ID: 917848937

View in Genome Browser
Species Human (GRCh38)
Location 1:179043459-179043481
Sequence GGCTGCACACTCCACGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 2, 1: 33, 2: 62, 3: 96, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917848937_917848943 5 Left 917848937 1:179043459-179043481 CCAGCTCCGTGGAGTGTGCAGCC 0: 2
1: 33
2: 62
3: 96
4: 266
Right 917848943 1:179043487-179043509 CATGCCTCTCCCACTGCAGCTGG 0: 1
1: 7
2: 24
3: 119
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917848937 Original CRISPR GGCTGCACACTCCACGGAGC TGG (reversed) Intronic
900165974 1:1244529-1244551 GGCTGCACCCTGCAGAGAGCTGG + Intronic
900379901 1:2378538-2378560 ACCTGCTCACTGCACGGAGCAGG - Intronic
900641736 1:3690868-3690890 GTCTGCACACGCCAGGGAACTGG - Intronic
901936435 1:12630283-12630305 GGCTGCATGTTCCATGGAGCTGG + Intergenic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
902976223 1:20090471-20090493 GGCTGAAAGCTCCTCGGAGCAGG + Intronic
903082207 1:20819998-20820020 GGCCGTACACTGCATGGAGCCGG + Intronic
903312000 1:22465864-22465886 GGCTACATGTTCCACGGAGCAGG - Intronic
903335017 1:22618944-22618966 GGCTGGAGAATGCACGGAGCCGG - Intergenic
903672273 1:25043432-25043454 GGCTGCATTCTCCATGGAGCTGG - Intergenic
903750247 1:25616940-25616962 GGCTGCGCGCTCCGCGGAGCCGG + Intergenic
904390248 1:30180233-30180255 GGATGGACACTCCCAGGAGCTGG - Intergenic
905001147 1:34671165-34671187 GGCTGCACACTCCGTGAGGCAGG + Intergenic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG + Intergenic
907614675 1:55912368-55912390 GGCTGCATGCTGCATGGAGCCGG + Intergenic
907761655 1:57367680-57367702 GGTTCCACACTCCGTGGAGCTGG + Intronic
909054764 1:70807506-70807528 GGCTGCATGCTCCATGGAGCTGG - Intergenic
909282219 1:73770411-73770433 GGCTGCATGCTCCACGGAGCTGG + Intergenic
910602281 1:89044189-89044211 GGTTGCATGCTCCATGGAGCCGG - Intergenic
911504113 1:98727132-98727154 TGCTGCACACTCCACGTCCCGGG - Intronic
911715942 1:101133185-101133207 GGCTGCACCCACAACTGAGCAGG - Intergenic
912044373 1:105436702-105436724 GGCTGTGCACTCCACAGAGAAGG + Intergenic
912881954 1:113424162-113424184 AGCTGCACACTCCTTGGAGCTGG - Intronic
914392901 1:147237585-147237607 GGCTGCCAGCTCCATGGAGCTGG - Intronic
915980341 1:160416238-160416260 GGCTGGAGGCTCCACGGAGTGGG + Intronic
916648995 1:166817230-166817252 GGCTGTACACTCCATAGAACTGG - Intergenic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
918757478 1:188356329-188356351 GGCTGAGCGCTCCACAGAGCTGG - Intergenic
919513554 1:198494700-198494722 GGCTGCAGGCTCCATGGAGCCGG - Intergenic
920286485 1:204883463-204883485 AGCTGCACAGGCCACAGAGCGGG - Intronic
921767051 1:218983994-218984016 GGCTGCATACTCAATGGAGCTGG - Intergenic
922041801 1:221904298-221904320 GAGTGCACACTCCACAGAGCAGG - Intergenic
924179329 1:241424693-241424715 GCCTGAATGCTCCACGGAGCAGG + Intergenic
924672885 1:246147499-246147521 GGCTGCACACTCCATGGAGGCGG + Intronic
924679784 1:246220270-246220292 GCCTGCACACTCCACAGAGCAGG + Intronic
1063112210 10:3047001-3047023 GGCTGCTCCCACCACAGAGCTGG + Intergenic
1064859914 10:19816049-19816071 GGCTGCACTTTCCTCGGGGCTGG - Intergenic
1065201582 10:23317486-23317508 GGCTGTACACTCTACTAAGCTGG - Exonic
1065368112 10:24953905-24953927 AGCTGCACCCTCCAAGGCGCTGG - Intergenic
1066758827 10:38736475-38736497 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
1067170287 10:43900352-43900374 GCCTGCTCACTCCATGAAGCGGG + Intergenic
1068300503 10:55132100-55132122 GGCTACACACTCCATGGAGCTGG - Intronic
1068474304 10:57506581-57506603 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1069731905 10:70622555-70622577 GGCTGCACACTCCATAAAGCTGG + Intergenic
1070096333 10:73340959-73340981 GCCTACACGCTCCATGGAGCTGG - Intronic
1070959131 10:80486639-80486661 GGCTGTGCCCTCCAGGGAGCTGG - Intronic
1072871459 10:99124866-99124888 GGCTGCACACTCCATGGAGCTGG - Intronic
1074028670 10:109663339-109663361 GGCCTCCCACTCCATGGAGCAGG + Intergenic
1074537289 10:114337583-114337605 AGCTGCAGAGTCCACGGAGAGGG + Intronic
1074712956 10:116192738-116192760 GGCTGAACCCTCCACAGTGCTGG + Intronic
1074991660 10:118713412-118713434 GGCTGCATGCTCCATGGAGCCGG - Intronic
1075007646 10:118842266-118842288 GGCCTCCCACTCCACGGAGCAGG + Intergenic
1075121465 10:119667768-119667790 ATCTGCACACTCCACACAGCAGG - Intronic
1076220421 10:128729256-128729278 GGCTGCACCCTCCTCAGAGTGGG + Intergenic
1076648794 10:131972824-131972846 GGCTGGACACTCAGCTGAGCGGG - Intronic
1076655352 10:132019937-132019959 GGCTGCACACTCCACAGAGCCGG - Intergenic
1076670119 10:132115943-132115965 TGCTGGAAACTCCTCGGAGCGGG + Intronic
1077012216 11:384434-384456 GGCCTCCCACTCCACAGAGCAGG + Intergenic
1077476686 11:2793806-2793828 GGCTGTACATTCTAAGGAGCAGG - Intronic
1077894592 11:6444116-6444138 GGCTGTATACTCCAGGGAGCAGG + Intergenic
1077912596 11:6586589-6586611 GGCTGCATGCTCCATGGAGCCGG + Intronic
1078042911 11:7884616-7884638 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1078130939 11:8613630-8613652 GGCTGGAGACTCCAGGGAGTGGG + Exonic
1078315327 11:10289410-10289432 GGCTGCACACTCCACGGACCTGG - Intronic
1079733141 11:23961765-23961787 GGCTGCACACTCCATGGAGCTGG + Intergenic
1080333794 11:31173966-31173988 GGTTGCCCACTCCAAAGAGCTGG + Intronic
1080584091 11:33666005-33666027 GCCTTCCCCCTCCACGGAGCAGG - Intronic
1085212313 11:74791883-74791905 GGCTGTACGCTCCACGGAGCCGG - Intronic
1085334400 11:75679776-75679798 GGTTGCCCACTCCGCGGGGCTGG - Intergenic
1086092636 11:83020125-83020147 GGCCTCCCACTCCACGGAGCAGG + Intronic
1086341872 11:85855312-85855334 GGCTCCACTCTCCACGGGCCTGG + Exonic
1086947179 11:92854427-92854449 GGTTGCATGCTCCACGGGGCTGG - Intronic
1087036095 11:93758185-93758207 GGCTACACACTCTATGGAGCGGG + Intronic
1087038050 11:93773719-93773741 GGCTGCATGCTCCACAGAACTGG - Intronic
1088650937 11:111957929-111957951 GGCGGCACGCTCCACAGAGCTGG + Intronic
1088704413 11:112448406-112448428 GGCTGCACACTCCATGGAGCTGG - Intergenic
1089591764 11:119546403-119546425 GGCTGCATGCTCCACAGAGCTGG + Intergenic
1089823011 11:121246054-121246076 GGCTGTACACTCCATAGAGCTGG + Intergenic
1092501296 12:9050698-9050720 GGCCTCGCGCTCCACGGAGCAGG + Intergenic
1093059733 12:14589718-14589740 GGCCTCCCGCTCCACGGAGCAGG - Intergenic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1093493159 12:19726758-19726780 GGCCTCCCACTCCACAGAGCAGG - Intergenic
1094427145 12:30327802-30327824 GGCTGCACACTCCATGGAGCTGG + Intergenic
1095252586 12:39996593-39996615 GGCTACACACTGCATGGGGCGGG - Intronic
1096434491 12:51577138-51577160 GGCTGCACAGTCCACATGGCTGG + Intergenic
1098519748 12:71421470-71421492 GGCTGTGCACTCCACAGAGCTGG - Intronic
1098803121 12:74986152-74986174 CACTGCACGCTCCAGGGAGCTGG - Intergenic
1099049884 12:77768806-77768828 GGTTGCACACTCCATGGAGCTGG - Intergenic
1099683462 12:85857187-85857209 AGCTGTGCACTCCATGGAGCTGG - Intergenic
1103047472 12:117749267-117749289 GGCTGCCCACTTCTCAGAGCTGG - Intronic
1103991495 12:124802477-124802499 GGCTGCCTCCTCCACGGAGGAGG - Intronic
1105041704 12:132966472-132966494 GGCTACATGCTCCATGGAGCTGG + Intergenic
1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG + Intergenic
1107146940 13:37069941-37069963 GCCTGCACATTCCACAGAGCAGG + Intergenic
1109030157 13:57180136-57180158 GGCTGCATGCTCCATGGAGTTGG - Intergenic
1109396666 13:61766951-61766973 GCCTGCACGCTCCACAGAGTTGG - Intergenic
1109562883 13:64076002-64076024 GGCTGTGCACTCCACAGAGCTGG - Intergenic
1109622304 13:64925830-64925852 TGGTGCACACTCCACGGAGTGGG - Intergenic
1110939363 13:81330403-81330425 GGCTGCACACTCCATGACACAGG + Intergenic
1110980230 13:81888998-81889020 GGCTACACACTCCGAAGAGCTGG + Intergenic
1111354569 13:87080715-87080737 AGCTGCACACTCCGCAGAGCAGG - Intergenic
1111800627 13:92975404-92975426 GGTTGCACACTCCATGGAGCTGG - Intergenic
1112085953 13:96033323-96033345 GGTTGTGTACTCCACGGAGCTGG + Intronic
1113447355 13:110379616-110379638 GGGTGCACAGACCATGGAGCTGG + Intronic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115484839 14:33900856-33900878 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1115664811 14:35534698-35534720 GGCTGCTGGCGCCACGGAGCAGG - Exonic
1116130725 14:40854028-40854050 GGCTGCACACTACTTGGAGCTGG + Intergenic
1116257103 14:42570891-42570913 GGCTACACATTCCATGGAGCTGG + Intergenic
1117050381 14:51854395-51854417 GGCTCCACACTCCCCAGACCAGG - Intronic
1117285611 14:54283099-54283121 GGCTGGGCCCTCCATGGAGCTGG - Intergenic
1119618005 14:76111579-76111601 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1120745401 14:88147097-88147119 GGCCTCCCACTCCATGGAGCAGG + Intergenic
1121547358 14:94771722-94771744 GGCTGCCCACTCCCCGGCTCAGG + Intergenic
1121824768 14:97001081-97001103 GGCTGCACGTTCCATGGAGCAGG - Intergenic
1122869674 14:104632097-104632119 GGCTGCACAGTGCACAGGGCAGG + Intergenic
1123893374 15:24803329-24803351 GGCTGCATGCTCCACGGAGCTGG - Intergenic
1124055399 15:26237198-26237220 GGCTGCACACACCCCGGGCCTGG + Intergenic
1124650408 15:31469679-31469701 GGCTGCACACTCCATGGAGCTGG - Intergenic
1124848024 15:33310736-33310758 CGTTGCGCTCTCCACGGAGCGGG + Intergenic
1125752230 15:42036753-42036775 AGCTGCATGCTCCGCGGAGCTGG + Intronic
1125769564 15:42156164-42156186 GGCTGTAGAGTCCACGGAGCTGG - Intronic
1126797771 15:52274188-52274210 GACTGCACACTCCATGAAGGCGG - Intronic
1126942854 15:53784989-53785011 GGCTGCACACAGCAAGGAGAGGG + Intergenic
1127920973 15:63493846-63493868 GGCTGGACACTTCAGGGGGCAGG + Intergenic
1128790797 15:70432114-70432136 GGCTGCACACTCCATGGAGCTGG - Intergenic
1129331620 15:74830751-74830773 GGCTGGACACGCAAGGGAGCTGG - Exonic
1129684482 15:77677349-77677371 GGCTGGCCACTCCAGGGTGCTGG - Intronic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1130029183 15:80296245-80296267 GGCTGCACACTCCATGGAGCTGG - Intergenic
1130183011 15:81651101-81651123 GACTACACACTCCGTGGAGCTGG + Intergenic
1131110176 15:89760095-89760117 GGCTGCATCCTCCAGGGATCTGG - Intergenic
1131825547 15:96320696-96320718 CGCAGCACACTCCATGGAGATGG - Intergenic
1132039654 15:98514228-98514250 GACTGCACTTTCCATGGAGCAGG - Intronic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132971819 16:2692952-2692974 GGCTTCCCGCTCCACGGAGCAGG - Intronic
1135100299 16:19599317-19599339 GGCTGCAGACTCCAAGCACCTGG - Intronic
1135986678 16:27189386-27189408 GGCTGTGCACTCCACGGAGCTGG + Intergenic
1136253803 16:29024789-29024811 GGCTGCCCAACCCATGGAGCTGG - Intergenic
1137238422 16:46633976-46633998 GGCTGCACACTCCATGGAGCTGG - Intergenic
1137291691 16:47055819-47055841 GGCTGCACACTCCATGGAGCCGG - Intergenic
1137588496 16:49679262-49679284 GGCTGCGCCCTCCGTGGAGCTGG + Intronic
1139390114 16:66601963-66601985 GGCTGCACACTCCATGGAGCAGG - Intergenic
1143034952 17:3989448-3989470 TGCAGCTCACTCCAAGGAGCAGG - Intergenic
1143975306 17:10825066-10825088 GGCTCCACCCTCCATGCAGCCGG - Exonic
1144714353 17:17423975-17423997 GACTGCACACTCCATGGAGCTGG + Intergenic
1146086789 17:29837827-29837849 GGCTGCGCACTCCATGGAGCTGG + Intronic
1146143377 17:30388677-30388699 GGCTGCATGCTCCACTGAGTCGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148334731 17:46833573-46833595 GGCTGCCCACCACACTGAGCAGG - Intronic
1149085299 17:52709658-52709680 GGCTGCACACTACATGGAGCGGG + Intergenic
1149159790 17:53678159-53678181 GGCTGTGCACTCCATAGAGCCGG + Intergenic
1149160588 17:53687540-53687562 GGCTGCACACTCCATGGAGCTGG - Intergenic
1149330681 17:55577847-55577869 GGCCTCCCACTCCACAGAGCAGG - Intergenic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149454618 17:56777731-56777753 GGCTGCATCCTCCATGGAGATGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149934569 17:60792222-60792244 GGCTGCATGCTCCACGGAGCCGG + Intronic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151772983 17:76177199-76177221 GGCTGCATGCTCCACAGAGCCGG + Intronic
1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG + Intergenic
1152864316 17:82713105-82713127 GGCTGCGTGCTCCACGGAGCTGG - Intergenic
1153472969 18:5467851-5467873 GACTGCACGCTCCACAGAGCCGG + Intronic
1154357660 18:13633896-13633918 GGCTGTGTGCTCCACGGAGCCGG - Intronic
1155120861 18:22817001-22817023 GGCTGCACACTCCATGGAGCGGG - Intronic
1155275336 18:24181867-24181889 GGCAGCACACTCCACTGAGAAGG - Intronic
1155830975 18:30514264-30514286 GGCTGCACACTCCATGGAGCAGG - Intergenic
1156298984 18:35818473-35818495 GGCTGCACGCTCCGTGGAGCTGG - Intergenic
1157043006 18:44061662-44061684 GGCTGCTCGCTCCAAGGAGCCGG - Intergenic
1158045133 18:53146381-53146403 GGCTGCATCCTCTATGGAGCAGG + Intronic
1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG + Intergenic
1159186557 18:64983540-64983562 GGCTGCACCCTCCATGAAGCTGG + Intergenic
1159519255 18:69496390-69496412 GGCTGCACCCTCCATAGACCTGG - Intronic
1160147605 18:76377635-76377657 GGCTGCAAACTCCAGGCAGCTGG - Intronic
1160211565 18:76884890-76884912 GGATGCAGACCCCACGGAGAAGG - Intronic
1160474265 18:79168060-79168082 GGCTGCATGCTCCATGGAGCTGG - Intronic
1161181215 19:2883979-2884001 GAAAGTACACTCCACGGAGCGGG + Intergenic
1162231511 19:9270747-9270769 GGGCTCCCACTCCACGGAGCAGG + Intergenic
1165027105 19:32969949-32969971 GGCTGCACACTTCATGGAGCCGG - Intronic
1166179291 19:41095666-41095688 GGCTGCACTCTCTAGGGAGGAGG - Intronic
1166546304 19:43636347-43636369 GCCTGCACCCTTCCCGGAGCAGG - Intronic
1167013016 19:46821513-46821535 GGCTACACACTCCATGGAGCCGG + Intergenic
1167234918 19:48308628-48308650 GGCTGCACACTCCATGGAGCCGG + Intronic
1167234979 19:48308904-48308926 GGCCTCCCACTCCAGGGAGCAGG + Intronic
1167596624 19:50431790-50431812 GGCTGGACGCTCCCCGGAGGCGG + Intergenic
1168303266 19:55419264-55419286 GGCTGCACGTTTCATGGAGCCGG + Intergenic
1202652953 1_KI270707v1_random:23559-23581 GGCTGTGCACTCCTCGAAGCTGG + Intergenic
925387525 2:3472476-3472498 GCCAGCACACTCCACGGCTCAGG - Intronic
926859428 2:17292417-17292439 GGCTGCACACTCCATGGAGCTGG - Intergenic
927743328 2:25591346-25591368 GGCTGCATGCTCCATAGAGCTGG - Intronic
928470402 2:31569150-31569172 GGCTGCGCACTCCACAGAGCTGG - Intronic
928723801 2:34148419-34148441 GGCTATACACTCCACGGAGCAGG - Intergenic
929564325 2:42975223-42975245 CGCTGCCCACTCCCCGCAGCAGG + Intergenic
930800429 2:55437980-55438002 GACTGCACATTCCATGGAGCTGG + Intergenic
931005952 2:57850244-57850266 GGCTTCATCATCCACGGAGCAGG - Intergenic
931499890 2:62854820-62854842 GGCCACACACTCCAAGCAGCTGG + Intronic
932113445 2:69022793-69022815 GGCAGCACACACCTTGGAGCTGG + Intronic
932501742 2:72188174-72188196 GGCTGCAGACTCCATGGAGCTGG - Intronic
933093170 2:78146242-78146264 GCCTGCACACTCCACAGAGATGG + Intergenic
933420720 2:82042724-82042746 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
934238031 2:90248271-90248293 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
938195072 2:129319553-129319575 GTCAGCACACTCCATGGAGCTGG - Intergenic
938312520 2:130302273-130302295 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
938722196 2:134076715-134076737 GGCTGCATGCTCCATGGAGCCGG - Intergenic
939605814 2:144253958-144253980 GGCTGCACACAGCAGGGAGCAGG - Intronic
940396388 2:153196602-153196624 GCCTGCATGCTCCATGGAGCAGG - Intergenic
940422950 2:153499984-153500006 AGCTGTGCACTCCAGGGAGCTGG - Intergenic
940612343 2:156006981-156007003 GGTTGCATGCTCCATGGAGCCGG - Intergenic
942114490 2:172713835-172713857 GGCTGTGCGCTCCATGGAGCCGG - Intergenic
943190876 2:184679384-184679406 GGATGCATGCTCCATGGAGCTGG + Intronic
943223848 2:185144365-185144387 GGTTGTGCACTCCACTGAGCTGG + Intergenic
943427132 2:187750574-187750596 GGCTGGATGCTCCATGGAGCCGG - Intergenic
943526158 2:189020385-189020407 GGCTGCACACTCCATGGAGCTGG + Intergenic
943961062 2:194264646-194264668 GGCTACACACTCCATGGAGCAGG + Intergenic
944586456 2:201177983-201178005 GGGTGCACACTCCACGGAGCTGG + Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
945770528 2:214035888-214035910 GGCTGTGCACTCCATGGAGCTGG - Intronic
946495458 2:220191917-220191939 GGCCGTGCACTCCATGGAGCTGG + Intergenic
947327429 2:228993133-228993155 GGCTTCTCACTCCATGTAGCAGG - Intronic
948476197 2:238221379-238221401 GGCCTCCCGCTCCACGGAGCAGG - Intergenic
948633934 2:239321986-239322008 GGAAGTACACTCCACAGAGCAGG + Intronic
948716678 2:239869762-239869784 GGCAGCACACTCCCAGGACCAGG - Intergenic
1168983537 20:2027435-2027457 GGCTGCACACTCCATGGAGCTGG - Intergenic
1169309214 20:4521248-4521270 GGCTGCAGGCTCCACGGAGAGGG + Intergenic
1170043977 20:12066123-12066145 GGCCTCTCACTCCACAGAGCAGG - Intergenic
1170500888 20:16974629-16974651 GCCTGTACATTCCATGGAGCGGG + Intergenic
1170840510 20:19921568-19921590 GGATGCGAATTCCACGGAGCAGG - Intronic
1171285887 20:23937915-23937937 GGCTGCATGCTCCCCAGAGCTGG + Intergenic
1172346873 20:34209187-34209209 AGCTGCACATTGCACAGAGCTGG + Intronic
1172346899 20:34209310-34209332 GGCCTCCCACTCCACGGAGCAGG + Intronic
1172676537 20:36676841-36676863 GGCTGCACACGCCATGGAGCTGG + Intronic
1173524620 20:43722043-43722065 AGCTGCACACTCCATGGATCTGG - Intergenic
1175001494 20:55634001-55634023 GACTGCATACTCTACAGAGCAGG - Intergenic
1175064292 20:56272311-56272333 TGCTGCACACTCCATGAAGCTGG + Intergenic
1176021395 20:62964079-62964101 AGCTGCACATTCCCAGGAGCAGG + Intronic
1177736101 21:25092477-25092499 GGCTGCACACTCCATGGAGATGG - Intergenic
1178632158 21:34271401-34271423 GGCTGCACACTCTCCTGAGAAGG - Intergenic
1183777420 22:39975651-39975673 AGCTGTAAGCTCCACGGAGCAGG + Intergenic
1184054536 22:42035498-42035520 GGCTGCATGCTCCATGGAGAAGG - Intronic
1184173747 22:42774478-42774500 GGCTACACGTTCCATGGAGCTGG + Intergenic
1184561019 22:45262981-45263003 GGCCTCCCGCTCCACGGAGCAGG - Intergenic
1184665594 22:45987315-45987337 GGCCGCATACTCCATGGAGCAGG + Intergenic
1185024961 22:48403593-48403615 GATTGCACACCCCATGGAGCAGG + Intergenic
951264908 3:20553229-20553251 GGCCTCCCACTCCACGGAGCAGG - Intergenic
951509029 3:23480514-23480536 GGCTGCACCCTCCATGGAACCGG - Intronic
952016030 3:28958777-28958799 GGCTGAAGACTCCACGGAGCAGG + Intergenic
952269552 3:31817783-31817805 GGCTGCACACTCCATGGAGCTGG - Intronic
953163661 3:40445169-40445191 GGTTGTACACTCCATGGAACAGG + Intergenic
953801894 3:46031046-46031068 GGCTGCATGCTCCACACAGCCGG + Intergenic
954099477 3:48358205-48358227 GGCCTCCCACTCCATGGAGCAGG - Intergenic
954099491 3:48358285-48358307 GGCTTCCAGCTCCACGGAGCAGG - Intergenic
955241625 3:57183117-57183139 TGCTGCACACTCCATGGAGCCGG - Intergenic
957613917 3:82505205-82505227 GGCTGCATGCTCCACGGAGCTGG + Intergenic
957638368 3:82815818-82815840 GGCTTCCCACTCCACAGAGCTGG - Intergenic
957653255 3:83035831-83035853 GGCCCCACACTCTACAGAGCTGG - Intergenic
957678669 3:83404023-83404045 GGCCTCTCACTCCACGGAGCAGG + Intergenic
958019782 3:87981064-87981086 GGCTGTGCACTTCAGGGAGCTGG - Intergenic
958418605 3:93906581-93906603 GGCTGCACGTGCCATGGAGCTGG + Intronic
958584594 3:96069602-96069624 GGCTTTGCACTCCACAGAGCTGG - Intergenic
958636148 3:96750109-96750131 GGCCTCGCACTCCACAGAGCAGG + Intergenic
959037344 3:101383363-101383385 GACTGCAAATTCCACAGAGCTGG + Intronic
960447159 3:117762820-117762842 GTCTGGACACTGCCCGGAGCTGG - Intergenic
960634379 3:119768698-119768720 GGCCTCCCACTCCACAGAGCAGG - Intergenic
960634413 3:119768818-119768840 GGCTGCACCCTCCATGGAGCTGG - Intergenic
960690441 3:120341714-120341736 GGCTGCACATTCCATGGAGCTGG + Intronic
961311256 3:126003627-126003649 GTTTGCATACTCCACGGGGCCGG + Intergenic
961493460 3:127273919-127273941 GGATGCACACTCCATGGAGCCGG + Intergenic
961791276 3:129378453-129378475 GGCCTCCCACTCCACAGAGCAGG - Intergenic
962105419 3:132383727-132383749 GGCTGCATGCTCCATGGAGCCGG - Intergenic
962716539 3:138131032-138131054 GGCAGCAGACTCTACGGAACAGG + Exonic
962824689 3:139089260-139089282 GGCTGCACACTCCATGGAGCTGG - Intronic
965118748 3:164522693-164522715 GGCAGCACACTCCTTGAAGCCGG - Intergenic
965205314 3:165713729-165713751 GGTTGCACACTCCATGGAGCCGG - Intergenic
965541941 3:169879828-169879850 GACTGCACAATCCATGGAGCTGG + Intergenic
965813538 3:172614873-172614895 GGCTGCACACTCCATGGAGCTGG - Intergenic
966254051 3:177898351-177898373 GGCTGTGCACTCCGCAGAGCTGG + Intergenic
966491314 3:180531447-180531469 GGCTGCCCACTCCATGGAGCTGG + Intergenic
966840022 3:184081036-184081058 GGCTGCGCACTCCACTGAGCAGG + Intergenic
967480405 3:189966243-189966265 GGCTGCCCACTCCCTGGTGCTGG + Intronic
967650013 3:191974081-191974103 AGCTGCACACTCCATGAAGCTGG - Intergenic
968538853 4:1151979-1152001 GGCTGCATGCTCCATGGAACTGG - Intergenic
968953131 4:3704863-3704885 GGCTTCACAGTCCACAGAGCTGG - Intergenic
969194041 4:5546841-5546863 GGAGGCATACTCCATGGAGCTGG + Intronic
969582882 4:8076123-8076145 AGCTGCAGACTCCAGGGGGCTGG - Intronic
971869516 4:32216736-32216758 GGCCACACACTACACAGAGCTGG - Intergenic
972128436 4:35800690-35800712 GGCTGCATTATCCATGGAGCAGG + Intergenic
972158981 4:36199104-36199126 GGCTGCATACTCTACAGAGATGG - Intronic
972203734 4:36747331-36747353 GGCCACACACTCCATGGAGCCGG + Intergenic
972203805 4:36747591-36747613 GGCCTCCCACTCCACAGAGCAGG + Intergenic
972358425 4:38303894-38303916 GGCTGCATGCTCCACAGAGTGGG - Intergenic
972931174 4:44072619-44072641 GGCTTCCCACTCCACAGAGCAGG - Intergenic
974619720 4:64340143-64340165 GACTGCATGCTCCATGGAGCTGG + Intronic
976129546 4:81870424-81870446 GGCCGTTCACTCCATGGAGCTGG + Intronic
976728960 4:88244005-88244027 GGCTGCATGCACCACGGAACCGG + Intergenic
976922765 4:90458239-90458261 GGCGGTGCACTCCATGGAGCAGG - Intronic
978663546 4:111155145-111155167 GGCTGCGCACTCCATGGAGCTGG - Intergenic
978964697 4:114726073-114726095 GGCTGCACACTCCATGGAGCTGG - Intergenic
979010673 4:115365355-115365377 GGCTGCTCACTGCACAGAGCTGG + Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
982158173 4:152541028-152541050 GCCTGCACACTCCATGCAGCAGG - Intergenic
982773687 4:159420980-159421002 GGCTGCGCACTCGGCGCAGCTGG + Intergenic
984526873 4:180867449-180867471 GGCTGCACGCTCCACGGAGGTGG - Intergenic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
986503997 5:8430216-8430238 GGCCTCCCACTCCACGGAGCAGG - Intergenic
987875291 5:23674350-23674372 GGCTGCTTACTCCACGGAGCTGG + Intergenic
987920390 5:24272736-24272758 GCATGCACACTGCACGGATCAGG - Intergenic
988073857 5:26326567-26326589 GGCTGCATGCTCCATGGAGCGGG - Intergenic
991230750 5:64330784-64330806 GGCTGCACATTCCACAGAGCTGG + Intronic
991359458 5:65803841-65803863 GGCTGTGCGCTCCATGGAGCTGG - Intronic
992029794 5:72709515-72709537 GGCTGTACACTCCATGGAGCTGG - Intergenic
994066822 5:95553072-95553094 GGCTGGACAATCCACTCAGCAGG + Intronic
994245532 5:97471703-97471725 GGCTGCATGCTCCATGGAGCTGG - Intergenic
995745082 5:115394259-115394281 GGCTGCATGCTCCACGGATCAGG - Intergenic
996661963 5:126014833-126014855 GGCTGCAGCCTCCAGGGATCAGG - Intergenic
997798745 5:136838681-136838703 GGCCACACACTCCAGGCAGCTGG - Intergenic
998480653 5:142459800-142459822 GGCTGTGCACTTCACAGAGCTGG - Intergenic
998792168 5:145777617-145777639 GGCTGCACACTCCATGAAGCTGG + Intronic
1000854374 5:166379917-166379939 GGCTGCGTGCTCCACAGAGCTGG - Intergenic
1002643493 5:180641517-180641539 GGCTGCAGACTGGAGGGAGCTGG + Intronic
1002693834 5:181070789-181070811 AGCTGCACGCTCCAGGGAGCTGG - Intergenic
1002897936 6:1389977-1389999 GGCTGCACGCGCGGCGGAGCGGG - Exonic
1003000571 6:2328431-2328453 TGCTGCACCCTCCAAGTAGCTGG + Intergenic
1003527949 6:6913598-6913620 GGCTGGGCACCCCAGGGAGCTGG - Intergenic
1004520667 6:16358613-16358635 TGCTGCATACTCCATGGAGCTGG + Intronic
1004696891 6:18042557-18042579 GGCAGCACACTCCATGGAGCTGG + Intergenic
1005021561 6:21423665-21423687 GGCCTCTTACTCCACGGAGCAGG - Intergenic
1005021622 6:21423887-21423909 GGCTGCACACTCCATGGAGCCGG - Intergenic
1005501314 6:26431301-26431323 GGCTGGACACTTCACAGAGCAGG + Intergenic
1005811535 6:29519742-29519764 GGCTGCTCCCTCCAGGGAGGCGG + Intergenic
1006500747 6:34457572-34457594 GGCTGCACACTCCATGGAGCTGG + Intergenic
1006500815 6:34457848-34457870 GGCCTCCCACTCCATGGAGCAGG + Intergenic
1006621945 6:35371464-35371486 GGCTGCACACTCCAGCAGGCAGG - Intronic
1006867794 6:37222833-37222855 GGTTACACACTCCATGGAGCCGG - Intronic
1007116615 6:39347694-39347716 AGATGCAGACTCCGCGGAGCCGG - Intronic
1007649821 6:43412590-43412612 GGCCCCCCACTCCATGGAGCAGG + Intergenic
1008231482 6:48989613-48989635 TGCTGCATGCTCCATGGAGCTGG + Intergenic
1010887727 6:81264017-81264039 GGCTGCATGCTCTACAGAGCTGG - Intergenic
1011284300 6:85706762-85706784 GACTGCACACTCCACAGAACCGG - Intergenic
1012052423 6:94361911-94361933 TGCTGCACACTCCACGGAGCAGG - Intergenic
1012231258 6:96762954-96762976 GCCTGCAAACTCCATGGAGTGGG - Intergenic
1012401472 6:98845441-98845463 GGCTGCTGCCTCCACGAAGCCGG - Intergenic
1012749634 6:103140827-103140849 GGCTGCACACTCCACAGAGCTGG - Intergenic
1014227280 6:118862308-118862330 GGCTGTACGCTCCATGGAGCTGG - Intronic
1015434616 6:133172115-133172137 GGCTGAGCACTACATGGAGCTGG + Intergenic
1015455806 6:133424870-133424892 GGCTGCACACTCCATGGAGCGGG - Intronic
1017993830 6:159513619-159513641 GGCTGCACGCTCCATGGGGCTGG + Intergenic
1018065077 6:160118931-160118953 GGCCTCTCACTCCACAGAGCAGG - Intergenic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1019296247 7:276833-276855 GGCTGCACACCCCAGGTAGCTGG - Intergenic
1019537959 7:1538630-1538652 GGCCCCACACTCCTCGGGGCCGG + Intronic
1021561568 7:21972718-21972740 GGCTGCATACTCCATGGAGCCGG - Intergenic
1023790629 7:43750343-43750365 GGCTGCACACTCCATAGAGCTGG - Intergenic
1024254642 7:47531739-47531761 GGCTGCACTCTCCATGGAGCCGG + Intronic
1024786354 7:52911681-52911703 GGCTGTGCACTCCAGGGAGCTGG - Intergenic
1025942231 7:66082905-66082927 AGCTGCACACGGGACGGAGCCGG + Exonic
1027128239 7:75572622-75572644 GGCTGCACACTCCATGGAACAGG + Intronic
1027575064 7:79921778-79921800 GGCTGCCCAATCCATGGAGTCGG + Intergenic
1029439349 7:100578522-100578544 GGCAGCACACGCCAGGGAGTTGG + Intronic
1029824352 7:103173667-103173689 GTCTGCACACTCAACTGAGAAGG - Intergenic
1030514228 7:110520120-110520142 GGCCGCATGCTCCATGGAGCTGG - Intergenic
1030570170 7:111212992-111213014 GACTGCGCTCTCCACAGAGCTGG + Intronic
1030721819 7:112880909-112880931 AGCTACACACTCCATGAAGCTGG + Intronic
1031009632 7:116512438-116512460 GGATGCACACTCCACATCGCAGG + Intergenic
1031265187 7:119572422-119572444 GGCCTCCCACTCCACAGAGCAGG + Intergenic
1035239089 7:157518291-157518313 GGCTGCACAGTGCATGGCGCTGG - Intergenic
1035434698 7:158850467-158850489 GGCTGCACACTGCGTGGAGCTGG - Intergenic
1035843369 8:2836389-2836411 CCCTGCACACTACACAGAGCCGG - Intergenic
1039210264 8:35205080-35205102 GGCTGAACACTCCCAGGAGCTGG - Intergenic
1039549016 8:38429947-38429969 GGCTGCAGCCACCACGGGGCCGG + Exonic
1039921213 8:41895913-41895935 GGCTGCAGGCTCCGGGGAGCGGG - Intronic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1042196944 8:66238761-66238783 GGCTGCACATTCCACAGAGCTGG - Intergenic
1042337187 8:67640758-67640780 GACTGCACACTCCACAGAGTGGG - Intronic
1042395919 8:68292362-68292384 GGCTGGACACTCCATGGAGCCGG + Intergenic
1042687975 8:71462527-71462549 ACCTGCACACTCCACAGAGCGGG - Intronic
1043591991 8:81843374-81843396 GACTGTACACTCCACAGAGTGGG + Intergenic
1043734339 8:83724705-83724727 GGCTGCATTCTCCACAGAGCTGG - Intergenic
1044259349 8:90098837-90098859 GGCTGCACGCACCATGGAGCCGG - Intergenic
1044525114 8:93242321-93242343 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1044962200 8:97542478-97542500 GGCTGCACACTCCATGGAGCCGG + Intergenic
1045300869 8:100908686-100908708 GGCTCCAGGCTCCACGGAGCTGG - Intergenic
1046395392 8:113633322-113633344 GACTGCATTCTCCACGAAGCTGG - Intergenic
1046648035 8:116806797-116806819 GGCTGCACCTTGCACGGAGCTGG + Intronic
1047104805 8:121720426-121720448 GGCCTCCCACTCCATGGAGCAGG - Intergenic
1048339245 8:133526018-133526040 GGCTGCATGCTCCACAGAGCTGG - Intronic
1048421871 8:134284816-134284838 AGCTGCATGCTCCATGGAGCCGG - Intergenic
1048548079 8:135405301-135405323 GGCTGCACACTCCATGGAGCTGG - Intergenic
1049021622 8:139961195-139961217 GTCTGCCCACTACACAGAGCAGG + Intronic
1049400628 8:142425304-142425326 GATGGCTCACTCCACGGAGCAGG - Intergenic
1049823849 8:144654605-144654627 GGCTGCACACTCCATGGAGCTGG + Intergenic
1049826979 8:144675114-144675136 GGCTGCATGGTCCATGGAGCTGG - Intergenic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050182211 9:2933922-2933944 GGCTGCAAGCTCCACGGAGCTGG + Intergenic
1050947846 9:11549291-11549313 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1052448766 9:28598603-28598625 GGCTGCTCACACCACTGAACTGG - Intronic
1052707376 9:32010340-32010362 GGCTGCACACTCCACAGAGCTGG + Intergenic
1052708040 9:32016543-32016565 GGCCTCCCACTCCACAGAGCAGG - Intergenic
1053077909 9:35150730-35150752 GGCTACACACTCCATGGAGCCGG + Intergenic
1053197974 9:36135038-36135060 GGCTGCTCACTGCACGCAGAGGG - Intergenic
1053617232 9:39781206-39781228 GCCTGCATACTCCATGAAGCTGG + Intergenic
1053875415 9:42540571-42540593 GTCTGCATACTCCATGAAGCTGG + Intergenic
1053897228 9:42754064-42754086 GCCTGCATACTCCATGAAGCTGG - Intergenic
1054236285 9:62561153-62561175 GTCTGCATACTCCATGAAGCTGG - Intergenic
1054266934 9:62926231-62926253 GCCTGCATACTCCATGAAGCTGG - Intergenic
1054550427 9:66595685-66595707 GCCTGCATACTCCATGAAGCTGG - Intergenic
1055572502 9:77631860-77631882 GGCTGCATGTTCCATGGAGCTGG + Intronic
1057371753 9:94480065-94480087 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
1057468378 9:95337029-95337051 GGCTGCATGCTCCGTGGAGCTGG + Intergenic
1057548356 9:96034652-96034674 GGCTGCACACTCCATGAAGCTGG + Intergenic
1057548418 9:96034901-96034923 GGCCACCCACTCCATGGAGCAGG + Intergenic
1058545931 9:106060059-106060081 GGCTGCATGCTCCGCAGAGCAGG - Intergenic
1059401094 9:114071068-114071090 GGCTGCACACCCCATTGAGCTGG + Intronic
1060479265 9:124008603-124008625 GGCTGCCGGCGCCACGGAGCCGG - Intronic
1060810810 9:126610713-126610735 GGCTGCTCGCTCCACGCAGGCGG - Intergenic
1062184593 9:135211297-135211319 GACTGCACCCCCCACCGAGCAGG + Intergenic
1062329004 9:136028591-136028613 GGCTGCACGCTCCATGGAGCTGG + Intronic
1203751704 Un_GL000218v1:86653-86675 GGCTGTGCACTCCTCAGAGCTGG + Intergenic
1185935861 X:4256917-4256939 GGCTGTATGCTCCACTGAGCTGG + Intergenic
1186389436 X:9144055-9144077 GACTGCACACTCCGCGATGCAGG + Intronic
1188207632 X:27380266-27380288 GGCTGCACACTCCACAGAGTTGG + Intergenic
1188434752 X:30148028-30148050 GGCTCTGCACTCCATGGAGCTGG + Intergenic
1188727908 X:33607532-33607554 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1189083481 X:37997341-37997363 GGCCTCCCACTCCATGGAGCAGG + Intronic
1189360022 X:40343327-40343349 AGCTGTACACTCCATGGAGCCGG + Intergenic
1189856582 X:45229971-45229993 GGCCGCATGCTCCATGGAGCTGG - Intergenic
1190445033 X:50515303-50515325 GGCTGCACACTCCCTGGAGCTGG - Intergenic
1190620819 X:52285110-52285132 GGCTGCACACTGCATGAAACTGG - Intergenic
1190621038 X:52287517-52287539 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
1191221095 X:57989436-57989458 GGCATCTCACTCCATGGAGCAGG + Intergenic
1192267085 X:69546504-69546526 GGCTGCATGCTCCATGAAGCTGG + Intergenic
1193468855 X:81875949-81875971 GGCTGCATGCTCCAGGGAGCTGG - Intergenic
1194380129 X:93181183-93181205 GGCTGCACACCCCATGAAGCTGG + Intergenic
1195126400 X:101813396-101813418 GGCCTCCCACTCCAGGGAGCAGG + Intergenic
1195179182 X:102339940-102339962 GGCCTCCCACTCCAGGGAGCAGG - Intergenic
1195454366 X:105051431-105051453 GGCTTCCCACTCCATGGACCAGG - Intronic
1195454430 X:105051689-105051711 AGCTGCACACTCCATGCAGCCGG - Intronic
1195654888 X:107324403-107324425 TGTTGCACACTCCAAGGACCCGG + Intergenic
1196883846 X:120224176-120224198 GGCTGCACATTCCATGGAGCTGG - Intergenic
1197342084 X:125287035-125287057 GACTGCACACTCCATGGAGCTGG + Intergenic
1197796152 X:130300107-130300129 GGCTGCCCACTCCATGGAGCAGG - Intergenic
1197951950 X:131907825-131907847 TGCTGCACACTCCGTGGAGCCGG + Intergenic
1199103627 X:143837149-143837171 GACTGTACACTCCATGGAGCAGG + Intergenic
1199360111 X:146907548-146907570 GGCCCCTCACTCCATGGAGCAGG - Intergenic
1199716486 X:150510633-150510655 GCCTGCAACCTCCACGGAGTGGG - Intronic
1199861220 X:151801674-151801696 GGCCTCCCACTCCATGGAGCAGG - Intergenic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic