ID: 917847115

View in Genome Browser
Species Human (GRCh38)
Location 1:179029004-179029026
Sequence AACCTGCACAGGCTACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917847115_917847120 28 Left 917847115 1:179029004-179029026 CCTGGCAGTAGCCTGTGCAGGTT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 917847120 1:179029055-179029077 TCCTACAGTCTGTTCTGGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 125
917847115_917847119 23 Left 917847115 1:179029004-179029026 CCTGGCAGTAGCCTGTGCAGGTT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 917847119 1:179029050-179029072 CTTGCTCCTACAGTCTGTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917847115 Original CRISPR AACCTGCACAGGCTACTGCC AGG (reversed) Intronic
900512410 1:3066918-3066940 AACCTGCAGAGGCTTCAGGCAGG + Intergenic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
907442577 1:54488289-54488311 ACCCTGCGGAGGCTGCTGCCCGG - Intergenic
907502029 1:54887616-54887638 GACCTGCAGAGGTTACCGCCAGG - Intergenic
908433780 1:64084839-64084861 CACCTGCACAGCCCACTGCAGGG - Intronic
917847115 1:179029004-179029026 AACCTGCACAGGCTACTGCCAGG - Intronic
920919690 1:210288253-210288275 CACCTGCCTAGGCTGCTGCCTGG - Intergenic
922991454 1:229916470-229916492 ACCCTGCACAGGCCACAGCATGG - Intergenic
1064257720 10:13758523-13758545 AACCTGCACAGGGTCTTGCCCGG + Intronic
1067607714 10:47681135-47681157 CACCTCCACCTGCTACTGCCTGG - Intergenic
1069999870 10:72368219-72368241 AATGTGCACAGGAAACTGCCTGG - Exonic
1071623272 10:87142532-87142554 CACCTCCACCTGCTACTGCCTGG - Intronic
1072451275 10:95541463-95541485 AACCTCCCAAGCCTACTGCCTGG + Intronic
1072539332 10:96386201-96386223 AACCGCCACAGGCCACTGCACGG + Exonic
1075054400 10:119207175-119207197 GACCCGCACTGGCTCCTGCCGGG + Intergenic
1075088313 10:119428803-119428825 ACCCTGCACAAGATCCTGCCTGG + Intronic
1076831157 10:132995003-132995025 AGCCTGCAGATGCTGCTGCCCGG + Intergenic
1076834066 10:133012190-133012212 AACCTGCAGGGGCAGCTGCCAGG + Intergenic
1077544893 11:3165039-3165061 TCCCCGCACTGGCTACTGCCAGG + Intronic
1078828450 11:14954288-14954310 AAAATGCACAGGATTCTGCCAGG - Intronic
1081335332 11:41858223-41858245 AATCTGCAGACGCTTCTGCCAGG - Intergenic
1083464388 11:62835430-62835452 CACCTGCACAGGGTACCACCAGG - Exonic
1083972286 11:66086563-66086585 TACATGCACAGGCTACTTCCAGG + Intronic
1084360270 11:68664603-68664625 CACCTGCACGGGCCAGTGCCTGG - Intergenic
1084473190 11:69374956-69374978 TCCCAGCACAGTCTACTGCCTGG + Intergenic
1084676961 11:70640977-70640999 AACATGGGCTGGCTACTGCCTGG + Intronic
1092013872 12:5140191-5140213 AACCTGCACAGATTCTTGCCTGG - Intergenic
1101241668 12:102845112-102845134 AACCTGCACAGGCTTCTACCTGG - Intronic
1102574713 12:113849120-113849142 CTCCTGCACAGGCAACAGCCAGG + Intronic
1103240736 12:119411327-119411349 AACCTAGAAAGGCTACTGTCTGG - Intronic
1104483312 12:129127841-129127863 TAACTGCACTGGTTACTGCCAGG + Intronic
1105678801 13:22704884-22704906 AACCTGCACAGGCCACTGGGTGG + Intergenic
1107720229 13:43240751-43240773 AACGTGCACATCCTACTTCCTGG - Intronic
1110584625 13:77174244-77174266 AACATACACAGTCTACTACCAGG - Intronic
1118694607 14:68372012-68372034 AACCTGCAAAGGAGACTGGCAGG + Intronic
1118952551 14:70447416-70447438 AACCTGCCCAGGGTCTTGCCTGG - Intergenic
1120996938 14:90424258-90424280 CACCTGGACACGCTAATGCCTGG - Intergenic
1122252434 14:100449375-100449397 AACCGCCACAGGCCAGTGCCAGG - Intronic
1122891561 14:104734463-104734485 AGCCTGCACATGCTAGTCCCAGG + Intronic
1125061833 15:35435425-35435447 AACCTGCACAGGGTTTTGCCTGG + Intronic
1125062492 15:35440667-35440689 AACCCGCACAGGGTCTTGCCTGG + Intronic
1126660629 15:51030163-51030185 GACCTGCAGAGACCACTGCCTGG + Intergenic
1128359741 15:66953674-66953696 AACCCGCACAGGGCTCTGCCTGG + Intergenic
1132331581 15:101015674-101015696 AACCTGCCTAGGGCACTGCCTGG - Intronic
1134290827 16:12901969-12901991 AAGCTGCCGAGGCTGCTGCCGGG - Exonic
1135859733 16:26044718-26044740 AACCTGCAGATGCCCCTGCCTGG - Intronic
1141652665 16:85401880-85401902 AACCAGCACAGGCTCACGCCAGG - Intergenic
1145789073 17:27613585-27613607 AACCTGCACAGGGTCTTGCCTGG - Intronic
1145806389 17:27736075-27736097 AACACTCACAGGCTACTGCAAGG - Intergenic
1145941185 17:28744183-28744205 AACCTGCACAGGCTCGCGCATGG - Exonic
1148211953 17:45813940-45813962 GACCTGCACCGGCCACTGCTGGG - Intronic
1149034041 17:52115044-52115066 AACCTGCACAGGGTCTTTCCTGG + Intronic
1149034684 17:52120645-52120667 AACCTGCACAGGGTCTTGCCTGG + Intronic
1150812322 17:68366408-68366430 ACCCTGCACAGGGCAGTGCCTGG - Intronic
1152235226 17:79135166-79135188 CACCTGCCCAGTCCACTGCCCGG + Intronic
1157207043 18:45709714-45709736 AAACAGCACAGGCAACGGCCTGG + Intergenic
1160940741 19:1619380-1619402 GACATGCACACGCTGCTGCCTGG - Exonic
1163650229 19:18513205-18513227 ACCCAGCACAGGCCACGGCCTGG - Intronic
1166291739 19:41868015-41868037 ACCCCACACAGACTACTGCCTGG + Intronic
1168310430 19:55457146-55457168 ACCCTGCACAGGCCACAACCTGG + Intronic
925203181 2:1985344-1985366 CACCTGCACTGCCTTCTGCCAGG - Intronic
926050998 2:9744777-9744799 AGCTTGCACAGCCTCCTGCCGGG - Intergenic
927391438 2:22599849-22599871 AAACTGCAGAGGGAACTGCCAGG + Intergenic
927869566 2:26615044-26615066 AACCAGCACTGGCAACTGCAGGG - Intronic
932655199 2:73604905-73604927 ATCCTGCACAGCCTCCCGCCAGG + Intronic
932663349 2:73676508-73676530 ATCCTGCACAGCCTCCCGCCAGG + Intergenic
932831957 2:74998804-74998826 AACCTGCACAAGGTCTTGCCTGG - Intergenic
933764656 2:85698405-85698427 AACCTGCTCAGGCTGCCGACTGG + Intronic
934662141 2:96148716-96148738 CACCCCCACAGGCTCCTGCCAGG + Intergenic
934720447 2:96571611-96571633 TCCCTGCACAGGCCACTGTCTGG + Intergenic
934915496 2:98298125-98298147 AACCTACACGGGCTCCTGCAGGG + Intronic
936511809 2:113154349-113154371 AACCTGCCCAGGCTTCCCCCTGG + Intergenic
936832112 2:116659318-116659340 AACCTGCACAGGGTCTTGCCTGG - Intergenic
937841217 2:126526534-126526556 ACCCTGCAGAGGCTTCTGCCTGG + Intergenic
943717571 2:191168701-191168723 AATCTTCACAGGCTCATGCCTGG - Intergenic
948482113 2:238256727-238256749 GACCTGGACAGGTTGCTGCCTGG + Intronic
948729020 2:239951908-239951930 CGCCTGCCCAGGCTCCTGCCTGG + Intronic
1172670887 20:36633760-36633782 TACCTGGACAGGCTAGTGCAGGG - Intronic
1174060938 20:47832690-47832712 AAGCAGCACCGGCTACTCCCTGG + Intergenic
1174070959 20:47898680-47898702 AAGCAGCACCGGCTACTCCCTGG - Intergenic
1174354182 20:49987435-49987457 AACCTGAACATGCTACTTCTGGG + Intronic
1175309184 20:57999566-57999588 AACGTGCACAGCCGACTGTCAGG + Intergenic
1176654909 21:9579633-9579655 CCCCTGCAAAGGCTCCTGCCCGG - Intergenic
1180910146 22:19444234-19444256 AAGCTGCACAGGCCAATGGCAGG + Exonic
1180920839 22:19520814-19520836 CACCTGCACCGGCCACTGCCTGG + Intergenic
1181116239 22:20634106-20634128 CACCTGCACAGGTGACTGCCTGG + Intergenic
1181413144 22:22739018-22739040 GACCTGCACAGGCATCTGGCAGG - Intronic
1182572387 22:31248878-31248900 AACCTCCGCTGGCTTCTGCCCGG - Intronic
949235652 3:1805862-1805884 CAGGTCCACAGGCTACTGCCAGG + Intergenic
950706927 3:14788608-14788630 AGCCTGCAGAGGCTTCTTCCAGG + Intergenic
952455501 3:33467972-33467994 AACATGCACAGGGTCTTGCCTGG - Intergenic
959158217 3:102692904-102692926 AGCCTGCACAGGGTCTTGCCTGG - Intergenic
961448422 3:126991801-126991823 CCCCTGCACAGGCTCCTGCGTGG - Intronic
962339310 3:134568546-134568568 AATATGAACAGGCTACTGCTGGG - Intronic
962375017 3:134852066-134852088 AAAGTGCACAGCCGACTGCCAGG - Intronic
963268803 3:143265819-143265841 CTCCTGCACAGTCTGCTGCCAGG + Exonic
963332327 3:143928371-143928393 AAGCTGCACACTCTACTTCCTGG - Intergenic
968643549 4:1727268-1727290 ACACAGCACAGGCTGCTGCCTGG - Intronic
974417812 4:61633304-61633326 AATCTTCACAGGGTTCTGCCAGG - Intronic
974417831 4:61633581-61633603 AATCTTCACAGGGTTCTGCCAGG - Intronic
974417849 4:61633858-61633880 AATCTTCACAGGGTTCTGCCAGG - Intronic
979053718 4:115969997-115970019 AACCTGCACAGGGTCTTGCCTGG - Intergenic
982184884 4:152785763-152785785 AACCTGCACTGTCTAATGCCAGG + Intronic
985067981 4:186142182-186142204 AACCCGCAGTGGCTGCTGCCTGG + Intronic
985391639 4:189496754-189496776 AACCGGCACAAGCTCCAGCCAGG - Intergenic
985495673 5:203680-203702 AACCTGCTCCCGCTCCTGCCTGG + Exonic
985549394 5:525346-525368 CACCTGCAAAGGCTCCTGCTCGG + Intergenic
985634900 5:1031117-1031139 ACCCTGCTCAGCCTCCTGCCTGG + Intronic
986565994 5:9115214-9115236 ACCCTGCACATTCTACTGACAGG + Intronic
990124582 5:52498378-52498400 CACCTGCACTGCCTGCTGCCAGG - Intergenic
990394925 5:55367555-55367577 AACATTCACAGGCTTATGCCAGG - Intronic
992737933 5:79742461-79742483 CAGCTGCAGTGGCTACTGCCTGG - Intronic
996665693 5:126057397-126057419 CACCTGTACAGGCAACTGCCAGG - Intergenic
998811522 5:145971339-145971361 AACCAGAACAGGCATCTGCCAGG - Intronic
999948263 5:156620863-156620885 ATCCTGCACAGTACACTGCCAGG - Intronic
1004140780 6:13014886-13014908 CAGCTGCAGAGGCTTCTGCCTGG - Intronic
1011158080 6:84355951-84355973 CACCTGCACATGCTTCTACCTGG + Intergenic
1012690195 6:102300504-102300526 GACCTGCAGTGACTACTGCCTGG - Intergenic
1013556615 6:111262786-111262808 AACCTGCCCAGGCTACACCCTGG + Intronic
1015739403 6:136437301-136437323 AACCTGCATTGGTTCCTGCCGGG - Intronic
1016172716 6:141040201-141040223 AACCTGCACAGGGTCTTGCTTGG + Intergenic
1016674748 6:146750852-146750874 AAGCTCCAAAGGCTTCTGCCAGG + Intronic
1021101241 7:16587244-16587266 AACCTGCACAGGGTCTTACCTGG - Intergenic
1022590365 7:31655433-31655455 AAACTGCACTGGCCTCTGCCAGG + Intronic
1024524937 7:50340037-50340059 GAACTGCACAGGCCACTTCCTGG - Intronic
1024586237 7:50844339-50844361 AACCAGCAGTGGCTTCTGCCAGG + Intergenic
1029002405 7:97167942-97167964 TACCTGCACAGGGTCTTGCCTGG + Intronic
1029374963 7:100171771-100171793 AACCTGCACCGGCTGGTGCGTGG - Exonic
1031128518 7:117803753-117803775 AACCAGAAAAGGCTACTGCAGGG + Intronic
1031889800 7:127281000-127281022 AACCTAGGCAGGCTACTTCCAGG - Intergenic
1033234250 7:139625636-139625658 ATCCTTCACAGGCCACTTCCTGG + Intronic
1033485445 7:141784680-141784702 AAGCAGCACAGGCTACAGACGGG - Intronic
1034126022 7:148672244-148672266 AGCCTGCACAGGGTCTTGCCTGG - Intergenic
1035026762 7:155831372-155831394 CAGCTCCACAGGCTTCTGCCCGG - Intergenic
1035754006 8:2017683-2017705 AACCTGCAGCGAGTACTGCCTGG + Intergenic
1036502360 8:9325514-9325536 AACCAGAACTGGCAACTGCCTGG + Intergenic
1037103569 8:15077966-15077988 AACCTGCACAGGGTCTTGCTTGG + Intronic
1047688261 8:127323239-127323261 CTCCTGTACAGGCTTCTGCCTGG - Intergenic
1049807507 8:144547618-144547640 GTCCTCCACAGGCTACTCCCCGG - Exonic
1050388263 9:5112147-5112169 AACGTGCACACGCTGCTACCCGG + Intronic
1052875667 9:33560407-33560429 AACCTGCACAGGGGCTTGCCTGG - Intronic
1053500343 9:38583937-38583959 AACCTGCACAGGGGCTTGCCTGG + Intergenic
1053591251 9:39516828-39516850 AAAATGCACAGGCTAATACCTGG - Intergenic
1053849095 9:42272185-42272207 AAAATGCACAGGCTAATGCCTGG - Intergenic
1054575057 9:66848465-66848487 AAAATGCACAGGCTAATACCTGG + Intergenic
1057679746 9:97168363-97168385 AACCTGCACAGGGGCTTGCCTGG + Intergenic
1058047831 9:100375913-100375935 AACCTGCACAGGGTCTTGTCAGG - Intergenic
1059057629 9:111000630-111000652 TAGCTGCACAGGTTCCTGCCTGG - Intronic
1060961920 9:127686930-127686952 AAACTGCAAAGGCTCCTGCTAGG + Intronic
1061006626 9:127931724-127931746 ATCCGGCACAGGCTTGTGCCAGG - Intergenic
1061574671 9:131498630-131498652 TACATGCAGAGGCTTCTGCCAGG + Exonic
1062133827 9:134914345-134914367 AGCCTGCAGAGACAACTGCCTGG + Intronic
1062572424 9:137191813-137191835 AATCTGCACAGCCCCCTGCCGGG + Exonic
1203632634 Un_KI270750v1:83086-83108 CCCCTGCAAAGGCTCCTGCCCGG - Intergenic
1187601777 X:20839343-20839365 CCCCTGCAAAGGCTCCTGCCTGG - Intergenic
1189947724 X:46196214-46196236 AACCTGCACAGGGTCTTCCCTGG + Intergenic
1190836045 X:54101592-54101614 AAAGTGCTCAGGCTACTGCATGG - Intronic
1190872470 X:54435718-54435740 CACTTGCACAGGCCACTTCCAGG + Intergenic
1196399823 X:115302704-115302726 AAGCTGCATAGGCAACTGTCGGG - Intronic
1199551852 X:149069458-149069480 AAACTGCAAAGGTTGCTGCCAGG + Intergenic
1202030828 Y:20572524-20572546 ACCCTGAACAGACTTCTGCCTGG + Intergenic