ID: 917846880

View in Genome Browser
Species Human (GRCh38)
Location 1:179026602-179026624
Sequence GCCTTCCGCCTCCGGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 194}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917846880_917846885 -6 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846885 1:179026619-179026641 GAAGGCGGGGCAACCGTGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 114
917846880_917846897 24 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846897 1:179026649-179026671 GGTCTCCTGGGGTCCTGCGCCGG 0: 1
1: 0
2: 3
3: 17
4: 228
917846880_917846886 -5 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846886 1:179026620-179026642 AAGGCGGGGCAACCGTGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 69
917846880_917846898 25 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846898 1:179026650-179026672 GTCTCCTGGGGTCCTGCGCCGGG 0: 1
1: 0
2: 4
3: 18
4: 184
917846880_917846892 12 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 199
917846880_917846888 3 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846888 1:179026628-179026650 GCAACCGTGCCCGGGGCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 129
917846880_917846887 -4 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846887 1:179026621-179026643 AGGCGGGGCAACCGTGCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 71
917846880_917846890 11 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846890 1:179026636-179026658 GCCCGGGGCCCGCGGTCTCCTGG 0: 1
1: 0
2: 4
3: 37
4: 294
917846880_917846894 13 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846894 1:179026638-179026660 CCGGGGCCCGCGGTCTCCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917846880 Original CRISPR GCCTTCCGCCTCCGGCCTGC AGG (reversed) Intronic