ID: 917856040

View in Genome Browser
Species Human (GRCh38)
Location 1:179100838-179100860
Sequence CTGCTCCCTCAGAGTGAACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917856034_917856040 -1 Left 917856034 1:179100816-179100838 CCTTTCCCCTTCAACACGCCAGC 0: 1
1: 0
2: 0
3: 11
4: 204
Right 917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 212
917856037_917856040 -8 Left 917856037 1:179100823-179100845 CCTTCAACACGCCAGCTGCTCCC 0: 1
1: 0
2: 1
3: 18
4: 157
Right 917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 212
917856036_917856040 -7 Left 917856036 1:179100822-179100844 CCCTTCAACACGCCAGCTGCTCC 0: 1
1: 0
2: 0
3: 11
4: 118
Right 917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 212
917856035_917856040 -6 Left 917856035 1:179100821-179100843 CCCCTTCAACACGCCAGCTGCTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 212
917856033_917856040 4 Left 917856033 1:179100811-179100833 CCTGGCCTTTCCCCTTCAACACG 0: 1
1: 0
2: 0
3: 7
4: 145
Right 917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917856040 Original CRISPR CTGCTCCCTCAGAGTGAACA GGG Exonic
900207496 1:1437887-1437909 CTGCCCCCCCAGAGAGCACAGGG + Intronic
900461494 1:2804182-2804204 CTGCTCCCCAAGAGTGGACACGG + Intergenic
902214720 1:14927185-14927207 GAGCCCCCTCAGAGTGAACCAGG + Intronic
902294970 1:15461019-15461041 CTGCTACCGCTGCGTGAACAAGG - Intronic
902395605 1:16130940-16130962 CTGCTCCCTCACAGGGCACCAGG + Intronic
904978751 1:34479036-34479058 CTGTTCCATCAGAGTGGAGAAGG - Intergenic
905441368 1:37998215-37998237 CTCCTCTCTCAGCGTGAGCAGGG + Intronic
905850321 1:41269272-41269294 GTGATCCAGCAGAGTGAACAGGG - Intergenic
906569037 1:46820655-46820677 CTGGCCACTCCGAGTGAACAGGG - Intergenic
906838425 1:49109243-49109265 CTGTTCCCTCAGAGAGCAGAAGG - Intronic
907653638 1:56320565-56320587 TTTCTCCCTCAGAAAGAACATGG + Intergenic
909725350 1:78828324-78828346 CTGGCCCATCAGAGGGAACAGGG + Intergenic
910609883 1:89129322-89129344 CCAGTCCCTCAGAGAGAACAGGG + Intronic
910614271 1:89179909-89179931 CCAGTCCCTCAGAGAGAACAGGG + Intergenic
912175562 1:107151443-107151465 CTGCTCCCTCAGAGTCATTATGG + Intronic
912566136 1:110588916-110588938 CTCCTCCCTCAGAGAGTAAAGGG - Intergenic
912651136 1:111440701-111440723 CTTCTTCCTCAGAGTGAGCTGGG + Exonic
914347242 1:146810360-146810382 CTGCCTCCTAACAGTGAACAAGG + Intergenic
916025488 1:160830015-160830037 CTGCTGTCCCAGTGTGAACAGGG + Intergenic
916269051 1:162920223-162920245 CTGCTCTCACAGAGAGAAAAAGG - Intergenic
916573292 1:166045820-166045842 CTTCTCACTCAGAGTGAGCAGGG - Intergenic
917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG + Exonic
921216865 1:212945162-212945184 CTGCACCCTCAGAGGGATCCTGG - Intergenic
923076161 1:230610554-230610576 CTTCTCCCTCACTGAGAACAGGG - Intergenic
923463696 1:234230395-234230417 CTCCTCCCCTAGAGTGAAAATGG + Intronic
924372768 1:243371064-243371086 ATGCTTCTTCAGAGTGAACCAGG + Intronic
924687622 1:246311267-246311289 CTGCCACCTCAGAGTCAGCAAGG - Intronic
924946715 1:248851391-248851413 CTGCTGCCACACAGTGACCATGG - Intronic
1066340181 10:34524850-34524872 GTGTTCCCTCAAAGAGAACATGG + Intronic
1067709177 10:48635094-48635116 CCTCTTCCTCAGTGTGAACAAGG + Intronic
1069419860 10:68237625-68237647 CTGGTACCTTAGGGTGAACAGGG + Intergenic
1069599179 10:69692536-69692558 CAGCTCCCCCAGAGGAAACAGGG - Intergenic
1071563028 10:86657773-86657795 CGGCTCCCTCAGAGAGAAGCAGG - Intronic
1071765171 10:88655837-88655859 CCACACCCTTAGAGTGAACAAGG - Intergenic
1072971272 10:100019953-100019975 CTCCTCCTGCAGGGTGAACATGG + Intergenic
1075511117 10:123073702-123073724 TTTCTCCCACTGAGTGAACAGGG - Intergenic
1076801741 10:132834200-132834222 CTGCTGCCTTAGAGTGAAACAGG - Intronic
1076837600 10:133028947-133028969 CTGCTCACTCAGTGTGAACTGGG - Intergenic
1077281372 11:1747657-1747679 CTACTCCCTCAAAGTGAGCCCGG - Exonic
1077530073 11:3090923-3090945 CTGACCCCTCACAGTGAGCAAGG + Intronic
1078980699 11:16529738-16529760 CTGATACCTGAGAATGAACAAGG - Intronic
1080943898 11:36949799-36949821 CTACTCCCACAGAGAGAACCAGG + Intergenic
1081688331 11:45058058-45058080 CTGCTCCCTAAGAGTGTATGAGG - Intergenic
1083780501 11:64915059-64915081 CTGCTCATCCAGGGTGAACATGG - Intronic
1084364496 11:68688681-68688703 CAACTCCCTCACATTGAACAAGG + Intronic
1084974618 11:72790008-72790030 CTGCTGCCTCAGACTGATGAAGG + Intronic
1086404258 11:86486679-86486701 CTCTTCTCTCAGAGTAAACATGG + Intronic
1088750079 11:112835920-112835942 CAGATCACTCAGAGTGAAGATGG + Intergenic
1089209690 11:116791733-116791755 CTCCTCCCCCAGGGTGGACAGGG + Intronic
1090334918 11:125955599-125955621 TTGCTCCCTGAGAGTGAAGTGGG - Intergenic
1090929384 11:131281765-131281787 CTGCTCATTCAAAATGAACAGGG - Intergenic
1090966486 11:131601914-131601936 TTGCTTCATCAGAGAGAACAAGG - Intronic
1091572949 12:1706424-1706446 TTACTCCCTCAAAGTAAACACGG - Intronic
1092260207 12:6949338-6949360 GTGCTCCCCCAGAGGCAACATGG - Intronic
1094835082 12:34318521-34318543 ATGCACCATCAGTGTGAACAGGG + Intergenic
1095440269 12:42232282-42232304 CTGCACCATCACAGTGAAAAAGG + Intronic
1095729534 12:45491619-45491641 CTGATCTCTCATAGTGAGCAGGG + Intergenic
1096521634 12:52187826-52187848 CTCCACCCTCAGTGTAAACATGG - Intronic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1097373268 12:58809919-58809941 CTGCTCCCAAAGAGAGCACAGGG - Intronic
1097907775 12:64938236-64938258 CTGCTCCCACAGAATCTACAGGG - Intergenic
1099921198 12:88959162-88959184 CTGCTCCTTAAGAGTGAGAAAGG + Intergenic
1103561564 12:121795630-121795652 GAGCTCCCTCAGGGTGACCAGGG + Intronic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1105753225 13:23441078-23441100 CTGCTACCTCACAGTTGACAGGG + Intergenic
1107885892 13:44873872-44873894 CAGCACCCTCAGAGTCACCAGGG + Intergenic
1107952510 13:45476649-45476671 CTGTTCCCTCAGTGTGTGCATGG + Intronic
1115389014 14:32832743-32832765 CTGCTCCATAAGACAGAACAGGG - Exonic
1117301745 14:54436952-54436974 CTTCTCCCTGAGAGTGTAGAGGG - Intronic
1118629301 14:67688168-67688190 CTGAACCCTCAGACTGAATAAGG + Intronic
1122095247 14:99365897-99365919 CAGCGCCCTCAGAGGGACCATGG - Intergenic
1122138120 14:99646112-99646134 CTCCACCCTCAGAGGGAAGATGG - Intronic
1122834171 14:104423071-104423093 CAGCTCCCTGAGGGGGAACAAGG + Intergenic
1125130414 15:36278472-36278494 CTGCTCCCTCTGTGGGAAGAGGG + Intergenic
1128886036 15:71289196-71289218 CTTGCCCCTCAGAGTCAACAGGG - Intronic
1129988888 15:79944509-79944531 CTCCTCCCTCAGAATGAATGGGG + Intergenic
1130352574 15:83105536-83105558 CTGCTCCCTCAGAGCCCACAAGG - Intergenic
1130415432 15:83690263-83690285 GTGCTTCCTCAGGATGAACACGG + Intronic
1131262599 15:90895452-90895474 CTGCTCCATGAGCCTGAACACGG - Exonic
1133409797 16:5558712-5558734 CAGCCCCCTCAGAGTGCAGAGGG + Intergenic
1134470701 16:14522730-14522752 CTGCCCCCTCCAAGTGAAGAAGG + Intronic
1136008638 16:27348056-27348078 CTGCTCCCTGAGAGCCAACCAGG - Intronic
1138192114 16:55022103-55022125 CTGCTCCCCTGGAGTTAACAGGG - Intergenic
1139986746 16:70904908-70904930 CTGCCTCCTAACAGTGAACAAGG - Intronic
1140908590 16:79430751-79430773 CTTCTCCATCAGGGTGAGCACGG + Intergenic
1142203145 16:88770597-88770619 CTTCCCCCTCAGCCTGAACACGG + Intronic
1145264821 17:21374669-21374691 CTTCTCCCTCCGAGTGACCAAGG - Intergenic
1148164703 17:45475254-45475276 CTCCTCCCTCAGCCTGGACACGG - Exonic
1148794110 17:50189000-50189022 CTTCTCCCTTAGGGTGAACCTGG - Exonic
1148845509 17:50527635-50527657 CTGCTCACTGAGAAGGAACAAGG - Intronic
1150395921 17:64821921-64821943 CTCCTCCCTCAGCCTGGACACGG - Intergenic
1150839618 17:68595679-68595701 CTTCTCTCCCAGAGTCAACAGGG - Intronic
1152401164 17:80067077-80067099 CTGGACCCTCAGAGAGAACCTGG - Intronic
1152493772 17:80655939-80655961 CAGATGCCTTAGAGTGAACACGG + Intronic
1152743515 17:82028971-82028993 GTGCTTTCTCAGAATGAACAAGG + Intronic
1153227700 18:2910609-2910631 CTGCTCACGCACTGTGAACAGGG + Intronic
1154306883 18:13237171-13237193 CTGCTCCCTCATCTTGAAAATGG + Intronic
1154969076 18:21389052-21389074 CTGCTCCTTCAGTGTGATCTGGG - Intronic
1156736929 18:40271335-40271357 CTCTTCCCTCACACTGAACATGG - Intergenic
1157962443 18:52170631-52170653 CAGATCCTTCAGAGAGAACATGG + Intergenic
1160144603 18:76353299-76353321 CTTCTGCCTCAGAGGGATCAAGG - Intergenic
1160354542 18:78215988-78216010 CTGCACCTGGAGAGTGAACATGG - Intergenic
1160567716 18:79797782-79797804 GTGCTCCCTCCGAGTGGACTTGG + Intergenic
1161499703 19:4607136-4607158 CGGCTCCCGGAGAGGGAACAAGG - Intergenic
1168141596 19:54391604-54391626 CAGCTCACTCAGGGTGATCATGG - Intergenic
925033620 2:670803-670825 CAGCTCCCCCAGAGTAAACGCGG - Intronic
925106281 2:1295307-1295329 GAGTTCCCTCAGAGTGAACGGGG - Intronic
925906873 2:8544974-8544996 CTGCTCCCTGTGAGGGACCAAGG - Intergenic
926161943 2:10495505-10495527 CGGCTTCCTCAGAGTGTGCAGGG - Intergenic
926671296 2:15579325-15579347 CTGAGGCCTGAGAGTGAACAAGG - Intergenic
927236556 2:20880421-20880443 CTGCTCCCTCTGAGCGTGCAGGG + Intergenic
930614927 2:53583743-53583765 CTCCTCTCTCAGAGAGACCATGG - Intronic
931119674 2:59202241-59202263 CTGCACACTCAGAGTCAACCTGG - Intergenic
931459371 2:62437001-62437023 CTCCACCCCCAGAGTGAACATGG - Intergenic
932516918 2:72360500-72360522 CTTCTCCCTCAGTGGGAACATGG - Intronic
932658489 2:73631077-73631099 CAGATCCCTCAGAGTTAAAAAGG + Intergenic
932665102 2:73691084-73691106 CAGATCCCTCAGAGTTAAAAAGG + Intergenic
934477854 2:94604795-94604817 CTGCGCCCTCAGTAGGAACAAGG + Intergenic
937259598 2:120576958-120576980 CTGCTGCCTGCGTGTGAACAGGG + Intergenic
937292473 2:120790074-120790096 CTTCTTCCTCTGAGTCAACATGG + Intronic
937886295 2:126901857-126901879 CTTCTCCCTCAGCAGGAACAGGG + Exonic
942421729 2:175814683-175814705 CTGTCCCCAGAGAGTGAACATGG - Intergenic
944695054 2:202193302-202193324 CTGCTCCCTCTTAGTGAGGAGGG - Exonic
946374159 2:219298095-219298117 CTCCTCCCTCTGTGGGAACAAGG + Exonic
948571526 2:238920755-238920777 CTCTTCCCTCAGAGAGCACAGGG - Intergenic
948885215 2:240878863-240878885 CTGATCCCTCAGGGTGGGCATGG - Exonic
948988364 2:241539804-241539826 GGGCTCCCTCACAGAGAACACGG + Intergenic
1171493877 20:25540624-25540646 CTGCTCGCCCAGAAAGAACAGGG + Intronic
1172832219 20:37845682-37845704 CTGCAACCTCAGAGAGAAGACGG - Intronic
1173128710 20:40366015-40366037 CTGCTCCCTTAGTGTGCACCTGG + Intergenic
1173190230 20:40870351-40870373 TAGCTCCTTCAGAGGGAACATGG - Intergenic
1173420788 20:42899206-42899228 CTGCTCCCTCAAAATAAAAATGG - Intronic
1174040201 20:47694189-47694211 TCTCTCCCTCAGAGAGAACAGGG - Intronic
1174588268 20:51625305-51625327 CCGCTCCCTCAAAGTGGCCACGG - Exonic
1175442123 20:58999636-58999658 CTGCCACTTCAGAGTGCACAGGG + Intronic
1177500447 21:21948024-21948046 TTGCTTCCTCAAAGTCAACAAGG - Intergenic
1178972515 21:37193750-37193772 CTGTGCCCTCAAAGTGCACATGG + Intronic
1179359924 21:40696237-40696259 CAGCTCGCTCAGAGAGAACGGGG + Intronic
1180160856 21:45998109-45998131 CTGCTCCCCCAGGGAGAAGACGG + Exonic
1180214423 21:46315444-46315466 CTGCACCCTCTGAGCGAACCTGG - Intronic
1183186983 22:36297776-36297798 CTGCTCACTCTCAGTGCACACGG + Intronic
1183545442 22:38452806-38452828 CTGGCCCCTCAGAGTGAGGAGGG - Intronic
1184886162 22:47345575-47345597 CTGCTCCCTCAGAAGCACCAGGG + Intergenic
950782605 3:15404909-15404931 CTGCTCCCCAATAGAGAACATGG + Intronic
952207224 3:31192015-31192037 CTCCTCCTTCACAGTGAAAATGG + Intergenic
952855902 3:37770714-37770736 CAGATCCCCTAGAGTGAACAGGG + Intronic
954132555 3:48567881-48567903 TTTCTCCCTCAGGGTGAACGGGG - Exonic
956769129 3:72509668-72509690 CTGCTCTGTCTCAGTGAACAAGG - Intergenic
957172495 3:76756620-76756642 ATGATCCATCAGAGTTAACATGG + Intronic
957279950 3:78137541-78137563 TTGCTCCATCATAGTGACCAAGG + Intergenic
959896505 3:111612681-111612703 CTGCTGCCTCAAAGAGTACATGG + Intronic
960086641 3:113598149-113598171 CAGCTGCCTCAAAATGAACAGGG + Intronic
960710030 3:120518800-120518822 CTGCTCCCTGAAAGTGTACAGGG - Intergenic
962317109 3:134365807-134365829 CTGCTTGCTCAGAGTGAGTAGGG - Exonic
963127399 3:141828004-141828026 CTCCTCCCTCCTAGTGAGCAGGG - Intergenic
966230051 3:177641896-177641918 TTGCACGCTCAGAGTGCACAGGG - Intergenic
967962306 3:194935570-194935592 CTACGCCCCCAGAATGAACAAGG + Intergenic
970283009 4:14478824-14478846 CTGCTCCAGCAGAGATAACAGGG - Intergenic
976456708 4:85256370-85256392 CTGCTACCTCAGAGGAATCATGG - Intergenic
977346461 4:95822689-95822711 CTGCTCTCTGAGAGAGAATATGG + Intergenic
977797050 4:101178930-101178952 CTGCTGACTAAGAGTGACCAGGG - Intronic
978773492 4:112482404-112482426 CTTCTCCCTGAGAGTGACAAGGG + Intergenic
979671355 4:123363322-123363344 CTGCTCCATCAGAGTGGATTGGG - Intergenic
980841390 4:138265716-138265738 CTACTCTCTCAGAGTAAGCAAGG - Intergenic
986037368 5:3952967-3952989 CTGTTCCCTCAGACAGCACAGGG + Intergenic
986556036 5:9010428-9010450 CCACTCCCTCAGGGTGAACTGGG + Intergenic
987621503 5:20342390-20342412 CTGTTCCCTCAGGGAGCACAGGG - Intronic
989161971 5:38399810-38399832 CTGCTCCTTTTGAGTGAAGATGG + Intronic
990370934 5:55117670-55117692 GTGCTCCCTCAGTGTGTTCATGG + Intronic
990658204 5:57981733-57981755 TTGCTCCCTCTGAATTAACACGG + Intergenic
992571693 5:78065558-78065580 CTGCTTCTTTAGAGTGAACATGG + Intronic
993078564 5:83267630-83267652 CTGCTCCCTGAGACTGTCCAGGG - Intronic
998285042 5:140850864-140850886 CTGCTTCCTCAGATTCAACTGGG + Exonic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
1001905147 5:175465907-175465929 CTATGCCCTCAGAGAGAACAAGG - Intergenic
1002025150 5:176391775-176391797 CAGCTCCTTCAGAGGGAGCATGG + Intronic
1004253597 6:14042922-14042944 CTGCTACTAGAGAGTGAACAGGG - Intergenic
1006790640 6:36698916-36698938 CTGGTCCCTCAGAGACAGCAAGG - Intronic
1007319139 6:41013897-41013919 CTGCTCCCTCAGGGAGAACCAGG - Intergenic
1008254979 6:49287072-49287094 CTGCTCACTAACAGTGAACCTGG - Intergenic
1010340697 6:74749003-74749025 CTGTTTCCTTAGAATGAACATGG + Intergenic
1012831476 6:104208753-104208775 CTGCTCCCTCAGGTCCAACAAGG - Intergenic
1013715412 6:112955283-112955305 CTTTACCATCAGAGTGAACAGGG + Intergenic
1016219612 6:141651578-141651600 TTGTTTGCTCAGAGTGAACATGG - Intergenic
1017818568 6:158032434-158032456 CTCCTCCCTGAGAGTGAGTATGG + Intronic
1018409020 6:163522309-163522331 CTACACCCTGTGAGTGAACAAGG - Intronic
1021791777 7:24213240-24213262 CTGCTGCCTCAGAATCACCAAGG + Intergenic
1022471362 7:30683468-30683490 CTGCACCCTCAGAGTGCCCAGGG + Intronic
1024575948 7:50764204-50764226 CTGATCCCTCAGGGTGGACAGGG - Intronic
1028917365 7:96274150-96274172 CTGCTCCCTCCCAGTCATCAAGG + Intronic
1028985492 7:97005727-97005749 CTCCTCCCTTTGAGTTAACAAGG + Exonic
1030841297 7:114357648-114357670 CTGCTCACTGAGAGTGATGAAGG - Intronic
1033208146 7:139439964-139439986 CGGCACCATCAGAGGGAACATGG - Intergenic
1035042886 7:155943448-155943470 CTGCTGGCTCTGGGTGAACAGGG + Intergenic
1037770269 8:21794847-21794869 CTGATCCCAAAGAATGAACAGGG + Intronic
1038891435 8:31728953-31728975 CTTCTAACTCAGAGTCAACATGG - Intronic
1039122818 8:34167936-34167958 TTTCTCCCTCAAAATGAACAAGG + Intergenic
1044418257 8:91961020-91961042 CTGCTCCTTCAGACTAGACAAGG + Intronic
1045696852 8:104818817-104818839 CTGCTCCCTGATAATGAAAAAGG + Intronic
1045725036 8:105161873-105161895 CTGCCACCTCAGAGTGAATGGGG + Intronic
1046027722 8:108745665-108745687 CTCCTCCCTTAGAGTGACAAAGG - Intronic
1046852016 8:118985113-118985135 CTGTACCCTCAGAGAGAGCATGG + Intergenic
1047298473 8:123591892-123591914 CTGCCCCCTCAGAGGTCACATGG + Intergenic
1049990037 9:981838-981860 CTGCTTCCTGACAGTGACCAAGG - Intronic
1050361812 9:4837616-4837638 CTGCACACCCAGAGAGAACAAGG - Intronic
1052852101 9:33384761-33384783 CTGCGCCCTCAGTAGGAACAGGG - Intronic
1053680205 9:40481312-40481334 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1053930196 9:43109622-43109644 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054283507 9:63143623-63143645 CTGCGCCCTCAGTAGGAACAAGG + Intergenic
1054293285 9:63316822-63316844 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054391313 9:64621315-64621337 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054504416 9:65895012-65895034 CTGCGCCCTCAGTAGGAACAAGG + Exonic
1054806756 9:69403155-69403177 CTGCTACCTTAGAGTGACCATGG + Intergenic
1057815342 9:98290105-98290127 CTCCTCCCCCAGAGTGGAGAAGG + Exonic
1059527818 9:115008419-115008441 TTGCTCCCTCAGTGTGGCCATGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060406497 9:123375586-123375608 CGGCTTCCTCAGAGTGCCCAGGG + Intronic
1062434531 9:136541013-136541035 CAGCTCCGTCAGTGTGAGCAAGG - Intronic
1062440722 9:136568131-136568153 CTGCTGCCTCACAGAGTACAGGG - Intergenic
1186207597 X:7216644-7216666 CTGCTCACTCAGACTGAGGATGG + Intergenic
1186612333 X:11149778-11149800 ATGCTCCCCCAGAATGAAGAAGG + Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1194431470 X:93812040-93812062 CTGTTCTCTCAGACTGAAAAAGG - Intergenic
1195475172 X:105277166-105277188 CTGCCTGCTCATAGTGAACATGG - Intronic
1198312441 X:135435607-135435629 CTGCTCCCTCAGAGAGGCCTGGG - Intergenic
1200275973 X:154732870-154732892 CTGCTCCATCAGAGACCACAGGG + Intronic
1201579428 Y:15495315-15495337 CTGCTCACTCAGACTGAGGATGG + Intergenic