ID: 917854773

View in Genome Browser
Species Human (GRCh38)
Location 1:179091381-179091403
Sequence GTGGTGGTCCTGAAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917854765_917854773 21 Left 917854765 1:179091337-179091359 CCAGAAAGACAGTGTCTGTCTAA 0: 1
1: 0
2: 0
3: 15
4: 181
Right 917854773 1:179091381-179091403 GTGGTGGTCCTGAAGATGGGAGG 0: 1
1: 0
2: 3
3: 22
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917854773 Original CRISPR GTGGTGGTCCTGAAGATGGG AGG Intronic
900238150 1:1602089-1602111 GCTGTGGCCCTGAAGGTGGGTGG + Intergenic
900297028 1:1957088-1957110 TTGGAGGTCCTGAGGATGGATGG + Intronic
900436463 1:2633418-2633440 GGGGTGGTCCTGAAGGGGGTGGG + Intergenic
900735184 1:4295246-4295268 TTGGTGGTCCTGAGACTGGGTGG + Intergenic
900773021 1:4560959-4560981 GTTATGGCCCTGGAGATGGGTGG + Intergenic
900903362 1:5532620-5532642 CTGGTGGGGCTGAAGATGGTTGG + Intergenic
901018339 1:6243998-6244020 GGGGGGGTCCTGAAGGTGAGAGG + Intergenic
902276816 1:15345891-15345913 GTGGTGGTGCTGAAGGCTGGAGG - Intronic
905659379 1:39709759-39709781 GTGGTGGTCCTGGAGCTGCTGGG - Intronic
909251614 1:73364145-73364167 GTGGTTGCCCTGAGGATGAGGGG - Intergenic
915457774 1:156052113-156052135 GTGGAGGGACTGAAGCTGGGAGG - Intronic
916591926 1:166199746-166199768 GTTGCAATCCTGAAGATGGGAGG + Intergenic
917854773 1:179091381-179091403 GTGGTGGTCCTGAAGATGGGAGG + Intronic
918008154 1:180561409-180561431 GTGGTGTTGCAGGAGATGGGTGG + Intergenic
918441959 1:184576608-184576630 AGGGTGGGCCTGAAGCTGGGTGG - Intronic
920098218 1:203500161-203500183 GTGGTGGTGGTGGAGGTGGGTGG - Intronic
920098260 1:203500286-203500308 GTGGTGGTGGTGGAGGTGGGTGG - Intronic
920098310 1:203500449-203500471 GTGGTGGTGGTGGATATGGGTGG - Intronic
920258904 1:204675512-204675534 GTGCTGGTGTTGAAGATGGAAGG - Intronic
920393453 1:205626242-205626264 GTGCCGGTCCTGAATAAGGGAGG - Intronic
922514314 1:226195481-226195503 GCGGTGGTCCTGTAGGTGGTGGG + Intergenic
922691877 1:227699489-227699511 GGGGTGGTCCTGAAGTTGGGAGG - Intergenic
923080749 1:230652187-230652209 GTGGTGGTGCTGAAGGTGCCGGG - Intronic
924330343 1:242935229-242935251 ATGCTGGTCATCAAGATGGGAGG + Intergenic
924758093 1:246959847-246959869 GTGGCGGTTCTGAAGATAGGCGG + Intronic
1063974049 10:11401446-11401468 GTGGTGGCCCTGTGGCTGGGCGG - Intergenic
1069592956 10:69653057-69653079 GGGGAGGTCCTGAAGCCGGGGGG + Intergenic
1069613620 10:69792158-69792180 GTGGTGGTGGTGACGGTGGGTGG - Intergenic
1070382116 10:75890555-75890577 GTGAGGGTCCTGAAGTTGGCTGG + Intronic
1073803044 10:107064836-107064858 GTGGTTGTCTTGAAGATGGATGG - Intronic
1075040892 10:119105771-119105793 GTGGTGTGCCTGTAGGTGGGAGG + Intronic
1075075878 10:119349813-119349835 GTGGTGGTTCTGAGGATGATAGG - Intronic
1075778887 10:125004516-125004538 GTGTGGGTCTTGAAGATGTGAGG - Intronic
1077002974 11:334174-334196 GTGGTGGTCTTTGGGATGGGAGG - Intergenic
1078332685 11:10438857-10438879 GTGTTTTTCCTGAAGATGTGGGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084484117 11:69438121-69438143 AGGGTGGTCCTGAGGAAGGGTGG + Intergenic
1084882871 11:72184457-72184479 GTGGTGGTCCCTAAGATCTGTGG + Intergenic
1085171293 11:74451994-74452016 GTGGTGGTCAAGAAGAGGAGAGG - Intergenic
1088582662 11:111330858-111330880 GTGGTGGTGGGGAAGCTGGGCGG - Intergenic
1089492620 11:118893373-118893395 GTGGTGGTGCTGATGAAGGGAGG - Intronic
1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG + Intergenic
1091324671 11:134677240-134677262 GTGGTGGCCCAGAAGGTGAGAGG + Intergenic
1092212210 12:6653969-6653991 GTGGTGGTGCCTGAGATGGGAGG - Intronic
1096248817 12:50013490-50013512 ATGGTGGTTATGAAGATGGAAGG - Intronic
1098182431 12:67862206-67862228 GTGGTGGTGCTGAGGATGTAGGG + Intergenic
1100625503 12:96327390-96327412 GTGGCTGTACTGAAGATGGAGGG + Intronic
1101954782 12:109203663-109203685 CTGGTGGTCCTGAGGACAGGGGG - Intronic
1103323246 12:120103642-120103664 TTCCTGGTCCTGAAGATGTGAGG - Intronic
1104475405 12:129066846-129066868 GTGGTGGGCGTGAGGGTGGGTGG + Intergenic
1106257137 13:28031981-28032003 GTGGTGGTCATAGAGATGGAGGG + Intronic
1106789088 13:33136693-33136715 AGGGTGGTCCCGAAGTTGGGTGG - Intronic
1109892346 13:68631752-68631774 CTGGGGGTCCTGAAGATAGGAGG + Intergenic
1112856207 13:103772775-103772797 GTGGTAGAACTGAAGATGGTAGG + Intergenic
1115264167 14:31483687-31483709 GTGATTGTCTTGAAGTTGGGAGG + Exonic
1118317827 14:64736632-64736654 GCGGGGGTCCTGGAGATGGATGG + Intronic
1118786154 14:69046808-69046830 ATGGTGGTGCTGAAGATGACAGG - Intergenic
1120248670 14:82035711-82035733 GTGGTGTCCCTGAATATTGGAGG + Intergenic
1122638268 14:103140792-103140814 GTGGTGTTGCTGGAGATGGGAGG + Intergenic
1124262927 15:28208617-28208639 GTGGTGGGGCTGAAGCTGGATGG - Intronic
1126252781 15:46588314-46588336 GTGGTGGTCCTACTGCTGGGGGG + Intergenic
1128547929 15:68579831-68579853 GTGGTTGGCTTGAAGATGTGGGG + Intronic
1129140431 15:73593023-73593045 GGGGTGGTCTTGGGGATGGGGGG - Intronic
1129250360 15:74305408-74305430 GGGGTGGGCCTGGAGAGGGGAGG + Intronic
1129529295 15:76249807-76249829 GCGGTAGTTCTGAAGATGGGTGG - Intronic
1130893377 15:88151698-88151720 AAAGTGGTCCTGAAGATGGAAGG + Intronic
1132114935 15:99128733-99128755 GTCATGATCCTGAAGTTGGGAGG - Intronic
1132406625 15:101545386-101545408 GTGATGGTCCTGGAGATGGAAGG + Intergenic
1132636879 16:954159-954181 GTTTTAATCCTGAAGATGGGTGG + Intronic
1132881951 16:2166207-2166229 GTGGTGGTGCTGGAGATGTCAGG - Intronic
1133296333 16:4754288-4754310 AAGTTGGTCCTGGAGATGGGAGG - Intronic
1136064144 16:27747542-27747564 CTGGTGGTGCTGAAGCTGGAAGG - Intronic
1138068512 16:53967003-53967025 CTGCTGCTCCTCAAGATGGGAGG - Intronic
1139581657 16:67877427-67877449 GTGGTGGGACTGAAGAAGGGTGG + Intronic
1139715824 16:68812240-68812262 GTGGTGGGATTGAAGATCGGAGG - Exonic
1139783579 16:69371927-69371949 ATGGTGATCCTGCAGATGTGAGG - Intronic
1141947683 16:87321859-87321881 GTGGTGGTGGTGGTGATGGGGGG - Intronic
1143325415 17:6095268-6095290 GTGGTGGTCCTGAGAGAGGGGGG + Intronic
1143385768 17:6529693-6529715 GTTGTGGGCCTGATGATGAGTGG - Intronic
1143483634 17:7240737-7240759 GTGCCGGTCCTGAATAAGGGAGG + Exonic
1143730970 17:8882559-8882581 GTGGTGAATATGAAGATGGGTGG - Intronic
1144795847 17:17890711-17890733 GTGGTCATCCGGAAGGTGGGAGG + Intronic
1146178324 17:30680730-30680752 GTGGTGGCCTTGGAGGTGGGAGG + Intergenic
1147645139 17:42028787-42028809 GTTGTGAGCCTGAAGCTGGGAGG + Exonic
1148831157 17:50432473-50432495 GTGGGGCTGCTGGAGATGGGTGG + Intronic
1149221005 17:54415179-54415201 GGGGGGGTCCTGCAGATGGATGG - Intergenic
1151545224 17:74788781-74788803 GTGGTGGTCACGAAGCTGAGGGG - Exonic
1151562517 17:74878216-74878238 GTGGTGGACCTGGAGAGTGGAGG - Exonic
1152052204 17:77989114-77989136 GTGGCAGTTCTGAAGAAGGGAGG + Intergenic
1152858091 17:82677650-82677672 GTGCTGGCCCTGGAGACGGGTGG - Intronic
1153843511 18:9028297-9028319 CTTGCTGTCCTGAAGATGGGAGG - Intergenic
1155559846 18:27063872-27063894 GTGGGGGTGGTGAAGGTGGGAGG + Intronic
1157349992 18:46875625-46875647 TGGGTGGTTCTGGAGATGGGAGG - Intronic
1158254490 18:55530546-55530568 GAGGTGGCCCTGAAAAGGGGGGG + Intronic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1158490542 18:57906097-57906119 GTGGTGGTGCTGAGGAAGGCCGG + Intergenic
1160685839 19:436336-436358 GTGGGGGTCCTGTGGCTGGGGGG - Intronic
1162737052 19:12752472-12752494 GTGGCGGGCCGGAACATGGGTGG + Intronic
1162967213 19:14161590-14161612 GTGGTGGTCGTGCTGAGGGGTGG + Exonic
1162980276 19:14234723-14234745 GTGGTGGCCTTGGAGGTGGGAGG - Intergenic
1163831219 19:19548012-19548034 GTGGGGGTCCTGGGGAGGGGTGG + Intergenic
1166609367 19:44176386-44176408 CTGATGGTCCTGAAGATGAGAGG - Exonic
1166679917 19:44759714-44759736 ATCCTGGTCCCGAAGATGGGGGG - Exonic
1167562243 19:50232846-50232868 GTGGTGGAGCTGCAGAGGGGTGG + Intronic
1167850035 19:52194414-52194436 GTGAAGGCCTTGAAGATGGGAGG + Intronic
926076193 2:9944990-9945012 GTGGTGGTACTGCCAATGGGTGG - Intergenic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
928524126 2:32122241-32122263 TTGGTGTTCCAGAAAATGGGTGG + Intronic
929766361 2:44847211-44847233 GTGGAGGTTCTGAAGATGGATGG - Intergenic
931098437 2:58968501-58968523 GTGGTGGTGGTGATGATGGTAGG + Intergenic
935331305 2:101979721-101979743 GAGGAGGTCCTGAAGAAGGTCGG + Intergenic
935445066 2:103147492-103147514 ATGGTGGTGCTGTAGATGAGAGG + Intergenic
935557260 2:104523474-104523496 GAGGAAGTTCTGAAGATGGGTGG + Intergenic
936503450 2:113085029-113085051 GTGGTGGTTCTATTGATGGGTGG + Intergenic
937762041 2:125616374-125616396 GTTGTACTCCTGAAGATGTGTGG + Intergenic
938082205 2:128376268-128376290 GTGGCAGTCCAGAAGGTGGGAGG + Intergenic
938940399 2:136164581-136164603 GGGGTGGGCCTGGGGATGGGCGG + Intergenic
939079615 2:137644064-137644086 GTAGTGGTGCTGGTGATGGGTGG + Intronic
943070978 2:183140290-183140312 CTGGGGGTTCTGAAGATGGTAGG - Intronic
944442288 2:199754431-199754453 CTGGTGGCCCTGCAGATGGGAGG + Intergenic
946497287 2:220207317-220207339 GTGCTGGTGCTGTAGCTGGGAGG + Intergenic
946964136 2:225019208-225019230 GCGGGGGTCCTGAAGATGTGGGG - Intronic
947831296 2:233143774-233143796 GAGGTGGTCATGATCATGGGAGG + Intronic
948424569 2:237878859-237878881 TTGGTGCTCCCGAAGGTGGGAGG + Intronic
1170570801 20:17631434-17631456 TTGGGGTTCCTGAAGGTGGGTGG - Intronic
1172012109 20:31851548-31851570 CTGGTGGTGCTGCAGATGGAGGG + Intronic
1172162145 20:32876110-32876132 TTGGTGGGGCTGAAGATGGGAGG + Intronic
1174424011 20:50419369-50419391 GTGAAGGCTCTGAAGATGGGAGG + Intergenic
1176288646 21:5032966-5032988 GTGATGGTCCTGATGACGGGGGG + Intronic
1176428744 21:6563741-6563763 GTGGTCGTCCTGGAGAGGGTGGG - Intergenic
1179631909 21:42683984-42684006 GGGGTGGTCCTGCAGAAGGCGGG - Intronic
1179704234 21:43172057-43172079 GTGGTCGTCCTGGAGAGGGTGGG - Exonic
1179868538 21:44230509-44230531 GTGATGGTCCTGATGACGGGGGG - Intronic
1180127681 21:45803415-45803437 GGGGTGGTCCTGAGGAAAGGAGG + Intronic
1180975711 22:19846956-19846978 TTGGTGCTGCTGAGGATGGGAGG - Exonic
1181288518 22:21772505-21772527 GTGCTGGCCCTGAGGATGGCCGG - Intronic
1182719714 22:32387273-32387295 GTGGTGGTGCTGGTGATGGAGGG - Intergenic
1183198002 22:36366706-36366728 GGGCTGGGCCTGGAGATGGGAGG - Intronic
1184754803 22:46509719-46509741 GTGGGGCTCCTGAGGATGGCTGG + Intronic
949916002 3:8965107-8965129 CTGGTGCTGCTGAAGATGGCAGG - Intergenic
950105960 3:10388631-10388653 GTGGTGGGCCTGGAGATGTTTGG - Intronic
950853339 3:16083280-16083302 GTGGTGGTGCTGATCATGGCTGG + Intergenic
951215738 3:20023482-20023504 TTGATTGTCCTGAAGTTGGGAGG - Intergenic
951340219 3:21476974-21476996 GTGGTGGTTATAAAAATGGGTGG - Intronic
952970629 3:38648654-38648676 GTGGTGGTGATGAGGATGGGGGG - Intronic
954380736 3:50217712-50217734 GTGGTGTTGTTGAAGTTGGGGGG - Exonic
955474922 3:59326774-59326796 GTGGTGGTCATGAAGCTGGACGG - Intergenic
955774643 3:62420447-62420469 ATGGTGGTCCAGGAGCTGGGAGG + Intronic
956478374 3:69647746-69647768 GTGGTGGTGGTGACAATGGGAGG - Intergenic
959661315 3:108871697-108871719 GAGGTGGCACTGTAGATGGGTGG + Intergenic
960748516 3:120918090-120918112 GGGCTGGTTTTGAAGATGGGAGG - Intronic
961269028 3:125673706-125673728 TTGGTGGTCTGGAAGATAGGAGG - Intergenic
961656574 3:128445715-128445737 GTGGTGGTGCTGGAGGTGGTGGG + Intergenic
961726234 3:128932811-128932833 GTGGTAGTCCTCAAGATTGGGGG + Exonic
962100739 3:132339665-132339687 GTGGTGGTCCTGAAGAAGGCAGG - Intronic
962340752 3:134581034-134581056 TTGGTGGTTATGAAGATGGATGG + Intergenic
963934110 3:151034859-151034881 TTAGTGGCCGTGAAGATGGGTGG - Intergenic
965203289 3:165688674-165688696 TTGGTGCTGCTAAAGATGGGAGG - Intergenic
965939218 3:174157114-174157136 GTGGTGGACCTGAGGATGTGTGG + Intronic
966391656 3:179459172-179459194 TTGGAGGACTTGAAGATGGGGGG - Intergenic
966930590 3:184673092-184673114 CTGGTGGACCTGCAGTTGGGCGG + Intronic
967622211 3:191647952-191647974 GTGGTGATAATGAGGATGGGTGG - Intergenic
967750961 3:193115863-193115885 ATGGTGGTCATGAAGAAGGCTGG - Intergenic
968634108 4:1669026-1669048 GTGGTAGTTTTGAAAATGGGAGG - Intronic
969329190 4:6463344-6463366 GTCCTGGTCCTGAGGAGGGGTGG + Intronic
975927599 4:79477239-79477261 GTGGTCTTCCTGAAGGTGGAGGG - Intergenic
976135016 4:81926442-81926464 GTGGGGGTCCTGGGGATGGAGGG - Intronic
976832840 4:89334216-89334238 AAGCTGGTCCTGAAGTTGGGAGG - Intergenic
981339331 4:143602527-143602549 ATGGGGGACATGAAGATGGGAGG + Intronic
982069857 4:151685693-151685715 GTGTTGGTGCTGAAAATGTGTGG - Intronic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
985415517 4:189732310-189732332 GTGGGGGGTCTGAAGATGGCAGG - Intergenic
985691560 5:1315606-1315628 GTGCCGGTCCTGAAGCTGGAAGG + Intergenic
986351095 5:6880062-6880084 GTGGTTGTGCTGAATTTGGGAGG + Intergenic
987067338 5:14303045-14303067 TTGATGATCCTGGAGATGGGGGG + Intronic
987067356 5:14303117-14303139 TTGATGATCCTGGAGATGGGGGG + Intronic
987067373 5:14303189-14303211 TTGATGATCCTGGAGATGGGGGG + Intronic
989011338 5:36876422-36876444 GTGGTGGTCGTGAGCGTGGGGGG - Intergenic
989949068 5:50275504-50275526 GTGATGGTTTTGGAGATGGGGGG - Intergenic
990819797 5:59825407-59825429 GTGGTGGCACTGCACATGGGTGG + Intronic
995568421 5:113455375-113455397 GTGGTGGTGGTGATGGTGGGGGG - Intronic
998311347 5:141136092-141136114 GTGGTGGTCCCGGACCTGGGCGG - Exonic
999156907 5:149464689-149464711 GTGGAGGGCGTGAAGACGGGTGG - Intergenic
999200793 5:149814847-149814869 GTGGTGTTGCTGGAGAAGGGGGG + Intronic
1000332379 5:160215945-160215967 GTGTAAGTCCTGCAGATGGGAGG + Intronic
1001123189 5:168996768-168996790 GTGGTGCTCCTGACGGTGAGGGG + Intronic
1001752050 5:174138833-174138855 GTGGATGTCATGAAGGTGGGCGG - Intronic
1001937503 5:175715740-175715762 GCAGTGGTGATGAAGATGGGAGG - Intergenic
1002459353 5:179365297-179365319 GGGGTGGTCCTGGAGCAGGGTGG - Intergenic
1003272737 6:4621674-4621696 GTGGTTTTCCTGCAGATGTGGGG - Intergenic
1003450490 6:6226915-6226937 GTGGTGGTGGTGATGCTGGGGGG + Intronic
1006340378 6:33443416-33443438 GTGGTGGTGGTGGTGATGGGAGG - Exonic
1007109659 6:39305607-39305629 GTGGTGGTGATCAAGAAGGGTGG - Intronic
1007620855 6:43213610-43213632 GGGGTCGCCCTCAAGATGGGGGG + Intronic
1010474984 6:76276060-76276082 GTGGTGGTGGCCAAGATGGGTGG + Intergenic
1010915278 6:81609284-81609306 GTGGTGGTCTTGAAGAAATGTGG + Intronic
1012443856 6:99288910-99288932 GTGGTGGTCATGTAGATGGGTGG - Intronic
1017237445 6:152131635-152131657 GTGGTGGTCCTGAAGGTTTGCGG - Intronic
1021738733 7:23664192-23664214 GGGGTGGTAATGAGGATGGGGGG - Intergenic
1022465871 7:30653004-30653026 GTGGTGCCCCTGCAGTTGGGTGG - Intronic
1022818457 7:33935656-33935678 CTGGTTGTCCTTATGATGGGAGG - Intronic
1024294039 7:47828687-47828709 CTGCTGCTGCTGAAGATGGGTGG - Intronic
1024486782 7:49928488-49928510 GGGGTGGTCCTGAAGGAGAGTGG - Intronic
1026043546 7:66888639-66888661 TTGCTGTTCCTGCAGATGGGTGG + Intergenic
1028391554 7:90322215-90322237 GAGGTGGTCCTGCAGATAGAAGG - Intergenic
1029710065 7:102294645-102294667 GTTCTGGTCCCAAAGATGGGTGG + Intronic
1031598358 7:123673276-123673298 GTGGTGGTGATGGAGGTGGGTGG + Intergenic
1037425174 8:18747867-18747889 GTGCTGGTCCTGATGATTAGAGG - Intronic
1037632977 8:20675060-20675082 ATGGTGGCCCTGGAGATGTGAGG - Intergenic
1037952457 8:23028059-23028081 TGGCTGGGCCTGAAGATGGGAGG + Intronic
1037963628 8:23117327-23117349 TGGCTGGGCCTGAAGATGGGAGG - Exonic
1038307895 8:26421167-26421189 CTGGTGGTCCAGAAGGAGGGTGG + Intronic
1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG + Intergenic
1048985673 8:139733498-139733520 GTGGAGGTCCTGGAAGTGGGAGG + Intronic
1049126775 8:140796412-140796434 GTGGTGGTGCTGGTGGTGGGAGG - Intronic
1049156115 8:141067765-141067787 CTGTTGGGCCTGGAGATGGGAGG + Intergenic
1049298904 8:141859327-141859349 GAGGTGGTCCTTGAGTTGGGTGG + Intergenic
1051119025 9:13731353-13731375 GTGGTGGCCTAGAAGCTGGGTGG - Intergenic
1051661360 9:19430000-19430022 TTGGTGGTCATTACGATGGGAGG + Intronic
1052608979 9:30744295-30744317 GTGGTGGTCCTGCTGCTGGGAGG + Intergenic
1053163198 9:35827914-35827936 GTGGAGAACCAGAAGATGGGAGG + Intronic
1053442686 9:38128975-38128997 GTGGTTGTACTGATGGTGGGCGG + Intergenic
1055396393 9:75879560-75879582 GTGGTGGTGGTGGAGATGGTGGG + Intergenic
1055508912 9:76975370-76975392 GTGGTGGTGTTAAAGATAGGAGG + Intergenic
1055512954 9:77013346-77013368 GTGGTGGTGGTGGAGTTGGGGGG - Intergenic
1055599552 9:77901471-77901493 GTACTGCTCTTGAAGATGGGAGG - Intronic
1056552063 9:87660182-87660204 GTGGAGGCCCAGGAGATGGGAGG + Intronic
1059436288 9:114278512-114278534 GTAGTGGTGGTGATGATGGGTGG + Intronic
1061492710 9:130955082-130955104 ATGGTGGTGATGAAGATGGTAGG - Intergenic
1061492729 9:130955223-130955245 ATGGTGGTGATGAAGATGGTAGG - Intergenic
1203637421 Un_KI270750v1:125941-125963 GTGGGGGGTCTGAAGATGGCAGG + Intergenic
1186595666 X:10979104-10979126 ATGGTGGCCCTGAGGATGGATGG - Intergenic
1187377040 X:18764402-18764424 GTGGGTGTCCTGGGGATGGGTGG + Intronic
1188831311 X:34901048-34901070 GTTGTGGAACAGAAGATGGGTGG - Intergenic
1191879054 X:65826394-65826416 GTGGGGTTGCTGGAGATGGGAGG + Intergenic
1192805258 X:74503084-74503106 GTGATGGTCCTGAAGAGGGTGGG - Intronic
1193652458 X:84154645-84154667 GTGGTGGTGATGAAGTTGGTGGG - Intronic
1194936465 X:99955665-99955687 GTGATGGGCCTATAGATGGGAGG - Intergenic
1196809946 X:119620962-119620984 GTGGTGGTGCTGGGGGTGGGTGG - Intronic
1196809954 X:119620981-119621003 GTGGTGGTGCTGGGGGTGGGTGG - Intronic
1200225907 X:154417410-154417432 CTGGTGGTGCTGCAGTTGGGGGG + Intronic
1200827251 Y:7658169-7658191 GTGGTGGTCTTGTGGGTGGGTGG - Intergenic
1200988452 Y:9326955-9326977 GTGGTGGTCTTGGTGGTGGGTGG - Intergenic
1201227706 Y:11834364-11834386 ATGCTGGTCATGAAGTTGGGAGG + Intergenic
1202119550 Y:21509237-21509259 GTGGTGGTCTTGGTGGTGGGTGG + Intergenic
1202122002 Y:21532777-21532799 GTGGTGGTCTTGGTGGTGGGTGG + Intronic
1202157004 Y:21896605-21896627 GTGGTGGTCTTGGTGGTGGGTGG - Intronic
1202159450 Y:21920146-21920168 GTGGTGGTCTTGGTGGTGGGTGG - Intergenic
1202185897 Y:22185061-22185083 GTGGTGGTCTTGGTGGTGGGTGG - Intergenic
1202196944 Y:22306716-22306738 GTGGTGGTCCTGGCGGCGGGTGG + Intergenic
1202205463 Y:22401335-22401357 GTGGTGGTCTTGGTGGTGGGTGG + Intronic