ID: 917846884

View in Genome Browser
Species Human (GRCh38)
Location 1:179026610-179026632
Sequence GTTGCCCCGCCTTCCGCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917846884_917846901 30 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846901 1:179026663-179026685 CTGCGCCGGGCGCTCGCAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 68
917846884_917846894 5 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846894 1:179026638-179026660 CCGGGGCCCGCGGTCTCCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 163
917846884_917846888 -5 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846888 1:179026628-179026650 GCAACCGTGCCCGGGGCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 129
917846884_917846890 3 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846890 1:179026636-179026658 GCCCGGGGCCCGCGGTCTCCTGG 0: 1
1: 0
2: 4
3: 37
4: 294
917846884_917846892 4 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 199
917846884_917846898 17 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846898 1:179026650-179026672 GTCTCCTGGGGTCCTGCGCCGGG 0: 1
1: 0
2: 4
3: 18
4: 184
917846884_917846897 16 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846897 1:179026649-179026671 GGTCTCCTGGGGTCCTGCGCCGG 0: 1
1: 0
2: 3
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917846884 Original CRISPR GTTGCCCCGCCTTCCGCCTC CGG (reversed) Intronic