ID: 917856917

View in Genome Browser
Species Human (GRCh38)
Location 1:179108580-179108602
Sequence AAGGGTAAAGAGAAGAATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 982
Summary {0: 1, 1: 1, 2: 5, 3: 82, 4: 893}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917856917_917856926 13 Left 917856917 1:179108580-179108602 CCACCATTCTTCTCTTTACCCTT 0: 1
1: 1
2: 5
3: 82
4: 893
Right 917856926 1:179108616-179108638 ACTCCAGCCACTCCCACCCCTGG 0: 1
1: 1
2: 2
3: 61
4: 598
917856917_917856928 16 Left 917856917 1:179108580-179108602 CCACCATTCTTCTCTTTACCCTT 0: 1
1: 1
2: 5
3: 82
4: 893
Right 917856928 1:179108619-179108641 CCAGCCACTCCCACCCCTGGAGG 0: 1
1: 0
2: 4
3: 50
4: 472
917856917_917856929 17 Left 917856917 1:179108580-179108602 CCACCATTCTTCTCTTTACCCTT 0: 1
1: 1
2: 5
3: 82
4: 893
Right 917856929 1:179108620-179108642 CAGCCACTCCCACCCCTGGAGGG 0: 1
1: 0
2: 5
3: 29
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917856917 Original CRISPR AAGGGTAAAGAGAAGAATGG TGG (reversed) Exonic
900323392 1:2095829-2095851 AGGGGAAAAGAGGAGAAGGGAGG - Intronic
900471398 1:2856752-2856774 AAATGGAAAGAGAAGAAGGGAGG - Intergenic
901172342 1:7268250-7268272 AAGAGTACAGAGGAGAAGGGGGG + Intronic
901178538 1:7322964-7322986 AAGGGGAAAGGGAGGAACGGAGG - Intronic
902706018 1:18205097-18205119 ATGGGGAGAGAGAGGAATGGGGG + Intronic
902734895 1:18394092-18394114 AAGGGCAGAGACAAGAATGGGGG - Intergenic
903082390 1:20820734-20820756 GAGGGTAGAGAGACGATTGGAGG + Intronic
903397847 1:23015800-23015822 AGAGGCAAAGAGTAGAATGGTGG + Exonic
903770595 1:25761593-25761615 AGAGGTAGAGAGTAGAATGGTGG - Intronic
904209070 1:28873872-28873894 AAGGGAAAAGGAAAGACTGGTGG + Intergenic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
904871278 1:33620049-33620071 GAGGCTGAAGAGAAAAATGGAGG + Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904902005 1:33864966-33864988 AAGGGAAAGGAGGGGAATGGAGG + Intronic
905255306 1:36677925-36677947 TTTGGTACAGAGAAGAATGGAGG + Intergenic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905948362 1:41923447-41923469 AGGAGTAGAGAGTAGAATGGTGG + Intronic
906086933 1:43144215-43144237 AATGGCAAAGAGAAGAAATGGGG - Intergenic
906391059 1:45416771-45416793 AAATGTGGAGAGAAGAATGGTGG - Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
908849764 1:68363871-68363893 AAGGGAAAAGAGAAAATAGGAGG + Intergenic
908965761 1:69760526-69760548 AAAGGTAATGAGAATATTGGGGG - Intronic
909274125 1:73663408-73663430 AAGGGTGGAGGGAAGAAGGGAGG - Intergenic
909297928 1:73974764-73974786 AAGGGAATAGGGAAGAATAGTGG + Intergenic
909511721 1:76460927-76460949 ATGGGTAAAGAGAGGAATGGTGG + Intronic
909524849 1:76611525-76611547 AGGGGTATGGAGAAGAGTGGAGG - Intronic
910537147 1:88311253-88311275 AAGGGTCAAGAGTAGAATACAGG - Intergenic
910937810 1:92500152-92500174 AAGAGCAGAGAGTAGAATGGTGG - Intergenic
910946807 1:92601662-92601684 AAAAGTACAGAGTAGAATGGTGG + Intronic
911083380 1:93955824-93955846 AAAGGTAAAGAGAAGACTAAAGG - Intergenic
911104156 1:94117098-94117120 AATGGTAAAGAGAGGAGGGGAGG - Intronic
911366701 1:96947292-96947314 AAGGGTAAAGAAAAGAGAAGGGG - Intergenic
911400333 1:97366859-97366881 AAGGTTAGAGAAAAGAATGTGGG - Intronic
912099395 1:106186754-106186776 AAGAATAGAGAGAACAATGGAGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912667395 1:111594519-111594541 AAGGGGAAAGGGAAGAAGGAAGG + Intronic
912961121 1:114196807-114196829 AAGGGGAAAGAAAAGAAGTGAGG + Intergenic
913182647 1:116337005-116337027 GAGGGAAAAGAAAGGAATGGGGG - Intergenic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914087365 1:144465223-144465245 AAGGGCAAAGAGAAGGTAGGAGG + Intergenic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914193144 1:145428195-145428217 AAGGGCAAAGGGAAGATAGGAGG + Intergenic
914311246 1:146468980-146469002 AAGGGCAAAGAGAAGGTAGGAGG - Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914778703 1:150763248-150763270 AAAAGTAGAGAGTAGAATGGTGG + Intronic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914869654 1:151462207-151462229 AAGGGTAAAGGGCAGGATAGGGG + Intergenic
914896481 1:151679505-151679527 AAGGACAAAGAGAACAAGGGAGG + Intronic
915463278 1:156082054-156082076 AAGGGAAAAGAGGAGAGAGGAGG + Intergenic
915536083 1:156536432-156536454 AGGAGTAGAGAGTAGAATGGTGG + Intronic
915727034 1:158025317-158025339 AAGGGGAAAGAGAAAACTCGGGG + Intronic
915977122 1:160398901-160398923 AAGGGTTAAGGGAAGTAGGGAGG - Intergenic
916078811 1:161219164-161219186 AATGGGGAAGAGAAGAAGGGTGG - Exonic
916208473 1:162338331-162338353 AGGAGAAAAGAGAATAATGGGGG - Intronic
917204354 1:172555240-172555262 AAGTGTACAGAGAACACTGGAGG + Intronic
917756199 1:178101140-178101162 AAGGGAAAAGAGAAGTCTTGAGG + Intronic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917830639 1:178881325-178881347 AAGGGTAAGGAAAAGTATGCTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917902009 1:179552043-179552065 AAGAGGAAAGTGAAGAATGAAGG - Intronic
918760224 1:188394970-188394992 AAGAGGAAAGAAAAGAATAGTGG - Intergenic
918846387 1:189620235-189620257 AAGGAGAAAGAGAAGAAAGGTGG + Intergenic
919021789 1:192115160-192115182 AAAGAGAAAGAGAAGAAAGGTGG + Intergenic
919158134 1:193793329-193793351 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
919525662 1:198646817-198646839 AAAAGTAAAGAGAAGAATCAAGG + Intronic
919641681 1:200051351-200051373 GAGGGAAAAGAGAGGAATAGTGG - Intronic
919750827 1:201037057-201037079 AAGAGAAAAGAGGAGATTGGAGG + Intergenic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920815043 1:209323456-209323478 GAGGGTAAGGAGAAGAAAGGTGG - Intergenic
920894231 1:210028454-210028476 AGGGGCAAAAAGTAGAATGGTGG - Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921266981 1:213429039-213429061 AAGGGTAGTGAGAAGAAAAGGGG - Intergenic
921963608 1:221063393-221063415 CAGGCTAAAGAGCAGTATGGAGG + Intergenic
922300914 1:224299731-224299753 GAGGATAAAGAGAAAAAAGGTGG - Intronic
922331463 1:224580497-224580519 AAGGGCAAAGCGAAAAAAGGAGG + Intronic
922417818 1:225437883-225437905 AAGGGCCAAGAGATGAAAGGGGG - Intergenic
923556441 1:235004424-235004446 AAGGGCAAAGAGAGAAAAGGAGG - Intergenic
923880687 1:238100891-238100913 AAAGAAAAAGAGAAGAAAGGAGG + Intergenic
924012841 1:239684881-239684903 AGGGGAAAAGATAAGAATAGGGG + Intronic
924098349 1:240578093-240578115 AAAGGCAGAGAGTAGAATGGTGG - Intronic
924152004 1:241139180-241139202 AAGGAAAGAGAGAAGAAGGGAGG - Intronic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063280297 10:4621372-4621394 TAGAGTATAGAGTAGAATGGTGG + Intergenic
1063301100 10:4849571-4849593 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1063838223 10:10041040-10041062 AAGGGAAAAGAGTGGAAAGGGGG - Intergenic
1064205681 10:13321668-13321690 AAAGGTAAAGGGAACAAAGGGGG + Intronic
1064281642 10:13956657-13956679 AAGGGAAAAGAAAATAATTGTGG + Intronic
1064457864 10:15505267-15505289 AAGGGGAAAGTGAAGGATTGGGG + Intergenic
1064795579 10:19007809-19007831 AAGGGTAAAGAGGTGAATTTAGG - Intergenic
1064829763 10:19449676-19449698 AAGAACAAAGAGAAGATTGGAGG + Intronic
1065213046 10:23423001-23423023 AAGGGAGAAGAGAAGAAATGTGG + Intergenic
1065324244 10:24536716-24536738 AAGGGTACTGAGGAGAATGGAGG - Intronic
1065324480 10:24538632-24538654 AAGGAAAAAGAGAGGAAGGGAGG + Intronic
1065487591 10:26249832-26249854 AAGGGAAAACAGAGGAGTGGTGG + Intronic
1065666739 10:28071272-28071294 AGGTGTAAAGAGAAGTAGGGTGG + Intronic
1065762933 10:28999828-28999850 AAAATTCAAGAGAAGAATGGAGG - Intergenic
1065788869 10:29241844-29241866 AAGGAAAAAGAAAAGAAAGGGGG + Intergenic
1066594322 10:37032590-37032612 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1066600083 10:37095086-37095108 AAAGTTCTAGAGAAGAATGGTGG + Intergenic
1067765152 10:49080318-49080340 ATGGTTAATGAGAAGAAAGGGGG + Intronic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068742877 10:60494015-60494037 AAGGCCAAAGATAAGTATGGTGG + Intronic
1068877610 10:62013606-62013628 AGGAGTAGAGAGTAGAATGGTGG - Intronic
1069162574 10:65109362-65109384 AAGGAGGAAGAGAAGAATAGAGG + Intergenic
1069172559 10:65252178-65252200 AAGGGTAAGCAGAACAATTGTGG + Intergenic
1069671098 10:70204487-70204509 AGAGGTAGAGAGTAGAATGGTGG + Intronic
1069760092 10:70804124-70804146 AAGAGAAAAGGAAAGAATGGAGG + Intergenic
1069914229 10:71777550-71777572 AAGGGCAAGGAGAAGAAAGCAGG - Intronic
1070750631 10:78962057-78962079 AAGGATACAGACAGGAATGGTGG + Intergenic
1071080279 10:81802364-81802386 AAGTGTAACGAGAAACATGGGGG + Intergenic
1071736417 10:88305502-88305524 AATGGAAAAGAGAAGAAAGCAGG + Intronic
1071756200 10:88543094-88543116 AAGGGGAAAGAGTAGAAAGGTGG - Intronic
1071820140 10:89271542-89271564 GAGGGTAAGGAGGAGTATGGTGG + Intronic
1072509241 10:96101761-96101783 AAGGGGAAAGAGGATACTGGGGG - Intergenic
1073277377 10:102324158-102324180 AAGGGGAGAGAGAGGAAGGGAGG - Intronic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1074306866 10:112287148-112287170 AGGGCTAAAGAGAAGGATTGGGG + Intronic
1074628427 10:115220707-115220729 AATGGTAAATAAAATAATGGGGG + Intronic
1074862090 10:117518157-117518179 AAGTGTAAACAGAAAACTGGGGG + Intergenic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075250092 10:120861045-120861067 AAGGGGATGCAGAAGAATGGGGG + Intronic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1076414594 10:130276828-130276850 AAGAACAAAGAGAAGATTGGGGG - Intergenic
1077202804 11:1320343-1320365 AATGCTAAAGATAAGAATAGTGG + Intergenic
1077904240 11:6516863-6516885 AAGAGTAATGGGAAGAATAGAGG - Intronic
1077975642 11:7245711-7245733 AAGGGCAAAGAGACAAAAGGGGG + Intronic
1078834038 11:15008644-15008666 AAGAGTAAAGAAAAGAATTTTGG - Intronic
1078839857 11:15068536-15068558 AAGGGTACAGAGAAGCAGGCTGG + Intronic
1079465006 11:20721783-20721805 AAGGGTAAAGAGAAGGACTTTGG + Intronic
1079531451 11:21459472-21459494 AAGGATAAAAAAAAGAATAGAGG + Intronic
1079600647 11:22309031-22309053 AAGGATAGAGAAAAGATTGGTGG + Intergenic
1080086062 11:28283904-28283926 AAAGGAAAAAGGAAGAATGGAGG + Intronic
1080529468 11:33161163-33161185 CAGGGTATATAGAAGAGTGGTGG - Intronic
1080847694 11:36040513-36040535 AATGATAAAGAGAAAAATGGGGG - Intronic
1080885313 11:36362640-36362662 ATGGGTGGAGAGAAGAAGGGAGG - Intronic
1080905483 11:36540732-36540754 AAGAACAAAGAGAAGATTGGAGG - Intronic
1080989514 11:37513807-37513829 GAAGATAAAGAGTAGAATGGTGG + Intergenic
1081780759 11:45710250-45710272 AAGGGTGCAGAGAAGAAGAGGGG + Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1081841483 11:46204619-46204641 AAAGGAAAAAAAAAGAATGGAGG + Intergenic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1084957863 11:72701001-72701023 AAGGGTAAAGGGAGAGATGGGGG + Intronic
1085409805 11:76284305-76284327 AAGGGTTGGGAGAACAATGGGGG - Intergenic
1085547962 11:77338035-77338057 AAGGAGAAAGAGAAGAATCTTGG + Intronic
1085703426 11:78764916-78764938 AAGGATAAAAAGGAGAATGGGGG + Intronic
1085774456 11:79352744-79352766 AAGGAGACAGAGAAGAAGGGAGG + Intronic
1085952641 11:81350971-81350993 AAAAGCAAAGAAAAGAATGGTGG - Intergenic
1086564340 11:88208402-88208424 TAGAGTAAAGAGTAGAATAGTGG - Intergenic
1086738081 11:90332138-90332160 GAGGGGAGAGAGGAGAATGGAGG + Intergenic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1086809271 11:91285520-91285542 AAGTGTAAAAAAAAGAAGGGAGG - Intergenic
1086846024 11:91750700-91750722 AAGGGGAAAGGGAAGGAAGGGGG - Intergenic
1087577591 11:100009446-100009468 AAGTGTAAAAAAAAAAATGGAGG + Intronic
1087777738 11:102272020-102272042 AAGGGTAAGGAGATGAAGAGTGG + Intergenic
1087896002 11:103587115-103587137 AGGGTTAAAGAGAAGTTTGGGGG + Intergenic
1088033883 11:105287810-105287832 GAGGGTAGAGAGTGGAATGGTGG + Intergenic
1088044156 11:105427336-105427358 GAAGGTAAAGAGTTGAATGGTGG + Intergenic
1088187381 11:107186638-107186660 AGAGGAAAAGAGTAGAATGGTGG - Intergenic
1088405881 11:109478275-109478297 AAAAGTAGAGAGAAGAATAGTGG + Intergenic
1088865758 11:113846145-113846167 AGAGATAAAGAGTAGAATGGAGG + Intronic
1089092720 11:115891691-115891713 AAGGTTAGAAAGAAGTATGGGGG + Intergenic
1089265289 11:117255149-117255171 AAGGGTAAGAAGAGAAATGGTGG - Intronic
1089406556 11:118202532-118202554 CAGGGCAGAGATAAGAATGGGGG + Intronic
1089483652 11:118827998-118828020 AAGGGCAAAGAGAAAACAGGTGG + Intergenic
1089583356 11:119495255-119495277 AAGGGGAATGGGGAGAATGGCGG + Intergenic
1089822487 11:121241175-121241197 AAGGGGAGAGAGGAGAGTGGGGG + Intergenic
1090350163 11:126102902-126102924 CTGGGCAAAGAGAAGAAAGGAGG + Intergenic
1091065251 11:132504262-132504284 AAGGGTAAAGATAGCTATGGAGG - Intronic
1091199016 11:133757485-133757507 AAGGGGGAAGAGAATAAGGGAGG - Intergenic
1091239071 11:134040383-134040405 AAGAGGAAAGATAAGAATGAGGG + Intergenic
1091268066 11:134286231-134286253 AATTATAAAGAGAAGAATCGAGG + Intronic
1091528471 12:1330612-1330634 AGGGGAAGAGAGAAGAAGGGAGG - Intronic
1091618874 12:2070919-2070941 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618904 12:2071026-2071048 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618926 12:2071098-2071120 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1092803365 12:12194885-12194907 AAAAGTAAAGAGTAGAATAGGGG - Intronic
1092923217 12:13250868-13250890 ATGGCTAGAGAGAAGAATGAAGG + Intergenic
1093073535 12:14732807-14732829 AGGGTTAAAGAGAAGAAAGGAGG + Intergenic
1093662802 12:21776026-21776048 AAGGTAAAATAGAACAATGGCGG - Intergenic
1093734606 12:22606348-22606370 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1094318282 12:29156037-29156059 AAAAGTAGAGAGAAGAATGGTGG + Intronic
1095554107 12:43480763-43480785 ATAAGTAGAGAGAAGAATGGTGG + Intronic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095853480 12:46835516-46835538 AAAAATAAAGAGAAGATTGGTGG - Intergenic
1096122433 12:49097034-49097056 AAGGGGAAGGAAAAGGATGGTGG + Exonic
1096435169 12:51583913-51583935 AAAAGTAAAGAGTAAAATGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097006826 12:55925827-55925849 AAGAGTAAAGAGAAGTATACTGG + Intronic
1097143348 12:56922182-56922204 AAGGGTAAAGATAAAACTGTGGG + Intergenic
1097466967 12:59938378-59938400 AAGGGGAAAGAAAGGAAAGGAGG + Intergenic
1097547125 12:61017830-61017852 AGAGGTAAAGACAAGAGTGGTGG - Intergenic
1097971990 12:65643174-65643196 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1098262863 12:68688447-68688469 AAGGGTAAGTAAAAGAATTGTGG - Intronic
1098298334 12:69027592-69027614 AAGGATATAGAGAAGTATTGAGG - Intergenic
1099093454 12:78341880-78341902 AAAGGGAGAGAGGAGAATGGGGG - Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100089375 12:90952128-90952150 AAGGATGAATAGAAGAAAGGGGG - Intronic
1100100526 12:91098594-91098616 AAGCAGAAAGAGTAGAATGGTGG + Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100591717 12:96035836-96035858 AAGGGAAATGATGAGAATGGAGG + Intronic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100858122 12:98776413-98776435 AAGGCTCAAGAGAAGAACTGGGG + Intronic
1101308900 12:103558186-103558208 AAGGGTCAAGAGTGGAATCGGGG - Intergenic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101797986 12:107993871-107993893 AAAAGTAAAGAGTAGAATAGTGG - Intergenic
1103038225 12:117673471-117673493 GATGGAAAAGGGAAGAATGGTGG + Intronic
1103639789 12:122340716-122340738 AATGGAAAAGAAAAGAATGGAGG + Intronic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1104098583 12:125584268-125584290 AAAGATAGAGAGAAGAATAGGGG - Intronic
1104265471 12:127228541-127228563 AATGGAAAAGAGGAGAATAGAGG + Intergenic
1105359133 13:19690792-19690814 AAGAGGAAAGAGAAGAAAGTTGG - Intronic
1105441823 13:20421597-20421619 AAAGGCAAAGAGAAGAGAGGTGG - Intronic
1106061173 13:26293951-26293973 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1106525318 13:30535470-30535492 AATGGTAAAGAGAAGCATGGAGG - Intronic
1106944044 13:34805560-34805582 CAGGGAAATGAGAAGAATGTTGG - Intergenic
1107059369 13:36140056-36140078 AATGGTGAAGAAAAGAAAGGAGG + Intergenic
1107101656 13:36599844-36599866 AAGGGGAAAGAGAGGAACTGCGG + Intergenic
1107379209 13:39837578-39837600 GAAGGTAGAGAGGAGAATGGTGG - Intergenic
1107842600 13:44474686-44474708 AGGGTTAAAAATAAGAATGGAGG + Intronic
1107897119 13:44976296-44976318 AAGGAGAAGGAGAAGAAAGGAGG + Intronic
1108057598 13:46499922-46499944 AAGGGGAAAGAGATGACAGGAGG - Intergenic
1108243451 13:48491620-48491642 AAGTCTACAGAGAGGAATGGAGG + Intronic
1108743077 13:53358980-53359002 AAGGGTAAAGGGAAAACTAGTGG + Intergenic
1109182061 13:59225634-59225656 AAGGAAAGAGAGAAGAAAGGAGG + Intergenic
1109364118 13:61333509-61333531 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1109773520 13:67008596-67008618 CAGGGTAAAGATAATATTGGTGG - Intronic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1110056552 13:70981344-70981366 AAAGGAAAAGAAAAGAAAGGAGG - Intergenic
1110168100 13:72468149-72468171 AAAGGAAAATAAAAGAATGGAGG + Intergenic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1110724326 13:78802125-78802147 AAAAGTAGAGAGCAGAATGGTGG - Intergenic
1110776784 13:79416924-79416946 AAGAGAAAAGGAAAGAATGGTGG - Intergenic
1110932719 13:81242805-81242827 GAGTGTCAAGAGAAGAAGGGAGG - Intergenic
1110984091 13:81941091-81941113 AAAAGTAAAGACTAGAATGGTGG - Intergenic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111334814 13:86805991-86806013 ACAGGAAAAGAGAAGAAGGGAGG - Intergenic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1111882056 13:93969753-93969775 GAGGATAGAGAGTAGAATGGTGG - Intronic
1113156399 13:107327687-107327709 ATAGGTAAAGAGAAGAAAAGCGG - Intronic
1113282313 13:108802271-108802293 AAAAGTAGAGAGAAGAATGATGG - Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113883356 13:113642030-113642052 AAGGGGAAAGAGAAAAATGAAGG - Intergenic
1114035227 14:18619453-18619475 AAGGACAAAGAGAAGATTGGGGG + Intergenic
1114123418 14:19695562-19695584 AAGGACAAAGAGAAGATTGGGGG - Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114302788 14:21393413-21393435 AAAGGGAAAGAGAAGAGAGGGGG + Intronic
1114404226 14:22440136-22440158 TAGGGTCAAGAGAAGAGTGAAGG - Intergenic
1114848841 14:26358278-26358300 AAATGTATAGAGTAGAATGGTGG + Intergenic
1115297091 14:31840723-31840745 AGAGGTAGAGAGTAGAATGGTGG + Intronic
1115305884 14:31933038-31933060 AAGGGAAAGGAGAATGATGGAGG - Intergenic
1115985378 14:39099848-39099870 AAGGCTAAATAGAAGACAGGTGG - Intronic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1116607319 14:47017479-47017501 AAGGGAAATGAGAAGAGTCGAGG + Intronic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117362102 14:54985837-54985859 AAATGGAAAGAGAAGAATCGAGG + Intronic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117621577 14:57592749-57592771 AAGGGTAAACAGAGGAAGAGAGG - Intronic
1117765334 14:59076115-59076137 AAGAGTCAAGTGAAGAATGCTGG + Intergenic
1117927751 14:60802082-60802104 AGAAGTAAAGAGTAGAATGGTGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118331443 14:64818733-64818755 AAGGGGAAGGAGAAGAAATGGGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118493765 14:66287573-66287595 AAGGCTAAAGAAAAGTAAGGGGG - Intergenic
1119294020 14:73518660-73518682 AAGGGAAAAGGGCAGAATGCTGG + Intronic
1119593980 14:75916991-75917013 AAAGGTAGAAAGTAGAATGGTGG + Intronic
1120068458 14:80074390-80074412 AAGGGGAAAAAGTAGAAAGGGGG + Intergenic
1120423227 14:84314677-84314699 AAAGGTATAGAGAAAAAAGGAGG + Intergenic
1120483895 14:85086109-85086131 ATGGGCATATAGAAGAATGGAGG - Intergenic
1121427995 14:93866490-93866512 ACGGGTGAAGAGATGATTGGGGG - Intergenic
1122330875 14:100911633-100911655 AAGGCTAAAGAGAAGGGTCGAGG - Intergenic
1122337343 14:101002534-101002556 AAGGGTAGAGAGGTGAAGGGTGG - Intergenic
1122395040 14:101420227-101420249 AAGGCTGAAGAGAAGACTGGAGG + Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122735760 14:103840171-103840193 AGGGCTAAACAGAGGAATGGTGG - Intronic
1123100557 14:105795894-105795916 AGAGGTAGAGAGGAGAATGGTGG + Intergenic
1123508205 15:20967447-20967469 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123565425 15:21541194-21541216 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123601689 15:21978483-21978505 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123779548 15:23612735-23612757 AGAAGTAGAGAGAAGAATGGTGG + Intronic
1123866617 15:24525712-24525734 AAGTGTAAAAAGTAGAATAGAGG + Intergenic
1124865164 15:33483162-33483184 AAGGGGAGAAAGAATAATGGAGG - Intronic
1125078153 15:35644764-35644786 AATGGAAAAGAGAAAAATGCAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125835811 15:42749726-42749748 AAGGGAAAAAAGAAAAATGAGGG - Intronic
1126289878 15:47062048-47062070 AAGGGTGAAGAAAGAAATGGTGG + Intergenic
1126354607 15:47782197-47782219 AAGGATAAAGAGATGTGTGGAGG + Intergenic
1126369288 15:47928726-47928748 AAGGAGAAAGAGTAAAATGGAGG + Intergenic
1126741893 15:51785634-51785656 GGAGGTAAAGAGTAGAATGGTGG + Intronic
1127216701 15:56830845-56830867 AAAGGGAAAAAAAAGAATGGTGG + Intronic
1127404956 15:58633934-58633956 AAGGAAAAAGAGAAGATGGGTGG + Intronic
1128054609 15:64690355-64690377 AAGGGTAAAGAGCCAAATGCTGG - Exonic
1128056029 15:64700756-64700778 TAGGGTAAAGAGAACATGGGAGG + Intronic
1128214205 15:65923011-65923033 GAGGATGAAGGGAAGAATGGAGG + Intronic
1128397316 15:67241495-67241517 AAGGGAAGAAAGAAGAATGTTGG - Intronic
1129228096 15:74181419-74181441 GAGGGGGAAGAGAAGAAAGGTGG + Exonic
1129714769 15:77840569-77840591 AAAGGGAAAGAGAAAAAGGGAGG - Intergenic
1130716423 15:86339606-86339628 TAGGCTAAACAGCAGAATGGAGG - Intronic
1131306873 15:91252747-91252769 AAGGAGAAAGGGAAGAATGAAGG - Intronic
1131687683 15:94788180-94788202 AAGGGAAAGGAAAAGAAAGGAGG - Intergenic
1131780048 15:95846208-95846230 AAGGGAACAGAGGAGAAGGGAGG + Intergenic
1132343195 15:101090963-101090985 AAGTGAAAAGAGCAGAATGTTGG - Intergenic
1202973797 15_KI270727v1_random:268284-268306 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1132952427 16:2571047-2571069 AAGGGAAAAAATAAAAATGGGGG - Intronic
1132961924 16:2629123-2629145 AAGGGAAAAAATAAAAATGGGGG + Intergenic
1133541345 16:6757607-6757629 GAGGATAGAGAGTAGAATGGTGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1135031461 16:19042165-19042187 AAATGGAAAGAAAAGAATGGGGG - Intronic
1135573070 16:23564113-23564135 AATGCTAAAGAGAAGTATAGGGG + Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1136083832 16:27870563-27870585 AAGGGAAGAGAGGAGAGTGGAGG - Intronic
1137033822 16:35551343-35551365 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1138332901 16:56229506-56229528 ATGGGTAAAAACAACAATGGGGG - Intronic
1139610831 16:68057308-68057330 AAAGGTACAGAGAAAAATAGAGG + Intronic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1139872409 16:70118182-70118204 TAGGGTCAAGAGAAGAGAGGAGG + Intronic
1139951431 16:70673937-70673959 AAGGGTAGAGACAAGAATTCAGG + Intronic
1140357476 16:74318802-74318824 AAGGGCAAAGAGAACATAGGAGG - Intergenic
1140363362 16:74363113-74363135 TAGGGTCAAGAGAAGAGAGGAGG - Intergenic
1140866437 16:79066494-79066516 AAGGGGGAAGGGAAGAAGGGAGG + Intronic
1140964404 16:79950885-79950907 GAGGTAAAAGAGAAGAATGAGGG + Intergenic
1140970427 16:80007238-80007260 AAAGGTAGAGAGAAGGATGGTGG - Intergenic
1140980831 16:80107524-80107546 AGAGGTAGAGAGTAGAATGGTGG + Intergenic
1141202852 16:81910920-81910942 AAGGGAAAAGAGAAAAGGGGAGG - Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1144255014 17:13458964-13458986 GAGGAGAATGAGAAGAATGGAGG - Intergenic
1144376284 17:14645352-14645374 AAGGTAAGAGAGAAGAAAGGGGG - Intergenic
1145091131 17:19987020-19987042 AAGGAAAAGGAGAAGAAAGGCGG + Intergenic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1146067954 17:29652383-29652405 AGGGGTAAGAAGAAAAATGGAGG + Intronic
1146964540 17:37013908-37013930 AAGGGGAAAAAGTAGAAGGGAGG - Intronic
1147415171 17:40283685-40283707 GAGGCTAAAGAAAAGAAGGGTGG + Exonic
1147584380 17:41645371-41645393 AAGGGTAGAGAGGGGAGTGGGGG - Intergenic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1148240724 17:45997986-45998008 AAGGGTGAAGAGGAGGCTGGGGG + Intronic
1148341284 17:46875043-46875065 AAGGGGGAAGAGAGGAAAGGAGG - Intronic
1148524026 17:48312535-48312557 CAGGGTAAAGAAAAGATTTGAGG + Intronic
1149027894 17:52051056-52051078 AGGGGAAAAATGAAGAATGGAGG + Intronic
1149288492 17:55192509-55192531 AAGTGTAATGAGTAAAATGGAGG + Intergenic
1149435906 17:56633178-56633200 AAGGGGAGGCAGAAGAATGGTGG - Intergenic
1149815412 17:59718496-59718518 AAAGGAAAAGAAAAGAAAGGAGG - Intronic
1149875917 17:60232891-60232913 AAGGTTAAAGGTAATAATGGTGG - Intronic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1150553367 17:66231393-66231415 AAGGAGAAAGAGAGGAAGGGAGG - Intronic
1150583239 17:66494448-66494470 AAGGGCAAAGAGACAAAAGGGGG + Intronic
1151086900 17:71390436-71390458 AGGGGTAGAGAGAAGAAGAGTGG + Intergenic
1151252510 17:72847466-72847488 AAGGGTCAAGAGGGGAATGAGGG + Intronic
1151418194 17:73980455-73980477 AAGGATAATGAGGAGAAAGGAGG + Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1203193747 17_KI270729v1_random:212807-212829 AATGGAATAGAGAAGAATGGAGG + Intergenic
1203203111 17_KI270730v1_random:12237-12259 AATGGAATAGAGAAGAATGGAGG + Intergenic
1153066815 18:1055083-1055105 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
1153149764 18:2078649-2078671 AAGTATAGAGAGTAGAATGGTGG + Intergenic
1153255339 18:3164504-3164526 AAGGCTAAGGAGAGGAATGGAGG - Intronic
1153299910 18:3583362-3583384 AAGGGGAAAGACAAGAAAGAGGG - Intronic
1153748526 18:8206199-8206221 AGGGGGAGAGAGAAGACTGGAGG + Intronic
1154469521 18:14685322-14685344 AGGAGTAGAGAGTAGAATGGTGG - Intergenic
1155522701 18:26685184-26685206 CAAGGGAGAGAGAAGAATGGTGG + Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1155770127 18:29686415-29686437 AGGGGTACAGAAAAGAGTGGAGG - Intergenic
1156604921 18:38655077-38655099 AAGGATTCAGAGAAGAGTGGCGG - Intergenic
1156698299 18:39794685-39794707 AAGGGCAAAGGAAAGAAAGGTGG + Intergenic
1156884708 18:42121653-42121675 CAGGGTAAAAAGTAGATTGGAGG - Intergenic
1157684028 18:49628684-49628706 AGGAGGTAAGAGAAGAATGGTGG + Intergenic
1157752177 18:50189095-50189117 AAGGCTGAAAAGAAGCATGGAGG - Intronic
1157888337 18:51390127-51390149 AAGGGTGGAGAGAAGAAGGCAGG - Intergenic
1157895206 18:51460082-51460104 AAGGGGAAAGATAAGGATGGAGG - Intergenic
1158102782 18:53849161-53849183 ATGTGTAATGTGAAGAATGGGGG + Intergenic
1158470078 18:57728453-57728475 GAGGGCAAAGAGAGGAAGGGAGG + Intronic
1158664658 18:59421480-59421502 AAGGGTAAAAACCAGAATAGGGG + Intergenic
1158669404 18:59461445-59461467 AAGGGTAGAGAGAAGGGTAGAGG - Intronic
1159233068 18:65634226-65634248 AAGGGCACAGAGGAGAATTGCGG + Intergenic
1159248650 18:65843950-65843972 AAGGGTGAAGAGAACACAGGGGG - Exonic
1160067165 18:75586405-75586427 AAAGGAAGAGAGAAGCATGGAGG - Intergenic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162614547 19:11787044-11787066 GAGAGTAAAGAGTAGAATTGAGG - Intergenic
1162640357 19:12003673-12003695 AAGAGTAAAGACAAGAGTGTTGG + Intergenic
1162998142 19:14349426-14349448 AAGGGAAGAGAGAAGAGAGGAGG + Intergenic
1163045543 19:14638813-14638835 AGGAGTAGAGAGTAGAATGGAGG - Intronic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163751525 19:19081136-19081158 AAGAATAAAGAAAAGAAAGGAGG + Intronic
1164413548 19:28026157-28026179 AAAGGAAAAGAAAAGAAAGGGGG - Intergenic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165188628 19:34043252-34043274 AAAGGGAAAGAGAGAAATGGGGG - Intergenic
1165971709 19:39637308-39637330 AAGCTTAAAGAGAGGCATGGAGG + Intergenic
1166125941 19:40715428-40715450 AGGGGTAAAAATAAGAAGGGGGG - Intronic
1166165291 19:40983630-40983652 AAAAGCAAAGAGTAGAATGGGGG + Intergenic
1166273561 19:41734561-41734583 AAGTGTAATGAGAAGAAAGCAGG + Intronic
1166450711 19:42898160-42898182 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166462611 19:43002502-43002524 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166468748 19:43058963-43058985 AAGTGTAATGAGAAGAAAGTTGG - Intronic
1167252698 19:48409113-48409135 AAGGGCAAAGAGAGGAGTGAGGG + Intronic
1167665411 19:50820534-50820556 AAAGGGAAAGAGAAAAATGTGGG + Intronic
1168053883 19:53850152-53850174 AGAAGTAAAGAGTAGAATGGGGG + Intergenic
1168109199 19:54182051-54182073 AAGGGAAAAGGGAAGGACGGAGG + Intronic
1168189944 19:54730646-54730668 AAAGGTAGAGAGTAGAATGGTGG - Intronic
1168191945 19:54745011-54745033 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168194227 19:54761567-54761589 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168196274 19:54776299-54776321 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168199936 19:54807086-54807108 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168570229 19:57460913-57460935 AAAAGTAGAGAGTAGAATGGTGG - Intronic
925588991 2:5491610-5491632 AAGGTAATAGAGAAGAATTGAGG - Intergenic
925908215 2:8552310-8552332 GAGGGTGTAGAGAACAATGGGGG + Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926447970 2:12968040-12968062 AAGGGAAAAGAGAAGTCTGAGGG + Intergenic
926700243 2:15798660-15798682 AGGGAAAAAGAGAAGAAAGGAGG + Intergenic
926805895 2:16710725-16710747 AAGAGTAGAAAGAAGAATGATGG + Intergenic
926873032 2:17444284-17444306 AAAGGGAAAGAAAGGAATGGGGG + Intergenic
927108238 2:19845616-19845638 AAGGGTATAGATAAGAATATGGG + Intergenic
927609676 2:24525385-24525407 AAGGATACAGAGAACAAGGGTGG + Intronic
927969516 2:27296508-27296530 AATGGTAACGAGATGAAAGGAGG - Intronic
928267015 2:29820855-29820877 AAGGGGAAAGAGAACACTGTAGG - Intronic
929172250 2:38943752-38943774 AAAGGTAGAAAGCAGAATGGAGG - Intronic
929329341 2:40661187-40661209 AGGGGTTAAGAGAAGAAAAGAGG + Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929981005 2:46680242-46680264 AAGAGGAAAGAGAAGATTTGGGG + Intergenic
930161516 2:48162274-48162296 AAAGGTAGAGAGTAGAATGATGG + Intergenic
930339358 2:50093252-50093274 AAGGGTCATGAGAAATATGGTGG + Intronic
930545902 2:52766610-52766632 AAGGGCACAGAAAAGTATGGAGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930673509 2:54176288-54176310 AAGGGGAAAGAAAATAGTGGAGG - Intronic
931075570 2:58707727-58707749 AAGGGAAAAGGAAAGAAGGGGGG - Intergenic
931175546 2:59850845-59850867 AAGGGAAATGAGAAGAAGAGAGG + Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
934955748 2:98616905-98616927 GAGGGTAGAGCGAAGAAAGGTGG + Intronic
935033957 2:99349972-99349994 AAAAGTAAAGAGTAGAATAGTGG - Intronic
935358201 2:102224528-102224550 GAAGGTAGAGAGAAGAATGGTGG + Intronic
935567328 2:104622785-104622807 ACTGGGAAAGAGAAGAAGGGGGG + Intergenic
936606255 2:113958117-113958139 AAGAGTAAAGACAAGAGTGTTGG + Exonic
937063016 2:118994156-118994178 AAGGGTAGAGAATAGAACGGAGG + Intronic
937547374 2:123039068-123039090 AAGGAAAAAGAGAAGAAGAGAGG + Intergenic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
937766044 2:125661594-125661616 AAGGGTAAAGGGAGGGATAGTGG + Intergenic
937859950 2:126699853-126699875 AAGGCTTTAGAGAAGAAGGGAGG + Intergenic
938196026 2:129329199-129329221 AGGAGCAAAGAGTAGAATGGTGG + Intergenic
938276018 2:130023431-130023453 AAGGACAAAGAGAAGATTGGGGG - Intergenic
938326974 2:130414179-130414201 AAGGACAAAGAGAAGATTGGGGG - Intergenic
938362969 2:130707297-130707319 AAGGACAAAGAGAAGATTGGGGG + Intergenic
938439353 2:131313926-131313948 AAGGACAAAGAGAAGATTGGGGG + Intronic
938981375 2:136530479-136530501 AAGGGACTAGAGAGGAATGGAGG - Intergenic
939122141 2:138129954-138129976 AAGAACAAAGAGAAGATTGGGGG + Intergenic
939567521 2:143802122-143802144 AAGGTTAAAAAAATGAATGGGGG + Intergenic
939715218 2:145575439-145575461 AAGGGGAAAACGAAGAATTGTGG - Intergenic
939751204 2:146049169-146049191 AAGGGTAGTGAGAAGCTTGGGGG - Intergenic
939882421 2:147645525-147645547 AAGGATAATAAGAAGAATTGAGG + Intergenic
940259500 2:151765569-151765591 AAGGGAAAAGGGAAAAGTGGAGG + Intergenic
940300468 2:152172010-152172032 AAGGGGAAAGTGAAACATGGGGG - Intronic
940810076 2:158232824-158232846 TAAGGTAGAGAGTAGAATGGTGG + Intronic
941134833 2:161701756-161701778 GGGGGTAGAGAGTAGAATGGTGG - Intronic
941412014 2:165169953-165169975 AAGGGAAAAGGGAAGAATGAAGG + Intronic
941797424 2:169615497-169615519 AGAAGTACAGAGAAGAATGGTGG - Intronic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942773951 2:179558381-179558403 GAGGGAAAAGAAAAGAATAGTGG + Intronic
943280640 2:185928446-185928468 AAGGAGGAAGAGAAGAAGGGAGG + Intergenic
943318722 2:186419669-186419691 AGGGGTAGAAAGTAGAATGGTGG + Intergenic
944267681 2:197746915-197746937 AAAAGCAGAGAGAAGAATGGTGG + Intronic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
945950135 2:216031517-216031539 AAGGGAAAAGAAAAGAAAGAAGG + Intronic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946857969 2:223972052-223972074 AAAGGTAAAGTGAAGAATGGCGG - Intergenic
946897646 2:224340646-224340668 TAGGGTAAAGAAAAAAAAGGAGG - Intergenic
946906737 2:224424595-224424617 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947251272 2:228107269-228107291 AAAAGTAGAGAGTAGAATGGTGG - Intronic
947759790 2:232595590-232595612 AAGTGTAAAGCTGAGAATGGAGG + Intergenic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
1169047640 20:2547903-2547925 AATGGTAAAGAGAACAGTGAAGG - Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169594800 20:7185974-7185996 AAAGTTATAGAGAAGAAGGGAGG + Intergenic
1169795329 20:9456375-9456397 GATGGTAAAAAGATGAATGGGGG + Intronic
1169913367 20:10665182-10665204 AAGGAAAAAGAGAAAAAGGGAGG + Intronic
1170583469 20:17716324-17716346 AAAGGAAAAGAAAAGAAGGGGGG - Intronic
1170771855 20:19339829-19339851 TTGGGTAGAGAGAAGAAGGGAGG + Intronic
1171563487 20:26153466-26153488 ATGAGTAAATAGAAGAATCGAGG - Intergenic
1171568999 20:26227952-26227974 AAGAGAAAAGGGATGAATGGTGG - Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1173023865 20:39289783-39289805 AAAGGGAAAGAGCAGAAGGGAGG - Intergenic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1174102154 20:48136010-48136032 AGGTGTAAAGAGAAGTATGTTGG - Intergenic
1174226184 20:49002431-49002453 AGGGGCACAGAGTAGAATGGTGG - Intronic
1174902472 20:54514900-54514922 AAGGAAGAAGAGAAGAAGGGAGG - Intronic
1175203711 20:57294991-57295013 AAGAGCAAAGAGCAGATTGGGGG + Intergenic
1175471074 20:59228990-59229012 AGAGGTAGAGAGTAGAATGGTGG - Intronic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1175861349 20:62151917-62151939 GAGGGAAAAGAGGAGAACGGGGG - Intronic
1176754283 21:10714267-10714289 AATGGAAAAGAGTAGAATGGAGG - Intergenic
1176804982 21:13472328-13472350 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
1177087638 21:16727192-16727214 GAGGGTAAAGTGAAGTACGGTGG - Intergenic
1178103146 21:29291628-29291650 TAGGGTACAGAGAAGTGTGGAGG + Intronic
1178209847 21:30517065-30517087 GAGGGTAAATAGAAAAATTGTGG - Intergenic
1178777043 21:35561848-35561870 TAGGAGAAAGAGAACAATGGAGG + Intronic
1178797513 21:35758603-35758625 AAAGGTAGAGAGTACAATGGTGG + Intronic
1178981914 21:37271482-37271504 AATCTTAAAGAGAGGAATGGGGG + Intergenic
1180090774 21:45532967-45532989 AAGGGGAAAGAGAGGAAGTGGGG + Intronic
1180281929 22:10707695-10707717 AAGAGAAAAGGGATGAATGGTGG + Intergenic
1180459345 22:15546499-15546521 AAGGACAAAGAGAAGATTGGGGG + Intergenic
1180763660 22:18228992-18229014 AAAGGAAAAGAGAACAATGAAGG + Intergenic
1180771984 22:18395551-18395573 AAAGGAAAAGAGAACAATGAAGG - Intergenic
1180803362 22:18645164-18645186 AAAGGAAAAGAGAACAATGAAGG - Intergenic
1180864174 22:19106343-19106365 AAGGGCAAAGAGAGGATGGGAGG + Intronic
1181218354 22:21350098-21350120 AAAGGAAAAGAGAACAATGAAGG + Intergenic
1182001687 22:26925322-26925344 AAGTGCACAGAGAAAAATGGGGG + Intergenic
1182957404 22:34439525-34439547 CAGGGTAGAGAGAAAAATGTGGG - Intergenic
1183097321 22:35560849-35560871 AAGGCTAACCAGAAGAATGAGGG + Intergenic
1183247332 22:36703664-36703686 AGGGGTAAAAAGAGGAAAGGCGG - Intergenic
1183461306 22:37952675-37952697 AAAGGATGAGAGAAGAATGGTGG - Intronic
1184080137 22:42213492-42213514 AAGGTTAATGAGAAGACTGTTGG - Exonic
1184835706 22:47019804-47019826 AAGGGAGAAGCGAAGGATGGAGG - Intronic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1185123812 22:48992659-48992681 AGAAGTAGAGAGAAGAATGGTGG + Intergenic
1185189291 22:49424059-49424081 AAGGGGAAAGAGAAGATTCAGGG - Intronic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
1203298668 22_KI270736v1_random:61819-61841 AATGGAACAGAGTAGAATGGAGG + Intergenic
949642514 3:6054205-6054227 ATGGGCAAAGAGAAGTAGGGTGG - Intergenic
949994260 3:9603739-9603761 AGGGGTAAAGAGAAGAGAAGAGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950941696 3:16899044-16899066 GGTGGTAGAGAGAAGAATGGAGG + Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951445736 3:22778258-22778280 AATGGTAAAAACAAGAGTGGGGG + Intergenic
951703083 3:25515721-25515743 TATGATAATGAGAAGAATGGTGG + Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952274593 3:31865061-31865083 AAGGGAGAAGAAAAGAAGGGAGG + Intronic
952449964 3:33422391-33422413 AAAGGAAAAGAAAAGAAGGGAGG + Intronic
952715540 3:36476299-36476321 GAGGGGACAGAGAAGAGTGGTGG + Intronic
953324922 3:42004826-42004848 ATGGCTAAAGAGATGGATGGGGG + Intergenic
953673660 3:44983237-44983259 GAGGTTACAGATAAGAATGGAGG - Intronic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
954629650 3:52040916-52040938 AAGGGACAAGGGAGGAATGGGGG - Intergenic
954884005 3:53856105-53856127 AAGGGTACAGAGAACACTGCAGG + Intronic
955144237 3:56300192-56300214 AAGGGAGCAGAGGAGAATGGAGG + Intronic
955483576 3:59413679-59413701 GAGGGAAAAGAAAAGAAGGGAGG - Intergenic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955871472 3:63442928-63442950 AAGGGTATGGGGAAAAATGGTGG - Intronic
956635948 3:71365283-71365305 AAGGGTTAAGAGATGAGTGCTGG + Intronic
956901201 3:73717690-73717712 AAGAGGACAGAGAACAATGGAGG - Intergenic
956938271 3:74128840-74128862 AAGGGGAAGGAGAAGAAAGGGGG + Intergenic
957109849 3:75940378-75940400 AAGAGAAAAGGGATGAATGGTGG + Intronic
957200217 3:77124832-77124854 AAAGGTAAAGGGAAGAAGGGAGG - Intronic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957314636 3:78561658-78561680 AGAGGTAGAGAGTAGAATGGTGG - Intergenic
957650636 3:82998089-82998111 AAGAAAAAAGAGTAGAATGGTGG + Intergenic
957790188 3:84930615-84930637 AAAGGCAGAGAGTAGAATGGTGG - Intergenic
958092657 3:88896038-88896060 AAGGGTGAACAGTAGAAGGGGGG - Intergenic
958135542 3:89485086-89485108 AAAGGCAGAGAGAAGAATGAAGG - Intergenic
958433242 3:94066867-94066889 GAAGGTATAGAGAAGAAAGGAGG - Intronic
958835887 3:99144567-99144589 AAGGAGGAAGAGAGGAATGGTGG - Intergenic
958906586 3:99948565-99948587 AAGGCGAAGGAGAAGAAAGGAGG + Intronic
959096590 3:101963332-101963354 AAGGATAAAGAGGAGAATTAAGG - Intergenic
959205193 3:103298298-103298320 AAGGGGCAAGAGAGGAAGGGAGG - Intergenic
959404352 3:105941996-105942018 AAGAAGAAAGGGAAGAATGGAGG - Intergenic
959705419 3:109334825-109334847 AAGTGTAAATAGAAGTAGGGTGG - Intronic
960530293 3:118756459-118756481 GAGGAGAAAGAGAAGAAAGGAGG + Intergenic
960803629 3:121562382-121562404 AAGGGTAGAGAAAAGAAAGGAGG + Intergenic
961004559 3:123396157-123396179 AAAAGAAAAGAGAAGAAGGGAGG + Intronic
961347750 3:126275037-126275059 AAAGGGAAAAAGAAGAATGAAGG - Intergenic
962072140 3:132044555-132044577 AGGGGAAAAGAGAGGAAGGGAGG + Intronic
962232210 3:133675509-133675531 AAGGACAAAGAGAAGATTGGAGG + Intergenic
962593642 3:136916693-136916715 AAGGGTAAGGATCAGAATGAGGG + Intronic
962779689 3:138700585-138700607 AAGAAAAAAGAGATGAATGGGGG + Intronic
962789986 3:138802425-138802447 AAGGGGAAAGGAAAGAGTGGCGG + Intronic
962897897 3:139732349-139732371 AGAGAAAAAGAGAAGAATGGTGG - Intergenic
963444532 3:145387368-145387390 AAGGGTAAAAACCAGCATGGGGG - Intergenic
963579194 3:147102796-147102818 AGGAGCAAAGAGTAGAATGGTGG - Intergenic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
965368602 3:167830845-167830867 AAGGGAGAACAGATGAATGGTGG - Intergenic
966433555 3:179858427-179858449 AAGGGAAGAGGGAAGAAAGGAGG - Intronic
966774731 3:183533839-183533861 GAGGGAAAAGAGAAGAGGGGAGG - Intronic
966955617 3:184875245-184875267 AAGGGTAAAGATTAAAATTGAGG - Intronic
967121955 3:186390240-186390262 AATGGAACAGAGAAGAATAGTGG - Intergenic
967226915 3:187300935-187300957 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
967330131 3:188282049-188282071 AAGGGAAAAGAGAGGAGGGGAGG - Intronic
969008943 4:4045060-4045082 AAGGAGAAAGAGAAGAACAGAGG + Intergenic
969197085 4:5571611-5571633 AAGGACAAAGAGAGAAATGGAGG + Intronic
969371860 4:6736606-6736628 AAAGATAAAAAGTAGAATGGTGG - Intergenic
969899601 4:10336583-10336605 TTGGGTAAAGAGAAAATTGGTGG - Intergenic
970142619 4:12998484-12998506 AAGGGTAAAGGGTAGAGTGGGGG + Intergenic
970338428 4:15078771-15078793 AGGGGCAAAGAGTAGAAGGGTGG + Intergenic
970651393 4:18182375-18182397 AAAGATAAAGAGTAGATTGGCGG + Intergenic
970719325 4:18967996-18968018 AAGGGCAAAGAGGAAAAAGGGGG - Intergenic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
970913828 4:21309674-21309696 AAGGGGAAATTGAGGAATGGAGG + Intronic
971821817 4:31566848-31566870 GAAGGTAAAGAATAGAATGGTGG + Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972376318 4:38475148-38475170 AATGGAAAAGAGAAGAAATGTGG + Intergenic
972706346 4:41547341-41547363 AGAGGTAGAGAGTAGAATGGGGG - Intronic
972844998 4:42976997-42977019 AAAAGTAGAGAGTAGAATGGTGG - Intronic
973083885 4:46030104-46030126 AAGATTGAAGAGATGAATGGGGG - Intergenic
973105761 4:46335154-46335176 AAGGGAAAAGAAAGGAATGGAGG + Intronic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
973575812 4:52288314-52288336 AAGGGAACAGGGAAGAAAGGTGG - Intergenic
973724611 4:53763073-53763095 GAGGTCAAAGAAAAGAATGGGGG + Intronic
974110668 4:57521760-57521782 AAAGGTAGAGAGTAGAATGGTGG + Intergenic
974244762 4:59300506-59300528 AGAGGTAGAGAGTAGAATGGTGG + Intergenic
974524948 4:63038825-63038847 AAGGGAAAAGAGCAGACAGGAGG + Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
974928130 4:68326931-68326953 AAAGTTAAAAAGAAAAATGGAGG + Intronic
975073755 4:70178390-70178412 AAGGGAGGAGAGGAGAATGGAGG - Intergenic
975294567 4:72718111-72718133 AAAAGTAGAGAGCAGAATGGTGG + Intergenic
975436117 4:74353820-74353842 AAGGGGAAAGAAAAGAAAGATGG + Intergenic
975507229 4:75150848-75150870 GGAGGTAGAGAGAAGAATGGTGG - Intergenic
976320587 4:83710144-83710166 AATGGTAAAGAGACTTATGGAGG - Intergenic
977003754 4:91538595-91538617 AAGGAGAAAGTGGAGAATGGAGG - Intronic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977188502 4:93970684-93970706 AAGGGGAAAGAGAAAGATTGAGG + Intergenic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978167252 4:105624028-105624050 AAAGGAAAAGAGCAGAGTGGAGG - Intronic
978245490 4:106567396-106567418 AAGGAGAATGAGAAGAAAGGAGG - Intergenic
978716914 4:111855605-111855627 CAGGTTAAAGTAAAGAATGGAGG - Intergenic
978934960 4:114363482-114363504 AAGGGGAAAGAGTGGAAAGGGGG - Intergenic
978944599 4:114480413-114480435 TAGGGTTTGGAGAAGAATGGTGG + Intergenic
979003211 4:115253937-115253959 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
979055701 4:115991107-115991129 AAGGGTAACAAACAGAATGGTGG - Intergenic
979069771 4:116187133-116187155 AAGGGGAAAGAGAAGAAGGTAGG + Intergenic
979130287 4:117036358-117036380 AAGGCTAAGGGGAAGCATGGTGG + Intergenic
979405010 4:120299155-120299177 AAGAGGAAGGAGAAGAAAGGGGG - Intergenic
979768238 4:124489540-124489562 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
980704041 4:136469350-136469372 GAGGATAAAGAGTAGATTGGTGG - Intergenic
981148992 4:141359495-141359517 CAAGGAAAAGATAAGAATGGAGG - Intergenic
981369000 4:143936761-143936783 AAGGATAAAGAGATGAATATGGG + Intergenic
981721249 4:147803613-147803635 GGAGGTAGAGAGAAGAATGGTGG - Intronic
981774688 4:148351884-148351906 AAGGCTTAAGAACAGAATGGGGG - Intronic
982079557 4:151775523-151775545 AAGAACAAAGGGAAGAATGGTGG + Intergenic
982316386 4:154036132-154036154 AAGGGAAGAGAGAACAAAGGGGG + Intergenic
982656858 4:158160916-158160938 AAAAGTAGAGAGTAGAATGGTGG + Intronic
982822568 4:159961332-159961354 AGAAGTAAAGAGAAGAATAGTGG - Intergenic
983484407 4:168317415-168317437 AATGGAAAAGAGAAAAAAGGAGG + Intronic
983655899 4:170084194-170084216 AAGGATAGAGAGTAGATTGGTGG + Intronic
985966821 5:3344022-3344044 AAGGGACAAAAGAAGAATGAGGG - Intergenic
986272002 5:6240769-6240791 AGAGTTAAAGAAAAGAATGGTGG + Intergenic
986304724 5:6506719-6506741 AGGGGGCAAGAGAAGAAAGGAGG + Intergenic
986365420 5:7023735-7023757 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
987085469 5:14463739-14463761 AAGGAAAAAGGGAAGCATGGGGG - Intronic
987339047 5:16923044-16923066 AAGGAAAAAGAGAAGAGGGGAGG + Intronic
987463089 5:18237787-18237809 ATAGGCAAAGAGCAGAATGGTGG - Intergenic
987617705 5:20298006-20298028 AAGTGAAAATAGAATAATGGGGG - Intronic
987734699 5:21825547-21825569 AAGGGAAAAGAAAATGATGGGGG - Intronic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988001204 5:25351467-25351489 AAGACAAAAGAGAAGACTGGAGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988776426 5:34481768-34481790 AAGGGGAAAGGGAGGAAGGGTGG - Intergenic
988926110 5:35992403-35992425 AAGGGGAAAGAGAAGTGTGGAGG + Intergenic
989451306 5:41589260-41589282 AAGGCAAAAAAGAAGCATGGAGG - Intergenic
991194983 5:63921991-63922013 AAAGGAAAAGAGAAAAATCGAGG + Intergenic
992127646 5:73658233-73658255 TAGAGTAAAGAGAAGAAATGGGG - Intronic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
992496214 5:77296813-77296835 AAGGAAAAAGAGAAGAAAAGGGG - Intronic
992595319 5:78340873-78340895 CAGGGGAGAGGGAAGAATGGGGG - Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993259199 5:85637693-85637715 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
993429113 5:87809952-87809974 GAAGGTAAAGAGTAGATTGGTGG - Intergenic
993884099 5:93396453-93396475 AAGGGGAAAGAGAAGTAAAGAGG - Intergenic
994113490 5:96035603-96035625 GAGTGTAAAGAGTGGAATGGGGG + Intergenic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994475070 5:100257208-100257230 AAAGATAAAGAGTAGAAGGGTGG - Intergenic
994475151 5:100258537-100258559 AAGAATGGAGAGAAGAATGGAGG - Intergenic
994574711 5:101563342-101563364 AGGGGTAAAGAAAAGTATGACGG + Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
994760136 5:103841652-103841674 AAGGTAAAAGAGAAGAAGAGAGG + Intergenic
995306789 5:110661016-110661038 AAAGGTAGAGAGTAGAATGATGG - Intronic
995308916 5:110688998-110689020 AAGGGTCAAAGGAAAAATGGGGG - Intronic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
995547468 5:113247410-113247432 AAGAGTAAAGAGAACAAAGCAGG + Intronic
995670281 5:114595110-114595132 AAAGGTCAAGAGAAGCATCGTGG - Intergenic
995877574 5:116806665-116806687 AGGAGTACAGAGAAGAGTGGTGG - Intergenic
996369834 5:122741475-122741497 TAAGGTAAAGAGAAGAATGAAGG - Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996652344 5:125894812-125894834 AAGAACAAAGAGAAGATTGGAGG - Intergenic
996949789 5:129111695-129111717 AAGGGTAGAGAGAGGAAAGGAGG - Intronic
997654474 5:135545040-135545062 AGGAGTAAAGAGAAGACAGGAGG + Intergenic
998046987 5:138995743-138995765 AAAGATAAAGAGTAGATTGGTGG - Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999410435 5:151345530-151345552 AGGGTTAAAGAGAACAATCGAGG + Intronic
999461819 5:151763329-151763351 AGGGGTACAGAGAACAAAGGAGG - Intronic
999480192 5:151941018-151941040 GAGGGTATAGAGAAGAGTAGTGG + Intergenic
999513202 5:152274260-152274282 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
999625382 5:153515436-153515458 AGAAGTAAAGAGTAGAATGGTGG + Intronic
999925945 5:156377744-156377766 AATGGTATAGCCAAGAATGGGGG - Intronic
1000161011 5:158597809-158597831 AAGAACAGAGAGAAGAATGGTGG + Intergenic
1000209796 5:159098550-159098572 AAGGAGAAAGAGGAGAAAGGAGG + Intronic
1000560089 5:162776601-162776623 ATGGGTTCAGAGCAGAATGGAGG - Intergenic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1001688918 5:173617614-173617636 AAGGGAAGAGAGGATAATGGTGG - Intergenic
1001906211 5:175475795-175475817 AAGGGAAAAGAAAAGAGTTGGGG + Intergenic
1002376993 5:178795996-178796018 AAAGGTAAAGGGAAAAAGGGGGG + Intergenic
1003279278 6:4677752-4677774 AAGGGGGAAGACAGGAATGGAGG + Intergenic
1003316937 6:5021534-5021556 AAGGGTAGTGAGAAGGAGGGAGG - Intergenic
1003323822 6:5076852-5076874 AATGGAAGAGAGAAGAACGGAGG - Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004556027 6:16699378-16699400 AAAGGTAAAGAGAACACTGAAGG + Intronic
1004738315 6:18430816-18430838 AAGGATAAGGAGAACAAAGGAGG - Intronic
1004739727 6:18447129-18447151 AAGGGGAAAGAGATAGATGGGGG + Intronic
1004914847 6:20321969-20321991 AAGGGTATAGGGAAGAATGCAGG + Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005023115 6:21436546-21436568 CAGGGAGAAGAGAAGAATTGTGG - Intergenic
1005286487 6:24333084-24333106 AAAGGCAAAAAGAAGAATGAGGG + Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005607997 6:27494995-27495017 AGGGGTGAAGAGAAGAGTGAAGG - Intergenic
1005647756 6:27857371-27857393 AAGGAGAGAGAGAAGAAAGGAGG + Intronic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006855122 6:37127510-37127532 AATGGTATAAAGAAAAATGGAGG - Intergenic
1007148076 6:39657366-39657388 AAGTGTAGAGAGATGAATGAAGG + Intronic
1007239645 6:40415803-40415825 AAAGGTAAAGGCAAGGATGGAGG + Intronic
1007377588 6:41467345-41467367 AAAGGGAGAGAGAAAAATGGTGG + Intergenic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1008413619 6:51213856-51213878 AAGGGAAGAGCGAAGAAAGGAGG + Intergenic
1008450822 6:51648417-51648439 AAAGGTAAAGAGAAGAAAACAGG + Intronic
1008826634 6:55702413-55702435 AAGGGTAGAGAGAAAAGTGAAGG - Intergenic
1008831206 6:55764747-55764769 ATAGGTAGAGAGTAGAATGGTGG + Intronic
1009511510 6:64555313-64555335 AGGGGTAGAGAGGAGAAAGGTGG + Intronic
1009601160 6:65801917-65801939 AAAGTGAAAAAGAAGAATGGTGG - Intergenic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1010348992 6:74849342-74849364 AAGTTTAAAGAGAAGGATGTAGG - Intergenic
1010671105 6:78687605-78687627 AAAGGTATAGACAAGGATGGTGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011414920 6:87108274-87108296 AAGGTGATAGAGAAGAAAGGGGG + Intergenic
1011823976 6:91284972-91284994 AAGGGTCAAGAGAAGCCTGAAGG + Intergenic
1012220647 6:96644973-96644995 AAAGGTAGAGAGTACAATGGTGG - Intergenic
1012305728 6:97654545-97654567 AAGGGGGGAGAGAAGAAGGGAGG - Intergenic
1012325467 6:97910781-97910803 AATGGTAAAGAAAAGCATTGAGG + Intergenic
1012660673 6:101886801-101886823 AAAGGTAGAAAGAAGAATGGTGG - Intronic
1012733329 6:102909113-102909135 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1012882998 6:104814117-104814139 AAGAATAAAGAAAAGAAAGGGGG + Intronic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013033367 6:106357902-106357924 AAGGGAAAAGAGAAGAAAAGGGG - Intergenic
1013348167 6:109282381-109282403 AAGGGAAAAGAGTGGAGTGGAGG - Intergenic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013493916 6:110678570-110678592 AAAGATAAAGTGCAGAATGGTGG - Intronic
1013641826 6:112091041-112091063 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1013730704 6:113162838-113162860 GAAGATAAAGAGTAGAATGGTGG + Intergenic
1014325848 6:119992314-119992336 AGTGGTAGAGAGTAGAATGGTGG - Intergenic
1014329107 6:120037548-120037570 AAAGTTAATGAAAAGAATGGGGG + Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1014976393 6:127890393-127890415 GAGGGAAGAGAGTAGAATGGTGG + Intronic
1015218810 6:130781007-130781029 AAAGTTAAAAAGAGGAATGGTGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015360787 6:132336752-132336774 AAGGAAAAAGAGAAGAAATGAGG + Intronic
1015787429 6:136932232-136932254 AGGGGTAAACTGAAGTATGGAGG + Intergenic
1016271831 6:142299422-142299444 AAGAGTAGAGAGTACAATGGTGG + Intergenic
1016825801 6:148387411-148387433 AAAGGAAAAGAAAAGAAAGGAGG - Intronic
1017114809 6:150966832-150966854 AAGGGAATAGAAAAAAATGGGGG + Intronic
1017728959 6:157297520-157297542 AAGTGGGAAGAGAAGAGTGGTGG - Intronic
1018323304 6:162636465-162636487 GAGGGTAAAGAGATGACTGAAGG + Intronic
1018444507 6:163842888-163842910 AAGGGTAAAGGGAGGAAAGGAGG - Intergenic
1018894912 6:168007489-168007511 ATGGCTAAAGAGTAGAAAGGGGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019257961 7:63644-63666 GAGGGTATAGAGAAGACAGGTGG + Intergenic
1019927318 7:4201975-4201997 AAGGAGAAAGAGTAGAAGGGTGG - Intronic
1020518719 7:9159107-9159129 AATGGCAAAGAGTAGAAAGGAGG + Intergenic
1020632947 7:10662356-10662378 AAGGATACAGCGGAGAATGGAGG + Intergenic
1020837617 7:13173668-13173690 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1020992493 7:15217759-15217781 AAAGTAAATGAGAAGAATGGTGG + Intronic
1021094733 7:16523058-16523080 GATGGTAAAGAGAAAAATGAAGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1021594057 7:22296002-22296024 CAGGGTAAGGAGAACAAAGGAGG + Intronic
1021794107 7:24236273-24236295 AAGAGTAAAGTTAAGAGTGGAGG + Intergenic
1021984209 7:26083488-26083510 AAGGGTAAAAAGAGAAAGGGAGG + Intergenic
1022070324 7:26907449-26907471 AAGTGAAAAGAAAAGAATTGTGG + Intronic
1022343211 7:29487653-29487675 AAGGAGAAAAAGAAGAAAGGAGG - Intronic
1022673154 7:32474830-32474852 AAGGGCAGAGAGAAAAAGGGAGG + Intergenic
1022918253 7:34983492-34983514 AAAGGGAAAGAGAGGAAGGGAGG + Intronic
1023112824 7:36831308-36831330 AAGTATAGAAAGAAGAATGGAGG - Intergenic
1023805589 7:43870534-43870556 AAGGGGAAATGGAAGAACGGTGG + Intronic
1024135584 7:46404490-46404512 GAAGGTAGAGAGTAGAATGGTGG + Intergenic
1024389642 7:48793594-48793616 AAGGGAAAAAAGAAGTGTGGAGG + Intergenic
1024577979 7:50780411-50780433 AAGGGTCAAGGGCAGAATGAGGG - Intronic
1024816254 7:53275361-53275383 AAGGCTGAAGAGAAGAATGTTGG - Intergenic
1025074363 7:55929941-55929963 AAGTGAAAAGATAACAATGGAGG + Intronic
1025084063 7:56008531-56008553 AAGGCTAAAGGCAAGATTGGGGG - Intergenic
1025706007 7:63864763-63864785 AAGGCTAAAGGCAGGAATGGGGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026356576 7:69562970-69562992 AAGGGAGAAGAGAAGAACAGAGG + Intergenic
1026577675 7:71587001-71587023 AAAGGTAGAGAGGAGAAAGGAGG - Intronic
1028066301 7:86389337-86389359 AGGGGTAGAGAGAAAAAGGGAGG - Intergenic
1028362574 7:89986873-89986895 AGAGGTAAAGTGTAGAATGGTGG + Intergenic
1028415648 7:90577852-90577874 AAGGGTAAAGCAAAGAAGTGAGG + Intronic
1028556447 7:92131097-92131119 AAGAGGAAAGTGAAGAATGAAGG + Intronic
1028657420 7:93225719-93225741 AAAGATAAAGAGGAGAATGAGGG + Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029607882 7:101609832-101609854 AAGGGAGAAGGGAGGAATGGAGG - Intergenic
1029912727 7:104172024-104172046 AAAGGAAAAGAGAAGATTGTTGG - Intronic
1029923170 7:104287615-104287637 AAAAGAAAAGAGAAGAAGGGAGG - Intergenic
1030580148 7:111344811-111344833 AAGGACAAACAGGAGAATGGAGG + Intronic
1030667362 7:112294160-112294182 AAGGGGAAAGAGAAGACAAGAGG - Intronic
1030803658 7:113887036-113887058 AAAGGTAGAGAGGAGAAGGGAGG - Intronic
1031281951 7:119815749-119815771 AAGGGGAAAAAGAAGAAATGTGG - Intergenic
1031436657 7:121740083-121740105 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1031584642 7:123519607-123519629 AAGGATAGAGAGTAGAATGATGG + Intronic
1031960206 7:127982444-127982466 AAGGGATAAAAGAAGAATGAAGG - Intronic
1032104380 7:129013929-129013951 AGAGGTAAAGAGTAGAATGACGG + Intronic
1032600457 7:133288242-133288264 AAGGGAGAGGAGAAGAATGGAGG - Intronic
1032667454 7:134051253-134051275 AAGCAGAGAGAGAAGAATGGAGG + Intronic
1032805085 7:135346125-135346147 AGGGGTAGAGAGTAGAGTGGTGG - Intergenic
1032895470 7:136246130-136246152 AAGGATATAAATAAGAATGGGGG - Intergenic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033869862 7:145738775-145738797 AGGAGTAGAGAGCAGAATGGTGG - Intergenic
1034211564 7:149367870-149367892 AAGGGGAAAGAGTTGAGTGGGGG - Intergenic
1034911309 7:155001327-155001349 GAGGGGGAAGAGAAAAATGGTGG + Intronic
1035180504 7:157085965-157085987 AAGGAGGAAGAGAAGAAAGGGGG - Intergenic
1035989013 8:4467395-4467417 ACGGAAAAAGAGAAAAATGGAGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036123968 8:6046456-6046478 AAGGAGGAAGAGAAGAAAGGAGG + Intergenic
1036250216 8:7155725-7155747 AAGGAGAAAGAGAAGAAGAGTGG + Intergenic
1036367272 8:8131725-8131747 AAGGAGAAAGAGAAGAAGAGTGG - Intergenic
1036476390 8:9097089-9097111 ATGGGAAGAGAGAAGAAAGGGGG - Intronic
1036883608 8:12533937-12533959 AAGGAGAAAGAGAAGAAGAGTGG + Intergenic
1037604099 8:20422935-20422957 CAAGGTAAAGAGAGGAATGGAGG - Intergenic
1037691617 8:21185787-21185809 AAGGGTAAGGAAAAGAAATGAGG + Intergenic
1037745110 8:21637054-21637076 AAGGGTAAATGGAAGAATGAGGG - Intergenic
1038204890 8:25457584-25457606 AAGAGTACAGAGAAGTTTGGCGG + Intronic
1038384152 8:27125487-27125509 GAAGGTAGAGAGTAGAATGGTGG - Intergenic
1038425011 8:27459284-27459306 AAGGGTGCAGATGAGAATGGGGG - Exonic
1038981171 8:32761108-32761130 AAAGGTAAAATGAAGAATGGAGG + Intronic
1039839297 8:41282047-41282069 TAGGGTGACGAGAGGAATGGAGG - Intronic
1040047646 8:42979726-42979748 AACGGTAAAGAGAATAACGAAGG - Intronic
1040690969 8:49937956-49937978 TAGGATAAAGAAAAGAAGGGAGG - Intronic
1041487034 8:58390849-58390871 AGAGGTAGAGAGTAGAATGGTGG + Intergenic
1041516464 8:58704492-58704514 AAGGAGAAAGAGAAGAAAGCAGG + Intergenic
1041812553 8:61927756-61927778 AAAGGAATAGAGAAGAGTGGAGG + Intergenic
1042044047 8:64628148-64628170 AACGGTAATGAGAAGATTTGAGG - Intronic
1042810603 8:72821808-72821830 AAAGGTGAAGGGAAGGATGGAGG + Intronic
1042985011 8:74573834-74573856 AAGGCTAAAGACATGGATGGAGG - Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043369123 8:79570869-79570891 TAGGGTAAAGAAATGTATGGAGG - Intergenic
1043607420 8:82019187-82019209 AAGGAAAAAGAGAGGAAGGGAGG - Intergenic
1043610303 8:82054682-82054704 GATGGTAAAGAGATTAATGGTGG - Intergenic
1043744544 8:83857002-83857024 AAAGGTAGAGAGTAGAATGATGG + Intergenic
1043967301 8:86494009-86494031 ATAGGTAGAGAGTAGAATGGCGG + Intronic
1044113736 8:88308151-88308173 CAGGGTGAAGTGAAGAATTGTGG - Intronic
1044256662 8:90071405-90071427 AAGGGGGAAGAGGAGAAGGGAGG + Intronic
1044381292 8:91536976-91536998 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1044802999 8:95976262-95976284 AAGGAGAGAGAGAAGGATGGAGG + Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045213671 8:100125399-100125421 AAGTGTACAGAGTAGAATGATGG + Intronic
1045290164 8:100826138-100826160 AAGGGTAATGGCAAGGATGGTGG - Intergenic
1045370142 8:101514894-101514916 AAGGAGGAAGAGAAGAAAGGGGG - Intronic
1045778945 8:105840971-105840993 AAAGTTAAAAAGAACAATGGGGG - Intergenic
1045782074 8:105878221-105878243 AAGGTTCAAGAGAAGAAAAGAGG + Intergenic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1045875863 8:106979911-106979933 AAGGTTAAAGAGAATAAAAGAGG + Intergenic
1046125767 8:109905306-109905328 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1046816595 8:118591014-118591036 TAGGCTCAAGAGCAGAATGGAGG + Intronic
1046930064 8:119833033-119833055 AAGCATATTGAGAAGAATGGAGG + Intergenic
1046933175 8:119861729-119861751 AAAAGGAAAGAGAAGAAGGGAGG + Intergenic
1047153957 8:122296264-122296286 AAGAAGAAAGGGAAGAATGGAGG + Intergenic
1047251934 8:123187210-123187232 AAGGGTGAAGACAGGAATAGAGG + Intronic
1047826582 8:128582362-128582384 AACGGTGAAGAGAATAATGGTGG - Intergenic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1047969505 8:130072601-130072623 ATGTGTAGAGAGAAGTATGGGGG - Intronic
1048053875 8:130845853-130845875 AAGGATAGAAAGAAGAAGGGAGG + Intronic
1048161647 8:132026993-132027015 AAGGGAAAAGGGAAAAATGGTGG - Intronic
1048165648 8:132059230-132059252 ATGGGAGAAGAGAAGAAGGGAGG - Intronic
1048313445 8:133344262-133344284 AAGGGGAGAGAGAAGGAAGGAGG - Intergenic
1048385727 8:133910987-133911009 AGGGGGAAAGAAAAAAATGGAGG - Intergenic
1050220833 9:3387902-3387924 AAAGATAAAGACAAGAATGATGG + Intronic
1050477380 9:6054169-6054191 AAGGGGAAAGAGAACTCTGGAGG + Intergenic
1050587002 9:7123437-7123459 AAGGGCAAAGAGAAGCAAAGGGG - Intergenic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1051304788 9:15698172-15698194 AGAGGTAGAGAGTAGAATGGTGG - Intronic
1051305432 9:15703439-15703461 GGAGGTAGAGAGAAGAATGGTGG - Intronic
1051552109 9:18341351-18341373 AAGGGTATAATGAAGAATGTTGG - Intergenic
1051738144 9:20224650-20224672 AAGGGAGAAGAGAAGAGGGGAGG + Intergenic
1051894319 9:21972035-21972057 AGCAGTAAAGAGTAGAATGGTGG - Intronic
1052441506 9:28502041-28502063 ATGGATAAAGGGAAGAAAGGAGG + Intronic
1052777286 9:32744904-32744926 TAGAGTAGAGAGCAGAATGGTGG + Intergenic
1053010595 9:34630694-34630716 AAGGGTGCAGAGAAGGGTGGCGG - Intergenic
1053246715 9:36540641-36540663 ATGGGAGAAGAGAAGAATTGGGG + Intergenic
1053246924 9:36542193-36542215 ATGGGGAAGGAGAAGAATTGGGG + Intergenic
1053346219 9:37380170-37380192 AGGGAGAAAGAGAAGAAGGGAGG + Intergenic
1053375386 9:37601634-37601656 GTGGGAAAAGAGAAGAATAGAGG + Intronic
1054459143 9:65453312-65453334 ATGGGTAAAGGGAAGGATGTGGG + Intergenic
1054880758 9:70142319-70142341 AATGGTGACGAGGAGAATGGAGG + Intronic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055324753 9:75117868-75117890 GAGGGTCAAGAGGAGAATGAAGG - Intronic
1055442350 9:76348827-76348849 AGAAGTAAAGAGTAGAATGGTGG - Intronic
1055524023 9:77111719-77111741 CAGGGGAAAGAGGAAAATGGAGG - Intergenic
1055613190 9:78044091-78044113 AACTGTAAAGAGTAGGATGGAGG + Intergenic
1055674681 9:78645035-78645057 AGGGTTAAAGAGGAGGATGGGGG - Intergenic
1055733025 9:79298516-79298538 AAGGGGATATGGAAGAATGGTGG + Intergenic
1055928685 9:81537580-81537602 AAGGATAAAGCTAATAATGGTGG - Intergenic
1056231624 9:84551458-84551480 AAGGGAAAAGTGAATACTGGAGG + Intergenic
1056441455 9:86625667-86625689 AAGGGTAATAAGAACAATGTAGG + Intergenic
1056686885 9:88773902-88773924 AAGGGTCATGTGAAGAATTGAGG - Intergenic
1057131534 9:92657584-92657606 AAGGGGACAGAGAAGGCTGGAGG + Intronic
1057286966 9:93764525-93764547 AAGGGCAAAGGGCAGAAGGGGGG - Intergenic
1058303276 9:103403470-103403492 AGAGGTAGAGAGTAGAATGGTGG + Intergenic
1059025380 9:110622305-110622327 AAGGGTAAAGAAAAGAAGTCAGG - Intergenic
1059193659 9:112350218-112350240 GAGGGTAAAGGGTGGAATGGGGG + Intergenic
1059382940 9:113942517-113942539 ATGGATACAGAGAAGACTGGAGG - Intronic
1059773960 9:117456036-117456058 CAGGGAAGAGTGAAGAATGGTGG - Intergenic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060279248 9:122204852-122204874 AAAGGCACAGAGAAGAAGGGTGG + Intronic
1060731391 9:126039237-126039259 AAGGCCAAAGAGAAGTAAGGAGG - Intergenic
1061244853 9:129396274-129396296 ATGGGTGAAGAGATTAATGGGGG + Intergenic
1061768511 9:132898881-132898903 AGGGGTGATGAGAAGTATGGTGG + Intronic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186120620 X:6357411-6357433 AAAGTAAAAGAGAAGAATTGGGG + Intergenic
1186149584 X:6660257-6660279 AACGGGAAAGAGAAGAATGTTGG + Intergenic
1186242138 X:7580463-7580485 AATGATAAAGAGAAGAGTGGAGG + Intergenic
1186396656 X:9215812-9215834 AGAGGTAAAAAGTAGAATGGTGG + Intergenic
1186731578 X:12416192-12416214 AAGGAGAAAGGGAAGAAAGGAGG - Intronic
1186747154 X:12581938-12581960 GAGGCTAATGAGAAGTATGGAGG - Intronic
1186900979 X:14055686-14055708 AAGAGTAAAGAGTAGAACAGTGG - Intergenic
1187360258 X:18619475-18619497 AAAGGTAAATAGAAAAATGAAGG + Intronic
1187584304 X:20642999-20643021 AAGGGAAAAGTGAGGACTGGTGG + Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1187987176 X:24826861-24826883 AAGGGTAAAGTGAAGATTTCAGG + Intronic
1188049503 X:25467203-25467225 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1188205908 X:27358317-27358339 AAAGGTGAAGAGAAGAAGGTAGG + Intergenic
1188225635 X:27593253-27593275 AAAGTCAGAGAGAAGAATGGTGG - Intronic
1188460791 X:30424973-30424995 TAGGGTAAAGAGAAAAATTGAGG - Intergenic
1188922314 X:35992134-35992156 AAGGGAAAAGAGAAGAAACAGGG - Intergenic
1189157699 X:38775513-38775535 AGAGGCAAAGAGTAGAATGGTGG - Intergenic
1189159748 X:38800096-38800118 AACGGAAAATAGAAGAATGTAGG + Intergenic
1189407433 X:40737330-40737352 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189561752 X:42198196-42198218 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189596024 X:42566302-42566324 AAGGGTGAAGAGTAGGTTGGGGG + Intergenic
1189926700 X:45962024-45962046 AATGGTAAACAGAAAAAAGGAGG + Intergenic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1190735211 X:53251221-53251243 AAAGATAAAGGGAAGAATGGTGG + Intronic
1191108188 X:56785275-56785297 AAGGGAGAAGAAAAGAATGCAGG + Intergenic
1192184364 X:68936649-68936671 AAGGAGGAAGAGGAGAATGGTGG + Intergenic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1193158724 X:78203755-78203777 AAGGGTACAAAGAAGAAAAGAGG - Intergenic
1193469115 X:81877626-81877648 AAATATAAAGAGTAGAATGGTGG + Intergenic
1193568343 X:83108392-83108414 AAAGAGAAAGAGAAGGATGGTGG - Intergenic
1194320393 X:92439725-92439747 AAGGGAGAGGAAAAGAATGGAGG - Intronic
1194453885 X:94079050-94079072 GGGGGTAAAGAGTAGAATAGTGG + Intergenic
1194675140 X:96785442-96785464 AAGGGTAAAGAGACAAAAGGTGG + Intronic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1194805780 X:98326122-98326144 AAGGGTAGAGAGATCAATAGTGG - Intergenic
1195328500 X:103777287-103777309 AAGGGAAAAGAGAAGATAGAGGG - Intronic
1195426268 X:104735125-104735147 AAGGGATAACAAAAGAATGGGGG + Intronic
1195445241 X:104945200-104945222 AAGGGTGAATAGTATAATGGTGG + Intronic
1195518545 X:105805005-105805027 AAGGGGAAAGAGAAGAGAGGAGG + Intergenic
1195756292 X:108202206-108202228 AAGGGTAAAGTGATGAAATGTGG - Intronic
1195773727 X:108379880-108379902 CAGGGCAAAGAGAAGACTTGGGG - Intronic
1197548560 X:127858933-127858955 GAGGGGGAAGGGAAGAATGGGGG + Intergenic
1197868582 X:131044442-131044464 AAAGGCAAAGAGAAGAGAGGAGG + Intergenic
1199007117 X:142713485-142713507 AGAAGTAAAGAGAAGAATAGTGG + Intergenic
1199222607 X:145334808-145334830 AAGGGTAATGTGAAGAGTGCTGG + Intergenic
1199243818 X:145579245-145579267 GTGGGTATAGAGATGAATGGGGG - Intergenic
1200628509 Y:5552855-5552877 AAGGGAGAGGAAAAGAATGGAGG - Intronic
1200808195 Y:7454327-7454349 AAAGGAAAAGAGAAGAGAGGAGG - Intergenic
1201117783 Y:10847793-10847815 AAGGGAATGGAGTAGAATGGAGG - Intergenic
1201253902 Y:12088419-12088441 AAGGGGAGAGAGAAGAATGGAGG - Intergenic
1201475491 Y:14376851-14376873 AAGGAGGAAGAGAAGAATGGAGG + Intergenic
1201864728 Y:18637687-18637709 AAGGTTAAAGAGAAGAAGGCAGG - Intergenic
1201868594 Y:18682691-18682713 AAGGTTAAAGAGAAGAAGGCAGG + Intergenic
1202258709 Y:22946813-22946835 AAGGTTAAAGAGAGAAATAGAGG + Intergenic
1202411698 Y:24580571-24580593 AAGGTTAAAGAGAGAAATAGAGG + Intergenic
1202459084 Y:25089501-25089523 AAGGTTAAAGAGAGAAATAGAGG - Intergenic
1202606535 Y:26644080-26644102 AGGGGAAAAGAGAGGAATGGAGG + Intergenic