ID: 917846892

View in Genome Browser
Species Human (GRCh38)
Location 1:179026637-179026659
Sequence CCCGGGGCCCGCGGTCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917846884_917846892 4 Left 917846884 1:179026610-179026632 CCGGAGGCGGAAGGCGGGGCAAC 0: 1
1: 0
2: 2
3: 4
4: 117
Right 917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 199
917846874_917846892 29 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 199
917846880_917846892 12 Left 917846880 1:179026602-179026624 CCTGCAGGCCGGAGGCGGAAGGC 0: 1
1: 0
2: 0
3: 23
4: 194
Right 917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917846892 Original CRISPR CCCGGGGCCCGCGGTCTCCT GGG Intronic