ID: 917862165

View in Genome Browser
Species Human (GRCh38)
Location 1:179156761-179156783
Sequence GCGTCACCTTTCCAAGTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 945
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 917}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917862165_917862169 8 Left 917862165 1:179156761-179156783 CCGGTCACTTGGAAAGGTGACGC 0: 1
1: 0
2: 1
3: 26
4: 917
Right 917862169 1:179156792-179156814 TGCGTGAACCAGGGAAACAGAGG 0: 1
1: 0
2: 84
3: 2576
4: 24825
917862165_917862168 -1 Left 917862165 1:179156761-179156783 CCGGTCACTTGGAAAGGTGACGC 0: 1
1: 0
2: 1
3: 26
4: 917
Right 917862168 1:179156783-179156805 CAGGAGAATTGCGTGAACCAGGG 0: 6
1: 2166
2: 103077
3: 176675
4: 184943
917862165_917862171 27 Left 917862165 1:179156761-179156783 CCGGTCACTTGGAAAGGTGACGC 0: 1
1: 0
2: 1
3: 26
4: 917
Right 917862171 1:179156811-179156833 GAGGCTGCAGTGAGCTGAGATGG 0: 357
1: 5123
2: 12770
3: 16749
4: 11920
917862165_917862167 -2 Left 917862165 1:179156761-179156783 CCGGTCACTTGGAAAGGTGACGC 0: 1
1: 0
2: 1
3: 26
4: 917
Right 917862167 1:179156782-179156804 GCAGGAGAATTGCGTGAACCAGG 0: 191
1: 69353
2: 116714
3: 117807
4: 79450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917862165 Original CRISPR GCGTCACCTTTCCAAGTGAC CGG (reversed) Intronic
900223449 1:1521812-1521834 GCCTCAGCCTCCCAAGTGACTGG + Intronic
900259738 1:1720207-1720229 GCCTCAGCCTTCCAAGTAACTGG + Intronic
901044566 1:6388053-6388075 GCCTCAGCTTCCCAAGTAACTGG + Intronic
901300753 1:8198531-8198553 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
901395730 1:8980100-8980122 GCCTCACCCTTCCAAGTAGCTGG + Intergenic
901507950 1:9698255-9698277 GCCTCACCTTCCCAAGTAGCTGG + Intronic
901752682 1:11421097-11421119 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
901831672 1:11896261-11896283 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
901877319 1:12174360-12174382 GCCTCAACCTTCCAAGTAACTGG + Intronic
902129700 1:14248940-14248962 GCATGGCCTTTCCATGTGACTGG - Intergenic
902248624 1:15138678-15138700 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
902629461 1:17696096-17696118 GCCTCAGCTTCCCAAGTAACTGG - Intronic
903343412 1:22669219-22669241 GCCTCAGCCTTCCAAGTCACTGG + Intergenic
903728092 1:25467141-25467163 GCGTCAGCTTCCCAAGTAGCTGG - Intronic
903934377 1:26884865-26884887 GCCTCAGCTTCCCAAGTAACTGG - Intronic
904057953 1:27684741-27684763 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
904127506 1:28251962-28251984 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
904131668 1:28280319-28280341 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
905080225 1:35312833-35312855 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
905507776 1:38493799-38493821 GCCTCAGCTTTCCAAGTGGATGG + Intergenic
905782811 1:40727643-40727665 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
905823614 1:41013470-41013492 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
905904507 1:41608967-41608989 GCCTCAACCTTCCAAGTAACTGG - Intronic
906059596 1:42939836-42939858 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
906139539 1:43525688-43525710 GCTTCACCCTTCCAAGTAGCTGG - Intronic
906408428 1:45560493-45560515 GCCTCACCCTTCCAAGTAGCTGG - Intronic
906450105 1:45938436-45938458 GCCTCAGCCTCCCAAGTGACTGG + Intronic
907253305 1:53158243-53158265 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
907470422 1:54670353-54670375 GCCTCAGCTTCCCAAGTAACTGG - Intronic
907799183 1:57747692-57747714 GCCTCACCCTCCCAAGTAACTGG - Intronic
908159330 1:61391173-61391195 GCCTCAGCATTCCAAGTGGCTGG + Intronic
908310503 1:62877257-62877279 GCCTCAGCTTTCCAAGTATCTGG - Intergenic
909943963 1:81642131-81642153 GCCTCAGCCTTCCAAGTAACTGG - Intronic
910571124 1:88704664-88704686 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
910618049 1:89221645-89221667 GAGTCTCCTTTGCAAGTCACTGG - Intergenic
911622316 1:100079191-100079213 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
912124814 1:106522817-106522839 GCCTCAGCCTTCCAAGTCACTGG - Intergenic
912858697 1:113193927-113193949 GCCTCACCCTCCCAAGTGACTGG + Intergenic
914382620 1:147131366-147131388 GCGTCAGCTTTCCAAGGAGCTGG + Intergenic
914738148 1:150438173-150438195 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
914778475 1:150760766-150760788 GCCTCAGCCTTCCAAGTAACTGG - Intronic
915092355 1:153435337-153435359 GCCTCATCCTTCCAAGTAACTGG - Intergenic
915159120 1:153904163-153904185 GCGTCAGCCTTCCAAGTAGCTGG - Intronic
915276206 1:154790021-154790043 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
915337488 1:155154150-155154172 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
916174662 1:162027685-162027707 GCCTTATCTTTCCAAGTAACTGG - Intergenic
916537244 1:165714853-165714875 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
916552683 1:165864060-165864082 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
917764342 1:178200731-178200753 ACGTCACCATTCCAAGTTGCAGG - Intronic
917862165 1:179156761-179156783 GCGTCACCTTTCCAAGTGACCGG - Intronic
918120705 1:181537212-181537234 GCCTCAGCTTCCCAAGTAACTGG + Intronic
918217102 1:182401218-182401240 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
918559527 1:185847836-185847858 CCCTCACCTTTCCAAGTAGCTGG - Intronic
919663641 1:200271709-200271731 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
920080403 1:203368815-203368837 GGGTCACCATTCCAGGTGACCGG - Intergenic
920578229 1:207079036-207079058 GCCTCACCTCTCCAAACGACTGG + Intronic
920904273 1:210146221-210146243 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
921012316 1:211154752-211154774 GCCTCACCCTCCCAAGTAACTGG + Intergenic
921105386 1:211971799-211971821 GCCTCACCCTTCCAAGTAGCTGG - Intronic
921112141 1:212049035-212049057 GCCTCAACTTCCCAAGTAACTGG + Intronic
921228860 1:213048509-213048531 GCTTCAGCCTCCCAAGTGACTGG + Intergenic
921789436 1:219272652-219272674 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
921865138 1:220080880-220080902 TCCTTACTTTTCCAAGTGACTGG - Intronic
922292048 1:224216414-224216436 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
922370860 1:224909548-224909570 GCCTCAGCTTCCCAAGTAACTGG + Intronic
922498258 1:226077609-226077631 GCCTCAGCCTTCCAAGTGACTGG - Intergenic
922826844 1:228527337-228527359 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
922842368 1:228653432-228653454 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
923027157 1:230214225-230214247 GCCTCAGCTTCCCAAGTAACTGG + Intronic
923570124 1:235106164-235106186 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
924156200 1:241179207-241179229 GCTTCAGCCTTCCAAGTAACTGG + Intronic
924186191 1:241493912-241493934 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
924856623 1:247880918-247880940 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1063214295 10:3910035-3910057 GCGTCAGCCTTCCAAGTAGCTGG - Intergenic
1063559892 10:7116061-7116083 GCCTCAGCGTTCCAAGTAACTGG - Intergenic
1064993571 10:21277321-21277343 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1065965610 10:30768025-30768047 GAGTCACCTTCCCCAGTGAGGGG + Intergenic
1066118465 10:32261091-32261113 GCGTCAGCTTCCCAAGTAGCTGG + Intergenic
1066188570 10:33034639-33034661 GCCTCATCTTCCCAAGTAACTGG - Intergenic
1066279196 10:33898672-33898694 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
1066401906 10:35085003-35085025 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1066403657 10:35098817-35098839 GCGTCAGCCTCCCAAGTAACTGG - Intergenic
1066598915 10:37083198-37083220 GCCTCACCTTCCCAAGTACCTGG + Intergenic
1067315890 10:45161988-45162010 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
1067852019 10:49760347-49760369 GCAGCACCTCTCCAAGTGCCAGG + Intronic
1067852789 10:49765402-49765424 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1068032071 10:51716805-51716827 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1068570426 10:58621781-58621803 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1068770317 10:60813681-60813703 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1069379062 10:67823584-67823606 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1069399076 10:68022382-68022404 GCCTCAGTTTCCCAAGTGACTGG - Intronic
1069416530 10:68205570-68205592 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1069446771 10:68479895-68479917 GAGTCATCTTTCCAAGTAACTGG - Exonic
1069500181 10:68945419-68945441 GCGTCAGCTTCCCGAGTAACTGG + Intronic
1069658318 10:70106681-70106703 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1069956107 10:72052958-72052980 GCTGCAACTGTCCAAGTGACAGG + Intergenic
1070155538 10:73832419-73832441 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
1070169907 10:73925171-73925193 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1070263661 10:74881766-74881788 GTGTCAGTTTTCCAAGTAACTGG + Intronic
1070317522 10:75329578-75329600 GCGTCAGCTTCCCAAGTAGCTGG + Intergenic
1072974660 10:100047119-100047141 GCTTCATCTTTCCAAGTAGCTGG - Intronic
1073083726 10:100875307-100875329 GCGTCACCTACCCACGTGAGTGG - Intergenic
1073092821 10:100957463-100957485 GCCTCACCCTCCCAAGTAACTGG + Intronic
1073886868 10:108049544-108049566 GCTTCAGCTTTCCAAGTAGCTGG - Intergenic
1074072568 10:110087141-110087163 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1074519071 10:114200636-114200658 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1074522291 10:114236769-114236791 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1075019815 10:118943681-118943703 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1075351414 10:121728026-121728048 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1077084155 11:739855-739877 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1077205764 11:1343261-1343283 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1077628040 11:3791008-3791030 GCGTCAGCCTTCCGAGTAACTGG + Intronic
1077790431 11:5433715-5433737 GCTTCAGCTTCCCAAGTAACTGG - Intronic
1078218432 11:9331571-9331593 GCGTCAGCTTCCCAAGTAGCTGG + Intergenic
1079220146 11:18553209-18553231 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1079246473 11:18755887-18755909 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1079285444 11:19126449-19126471 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1080881354 11:36323768-36323790 GCATCAGCTTTCCAAGTAACTGG - Intronic
1081291464 11:41330690-41330712 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1081476509 11:43438270-43438292 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1081898281 11:46605998-46606020 GCCTCACCTTACCAAGTAGCTGG + Intronic
1082019190 11:47517130-47517152 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1083017462 11:59470045-59470067 GCCTCAGCTTCCCAAGTGGCAGG - Intergenic
1083034238 11:59621803-59621825 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1084026903 11:66456299-66456321 GCCTCAGCTTTCCAAGTAACTGG + Intronic
1084489322 11:69469835-69469857 GCCTCAGCTTTCCAAGTGACTGG + Intergenic
1085112940 11:73903967-73903989 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1085256912 11:75179849-75179871 GCGTCATCCTCCCAAGTGGCTGG + Intronic
1086335579 11:85797511-85797533 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1087582037 11:100069265-100069287 GCCTCAACCTTCCAAGTGGCTGG + Intronic
1087776640 11:102262610-102262632 GCCTCACCTCTCAAAGAGACGGG - Intergenic
1088290610 11:108232975-108232997 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1088306275 11:108411899-108411921 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1088901896 11:114124501-114124523 CCATCCCCTTTCCAAATGACTGG - Intronic
1089382023 11:118040099-118040121 GCCTCAGCTTTCCAAGTAAGTGG - Intergenic
1089501807 11:118936544-118936566 GCGTCACCCTCCCAAGTAGCTGG + Intronic
1089517140 11:119040372-119040394 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
1089763038 11:120742229-120742251 GCCTCAGCCTCCCAAGTGACTGG - Intronic
1089821454 11:121230956-121230978 GCTTCACCTTTCACTGTGACTGG - Intergenic
1090399375 11:126439214-126439236 GCCTCAACCTTCCAAGTAACTGG - Intronic
1092224661 12:6739939-6739961 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1092249854 12:6887870-6887892 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1092383872 12:8020339-8020361 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1092682836 12:11006495-11006517 GCCTCAGCTTGCCAAGTAACTGG + Intronic
1092762640 12:11823579-11823601 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1092795823 12:12109567-12109589 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1093012767 12:14126291-14126313 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1094591077 12:31821518-31821540 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
1095737564 12:45574554-45574576 GCGTCAGCCTTCCAAGTAGCTGG - Intergenic
1095912307 12:47440883-47440905 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1096026302 12:48365938-48365960 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1096027223 12:48377000-48377022 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1096271578 12:50169691-50169713 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1096337572 12:50767985-50768007 GCGTCATCTTCCCAAGTAGCTGG + Intronic
1096554039 12:52392334-52392356 GCTTCAGCTTCCCAAGTGGCTGG + Intergenic
1096702780 12:53397124-53397146 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1097084932 12:56460460-56460482 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1097658042 12:62393702-62393724 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1097849858 12:64401066-64401088 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1097875215 12:64636749-64636771 GCCTCACCCTCCCAAGTGGCTGG - Intronic
1098278756 12:68840957-68840979 GCCTCAGCCTTCCAAGTAACTGG + Exonic
1099194226 12:79595735-79595757 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1099947987 12:89266741-89266763 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
1100426349 12:94490609-94490631 GCCTCACCCTCCCAAGTAACTGG + Intergenic
1100459081 12:94780660-94780682 GCTTCACCCTTCCAAGTAGCTGG - Intergenic
1100466726 12:94852632-94852654 GCCTCAGCTTCCCGAGTGACTGG - Intergenic
1100491613 12:95085327-95085349 GCTTCACCCTCCCAAGTGTCTGG + Intronic
1100542218 12:95568280-95568302 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1101145448 12:101836606-101836628 GCCTCAGCTTCCCAAGTGTCTGG + Intergenic
1101282940 12:103278454-103278476 GCATCTCCTTTCCATATGACTGG - Intronic
1101305652 12:103525130-103525152 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1101914519 12:108885867-108885889 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1102125289 12:110475684-110475706 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1102395882 12:112585433-112585455 GCGTAACCTTTTCAAGAAACGGG - Intronic
1102403177 12:112648931-112648953 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1102782618 12:115578392-115578414 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1102952608 12:117040587-117040609 GCGTCACCTTCTCTGGTGACCGG + Intronic
1103072035 12:117952559-117952581 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1103378662 12:120477042-120477064 GCCTCAACTTCCCAAGTAACTGG + Intronic
1103593242 12:122007144-122007166 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
1103605722 12:122084659-122084681 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1103644758 12:122382411-122382433 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1103664533 12:122552477-122552499 GCTTCAGCTTCCCAAGTGGCTGG + Intronic
1103795013 12:123497331-123497353 GCCTCATCTTCCCAAGTAACTGG + Intronic
1104569292 12:129910962-129910984 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1105281808 13:18968394-18968416 GCCTCACCATTCCAAGTAGCTGG + Intergenic
1105548565 13:21370246-21370268 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1105570329 13:21596536-21596558 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1105703324 13:22950128-22950150 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1105745063 13:23369971-23369993 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1105865233 13:24453047-24453069 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
1106082306 13:26510633-26510655 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1106346157 13:28880769-28880791 GCCTCATCTTTTCAAGTGACAGG - Intronic
1106782877 13:33077149-33077171 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
1107255424 13:38420326-38420348 GCTTCAGCTTCCCAAGTCACTGG - Intergenic
1107511552 13:41090801-41090823 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1107646062 13:42495687-42495709 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1107901205 13:45016337-45016359 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1108399300 13:50023015-50023037 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1108444231 13:50491269-50491291 GCTTCACCCTTCCAAGTAGCTGG + Intronic
1108882964 13:55143641-55143663 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1109217329 13:59604461-59604483 ACTTCAGCTTTCCAAGTGGCTGG - Intergenic
1109252693 13:60039416-60039438 GCTTCAGCTTCCCAAGTGGCAGG + Intronic
1109836441 13:67863435-67863457 GCCTCAGCTTTACAAGTAACTGG - Intergenic
1110112272 13:71762650-71762672 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1111047861 13:82839086-82839108 GCCTCACCCTTCCAAGTATCTGG + Intergenic
1111352505 13:87049900-87049922 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1111730622 13:92072379-92072401 GCCTCAACTTTCCAAGTAGCTGG + Intronic
1112158390 13:96842873-96842895 GCGTCAGCCTTCCAAGTAGCTGG + Intergenic
1112331703 13:98481950-98481972 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1112732856 13:102386245-102386267 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1112789896 13:102991682-102991704 GCATCAGCTTTCCAAGTACCTGG - Intergenic
1113097064 13:106677382-106677404 GCGTCAGCTTCCCAAGTAGCTGG - Intergenic
1113158207 13:107349624-107349646 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1113284515 13:108831625-108831647 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1113295816 13:108957430-108957452 GCTGCACCTTTCCTTGTGACAGG - Intronic
1113367640 13:109691143-109691165 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1113420530 13:110168132-110168154 GCTTCAGCCTTCCAAGTGGCTGG + Intronic
1113827984 13:113271617-113271639 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1114232344 14:20795089-20795111 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1114274275 14:21127948-21127970 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1114344247 14:21779087-21779109 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1114541520 14:23463626-23463648 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1116364229 14:44039942-44039964 GAGTCACATTTCCACATGACTGG - Intergenic
1116382564 14:44289580-44289602 GCCTCAGCTTTCCCAGTAACTGG - Intergenic
1117023254 14:51594237-51594259 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1117043460 14:51788994-51789016 GCCTCACCTTCCCAAGTGGCTGG - Intergenic
1117185363 14:53234444-53234466 GCCTCACCTTCCCGAGTGGCTGG + Intergenic
1117230278 14:53709904-53709926 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1117680394 14:58197779-58197801 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1118011271 14:61612979-61613001 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1118217934 14:63827161-63827183 GTGTCACCTTCCCAAGTAGCTGG - Intergenic
1118220465 14:63851244-63851266 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1118357482 14:65026745-65026767 GCCTCACCCTTCCAAGTAGCTGG - Intronic
1118572399 14:67206843-67206865 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1119149156 14:72342449-72342471 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1119307804 14:73621876-73621898 ACCTCAACTTCCCAAGTGACTGG + Intergenic
1119314575 14:73681995-73682017 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1120168355 14:81224029-81224051 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1120240926 14:81948718-81948740 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1122186928 14:100006397-100006419 GCGTCAGCTTCCCAAGTAGCGGG + Intronic
1123044441 14:105504346-105504368 GTGTCTGCTTTCCAAGTCACTGG - Intergenic
1123150204 14:106174416-106174438 GAGTCACCATTACCAGTGACAGG - Intergenic
1123462848 15:20489551-20489573 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
1123486938 15:20749321-20749343 GCGTCAGCCTTCCAAGTAGCTGG + Intergenic
1123543425 15:21318379-21318401 GCGTCAGCCTTCCAAGTAGCTGG + Intergenic
1123655211 15:22510868-22510890 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1123664670 15:22598958-22598980 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1123951674 15:25284513-25284535 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1124273685 15:28306947-28306969 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
1124309121 15:28606069-28606091 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1124318506 15:28693408-28693430 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1124564936 15:30804038-30804060 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1124953066 15:34341136-34341158 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1125116206 15:36094729-36094751 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1125628321 15:41127280-41127302 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1125707089 15:41748140-41748162 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1125771559 15:42170844-42170866 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1125820482 15:42626034-42626056 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1126582137 15:50251715-50251737 GCCTCAGCTTTCCAAGTATCTGG - Intronic
1126718908 15:51555041-51555063 GCCTCAGCCTCCCAAGTGACTGG - Intronic
1127048283 15:55051406-55051428 GCCTCAACTTTCCAAGTAGCTGG + Intergenic
1127399820 15:58574419-58574441 GCCTCAGCCTTCCAAGTCACTGG + Intergenic
1127466083 15:59246230-59246252 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1127787500 15:62368866-62368888 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1127984456 15:64059013-64059035 GCCTCAGCCTTCCTAGTGACTGG + Intronic
1128163687 15:65441942-65441964 GCGTCAGCCTTCCAAGTAGCTGG - Intergenic
1128278488 15:66374692-66374714 GCCTCACCCTTCCAAGTAGCTGG + Intronic
1128284794 15:66427897-66427919 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1128293408 15:66496874-66496896 GCTTCACCTTCCCAAGTAGCTGG - Intronic
1128588867 15:68876630-68876652 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1128641065 15:69337960-69337982 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1128641266 15:69339585-69339607 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1129143376 15:73623570-73623592 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1129305709 15:74659928-74659950 GCTTCAGCTTTCCAAGTAGCTGG - Intronic
1130610411 15:85355656-85355678 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1131241116 15:90744485-90744507 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1131900444 15:97082321-97082343 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1131976991 15:97957010-97957032 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1132282633 15:100633460-100633482 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1132800977 16:1753064-1753086 ACGTCAGCTTTGCACGTGACGGG + Intronic
1133121699 16:3612363-3612385 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1133187191 16:4108486-4108508 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1133227146 16:4346832-4346854 GCCTCACCCTCCCAAGTAACTGG + Intronic
1133250879 16:4480160-4480182 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1133268265 16:4597669-4597691 TCTTCAGCCTTCCAAGTGACTGG + Intronic
1133282578 16:4675614-4675636 GCCTCAGCCTTCCAAGTCACTGG - Intronic
1133554325 16:6890402-6890424 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
1133666303 16:7971467-7971489 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1133886307 16:9831355-9831377 GTGTCACTTTTCCAAGAGAAAGG - Intronic
1134182401 16:12058606-12058628 GCCTCACCCTTCCAAGTAGCTGG + Intronic
1134274994 16:12767840-12767862 GCCTCACCCTCCCAAGTAACTGG - Intronic
1134623435 16:15707151-15707173 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1134854870 16:17510038-17510060 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1135073233 16:19370683-19370705 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1135095413 16:19560679-19560701 GCCTCAGCCTCCCAAGTGACTGG - Intronic
1135426530 16:22341534-22341556 GCGTCAGCCTCCCAAGTAACTGG - Intergenic
1135558458 16:23456387-23456409 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1136251862 16:29010645-29010667 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1136524257 16:30818207-30818229 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1136623771 16:31448592-31448614 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1136679847 16:31952372-31952394 GAGTCACCATTACCAGTGACAGG + Intergenic
1136890214 16:33965729-33965751 GAGTCACCATTACCAGTGACAGG - Intergenic
1137248714 16:46727639-46727661 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1137254559 16:46764267-46764289 GCCTCACCCTTCCAAGTAGCTGG - Intronic
1137452974 16:48594467-48594489 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1137602464 16:49765603-49765625 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1138049489 16:53761209-53761231 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1138828430 16:60350428-60350450 GCCTCACCTTCCCAAGTAACTGG + Intergenic
1138900914 16:61268773-61268795 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
1139621886 16:68151952-68151974 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1139675435 16:68520204-68520226 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1139755317 16:69138350-69138372 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1139895418 16:70284485-70284507 GCCTCAGCTTTCCGAGTAACTGG - Intronic
1140815430 16:78616652-78616674 GCCTCACCCTTCCAAGTGGCTGG - Intronic
1140918738 16:79517687-79517709 GCCTCAGCCTTCCAAGTCACAGG + Intergenic
1140937152 16:79683945-79683967 GCTTCAGCTTCCCAAGTGTCTGG + Intergenic
1141154694 16:81589209-81589231 GCGTCAGCTTCCCAAGTAGCTGG + Intronic
1141202159 16:81906536-81906558 GCCTCATCTTCCCAAGTAACTGG + Intronic
1141252843 16:82374528-82374550 GCGTCAGCCTTCCAAGTAGCTGG + Intergenic
1141333552 16:83134302-83134324 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1141528103 16:84626451-84626473 GCCTCACCTTCCCTAGTGGCTGG + Intergenic
1141712599 16:85708652-85708674 CTGTGACCTTTCCAAGTGCCTGG - Intronic
1142014493 16:87737471-87737493 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1142025344 16:87809969-87809991 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1203082817 16_KI270728v1_random:1157885-1157907 GAGTCACCATTACCAGTGACAGG + Intergenic
1142677078 17:1520481-1520503 GCTCCACCCTCCCAAGTGACAGG - Exonic
1142913670 17:3116142-3116164 GCGTCACCTGGCCAAGTGAGGGG + Intergenic
1142969531 17:3601709-3601731 GCCTCACCCTCCCAAGTAACTGG + Intergenic
1143139360 17:4732306-4732328 GCCTCACCCTTCCAAGTAGCTGG - Intronic
1144472396 17:15556474-15556496 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1144620754 17:16817004-16817026 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1144838258 17:18169329-18169351 GCCTCACCCTCCCAAGTGGCTGG - Intronic
1144924079 17:18788214-18788236 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1145008332 17:19350951-19350973 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1145030673 17:19502477-19502499 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1145184666 17:20784119-20784141 GCCTCACCGTTCCAAGTAGCTGG - Intergenic
1145188027 17:20813168-20813190 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1145926595 17:28652054-28652076 GCGTCAGCCTTCCAAGTAGCTGG - Intronic
1146104174 17:30015891-30015913 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1146248708 17:31316314-31316336 GTGTTTCCTTTCCAAATGACAGG - Intronic
1146390550 17:32418276-32418298 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1146903604 17:36603514-36603536 GCTTCAGCCTTCCAAGTAACTGG + Intronic
1146904617 17:36610038-36610060 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
1146906196 17:36619551-36619573 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1147216772 17:38904476-38904498 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1147257166 17:39188458-39188480 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1147296114 17:39483955-39483977 GCCTCAACTTCCCAAGTGGCTGG + Intronic
1147473235 17:40684359-40684381 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1148074090 17:44925664-44925686 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1148258318 17:46156230-46156252 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
1148285683 17:46389078-46389100 GCCTCACCTTCCCAAGTACCTGG - Intergenic
1148307846 17:46606695-46606717 GCCTCACCTTCCCAAGTACCTGG - Intronic
1148411715 17:47472953-47472975 GCCTCACCCTTCCAAGTAGCTGG + Intergenic
1148427698 17:47614083-47614105 GCGTCAGCCTTCCAAGTAGCTGG + Intronic
1148811989 17:50299060-50299082 GCCTCACCCTTCCAAGTAGCTGG + Intergenic
1148844690 17:50522577-50522599 GCCTCAGCTTTCCAAGTAGCAGG - Intronic
1148997219 17:51721447-51721469 GCCTCAACCTTCCAAGTAACTGG + Intronic
1149312171 17:55405253-55405275 GCGTCAGCCTTCCAAGTAGCTGG - Intronic
1149822384 17:59792160-59792182 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1149890588 17:60385725-60385747 GCGTCAGCCTTCCAAGTAGCTGG - Intronic
1150263121 17:63812908-63812930 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1150297558 17:64021187-64021209 TCCTCAACTTCCCAAGTGACTGG + Intergenic
1150351317 17:64446981-64447003 GCCTCACCCTCCCAAGTAACTGG - Intergenic
1150480807 17:65508225-65508247 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1150678841 17:67267893-67267915 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1151260828 17:72914751-72914773 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1151298379 17:73202671-73202693 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1151320790 17:73351222-73351244 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1151551951 17:74827408-74827430 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1151621189 17:75246075-75246097 GCGACACCTTCGCTAGTGACTGG + Intronic
1151695513 17:75714559-75714581 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1151865150 17:76796863-76796885 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1152377164 17:79924802-79924824 GTGTCATCTTTCCAGGTGGCAGG - Intergenic
1152807745 17:82364866-82364888 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1152958337 18:59656-59678 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1153049982 18:893041-893063 GCCTCAGCTTTCCAAGTATCTGG - Intergenic
1153061367 18:998190-998212 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1153298218 18:3568799-3568821 GCCTCAGCTTCCCAAGTGTCTGG + Intronic
1153314207 18:3706109-3706131 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1153321708 18:3779902-3779924 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1153347668 18:4045482-4045504 GCCTCACCCTCCCAAGTAACTGG - Intronic
1153484377 18:5581880-5581902 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1153551354 18:6264667-6264689 GCTTCAGCTTTCCAAGTAGCTGG - Intronic
1153877610 18:9388802-9388824 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1153992836 18:10415164-10415186 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1154264493 18:12868367-12868389 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1154361422 18:13665263-13665285 GCCTCAGCTTTCCAAGTAGCTGG - Exonic
1154392221 18:13948013-13948035 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
1154476895 18:14769219-14769241 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1154481275 18:14828155-14828177 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1155931681 18:31715338-31715360 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1156107214 18:33678002-33678024 GCCTCATCTTCCCAAGTAACTGG + Intronic
1156314598 18:35956581-35956603 GCGTCACCCTCCCAAGTAGCTGG + Intergenic
1157734848 18:50038245-50038267 CCTTCTCCTTCCCAAGTGACTGG - Intronic
1158104635 18:53871656-53871678 GCCTCACCCTTCCAAGTGGCTGG - Intergenic
1158177778 18:54677135-54677157 GCCTCACCCTCCCAAGTAACTGG + Intergenic
1158178811 18:54688507-54688529 GCCTCAACTTTCCAAGTAGCTGG - Intergenic
1158316632 18:56218379-56218401 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1158659678 18:59374829-59374851 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1159056989 18:63476167-63476189 GTCTCAGCTTTCCAAGTAACTGG + Intergenic
1161159530 19:2754274-2754296 GCGTCAGCCTTCCAAGTAGCTGG - Intergenic
1161181064 19:2882667-2882689 GCCTCACCCTCCCAAGTGGCTGG + Exonic
1161263985 19:3354739-3354761 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1161653707 19:5500175-5500197 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1161697032 19:5774900-5774922 GCCTCAGCTTTCCAAGTAGCGGG - Intronic
1161920663 19:7263162-7263184 GCCTCAGCCTTCCGAGTGACTGG - Intronic
1161945091 19:7430688-7430710 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1162117922 19:8442965-8442987 GCATCAGCTTTCCAAGTATCTGG - Intronic
1162773364 19:12964068-12964090 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1162875973 19:13621262-13621284 GCCTCAACTTTCCAAGTAGCTGG - Intronic
1163000862 19:14366045-14366067 GCGTCAGCCTTCCAAGTAGCTGG + Intergenic
1163452157 19:17384709-17384731 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1163530591 19:17846697-17846719 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1163583144 19:18150099-18150121 GCCTCAGCTTCCCAAGTGGCTGG + Exonic
1163811120 19:19432414-19432436 GCCTCACCCTCCCAAGTGGCTGG + Intronic
1164097482 19:22024362-22024384 ACGTCCCCATTCCAAGTGGCAGG + Intergenic
1164117668 19:22237809-22237831 ACGTCCCCATTCCAAGTGGCAGG + Intergenic
1164256069 19:23529367-23529389 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1164279266 19:23754549-23754571 GTCTCACCTTCCCAAGTAACTGG - Intronic
1164762499 19:30738407-30738429 ATGTCACCTTTCCTGGTGACTGG - Intergenic
1164960462 19:32424203-32424225 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1165029405 19:32986677-32986699 GCCTCAGCTTCCCGAGTGACTGG - Intronic
1165037593 19:33045164-33045186 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1165134422 19:33658223-33658245 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1165159523 19:33807823-33807845 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1165387386 19:35518707-35518729 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1165572155 19:36784543-36784565 GCGTCAGCTTCCCAAGTAGCTGG - Intergenic
1165580891 19:36862547-36862569 GCTTCAGCTTCCCAAGTGGCTGG - Intronic
1165614644 19:37189050-37189072 GCCTCACCCTCCCAAGTAACTGG + Intronic
1165619839 19:37236500-37236522 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
1165814022 19:38630266-38630288 GCCTCATCTTCCCAAGTGGCTGG + Intronic
1165906860 19:39199625-39199647 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1166089523 19:40499141-40499163 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1166322799 19:42029180-42029202 GCCTCACCCTTCCAAGTAGCTGG + Intronic
1166800370 19:45453010-45453032 GCTTCAGCCTTCCAAGTGGCTGG - Intronic
1166954842 19:46456629-46456651 ACGTCAGCTTTCCAAGTAGCTGG - Intergenic
1167025092 19:46910225-46910247 GCCTCACCCTTCCAAGTAGCTGG + Intergenic
1167228189 19:48264020-48264042 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1167278583 19:48553420-48553442 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1167322095 19:48803411-48803433 GCGTCAGCCTTCCAAGTAGCTGG - Intronic
1167500439 19:49843956-49843978 GCGTCACCCTTCCGAGTAGCTGG + Intergenic
1167547192 19:50134408-50134430 ACCTCACCCTCCCAAGTGACTGG - Intergenic
1167585949 19:50375981-50376003 GCCTCACCCTCCCAAGTAACTGG - Intronic
1167969323 19:53177002-53177024 GCTTCAGCTTCCCAAGTAACTGG - Intronic
1168031265 19:53681885-53681907 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1168218955 19:54946752-54946774 GCCTCAACCTTCCAAGTAACTGG + Intronic
1168223925 19:54980994-54981016 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1168565834 19:57422436-57422458 GCCTCAGCTTCCCAAGTGTCTGG + Intronic
926033113 2:9610621-9610643 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
926243751 2:11107012-11107034 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
926880193 2:17537205-17537227 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
927193051 2:20530196-20530218 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
927565491 2:24108784-24108806 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
928561414 2:32490418-32490440 GCGTCACCCTCCCAAGTAGCTGG - Intronic
928861834 2:35867736-35867758 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
929870790 2:45757550-45757572 GCCTCAGCCTTCCAAGTTACTGG - Intronic
929966119 2:46538239-46538261 GAGTGACCTTCCCAAATGACAGG + Intronic
930067093 2:47335954-47335976 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
930092140 2:47538654-47538676 GCCTCAGCCTTCCAAGTAACTGG - Intronic
930133872 2:47881135-47881157 GCGTCAGCCTCCCAAGTAACTGG - Intronic
930139656 2:47938801-47938823 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
930185016 2:48404632-48404654 GCGTCAGCTTTCCGAGTAGCTGG - Intergenic
930742209 2:54843311-54843333 GCTTCACCCTCCCAAGTAACTGG - Intronic
930813470 2:55567528-55567550 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
930956909 2:57213819-57213841 GCGTCAGCTTCCCAAGTAGCTGG + Intergenic
931008035 2:57875058-57875080 GATTCACCTTTCCAAATGAATGG + Intergenic
931326499 2:61230727-61230749 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
931339669 2:61387348-61387370 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
932138206 2:69250153-69250175 GCTTCACCTTCCCAAGTAGCTGG + Intergenic
932156874 2:69426085-69426107 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
932550251 2:72762127-72762149 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
932711640 2:74069699-74069721 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
933344829 2:81069685-81069707 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
933745616 2:85568893-85568915 GCCTCAGCCTTCCAAGTAACTGG - Intronic
934490240 2:94757392-94757414 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
934892600 2:98083870-98083892 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
935124424 2:100210905-100210927 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
935186558 2:100739477-100739499 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
935192900 2:100792865-100792887 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
935461725 2:103343611-103343633 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
935739827 2:106137678-106137700 GCCTCACCTTCCCAAGTAGCTGG - Intronic
935757423 2:106287187-106287209 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
936897138 2:117440791-117440813 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
937418287 2:121734676-121734698 GCGTCACCTTCCCAAGTAGCTGG - Intronic
937941214 2:127287517-127287539 GCCTCAGCCTCCCAAGTGACCGG - Intronic
938009291 2:127815772-127815794 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
938041693 2:128081491-128081513 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
938510594 2:131938221-131938243 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
938869115 2:135455301-135455323 GCCTCACCCTCCCAAGTGACTGG + Intronic
939452560 2:142393158-142393180 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
939967628 2:148626039-148626061 GAGTCACCTTACCAATTGAGTGG - Intergenic
940017321 2:149120904-149120926 GCCTCAGCTTCCCAAGTAACTGG + Intronic
940165278 2:150764004-150764026 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
940226792 2:151409359-151409381 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
940311923 2:152288158-152288180 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
941136733 2:161726792-161726814 GCCTCAGCTTCCCAAGTAACTGG - Intronic
942038350 2:172033466-172033488 GCCTCAGCTTCCCAAGTAACTGG + Intronic
942039525 2:172044789-172044811 GCCTCAGCTTCCCAAGTAACTGG - Intronic
942134817 2:172914446-172914468 GCCTCACCCTCCCAAGTAACTGG + Intronic
942307152 2:174619825-174619847 GCCTCAGCTTCCCAAGTAACTGG - Intronic
943139363 2:183960068-183960090 GCCTCAGCTTTCCAAGTAACTGG + Intergenic
943394855 2:187321782-187321804 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
943864968 2:192917729-192917751 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
944003238 2:194867804-194867826 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
944670479 2:201990229-201990251 GCCTCAACCTTCCAAGTAACTGG - Intergenic
944721156 2:202424257-202424279 GCCTCAGCTTCCCAAGTGGCAGG - Intronic
945064345 2:205935895-205935917 GCTTCAGCTTCCCAAGTGGCTGG - Intergenic
945079607 2:206075549-206075571 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
945081405 2:206089885-206089907 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
945243948 2:207701053-207701075 GCATCAGCTTCCCAAGTGGCTGG + Intergenic
945313263 2:208341120-208341142 GCCTCAGCTTCCCAAGTAACTGG + Intronic
946060772 2:216939475-216939497 ACCTCACCCTCCCAAGTGACTGG - Intergenic
946251849 2:218418812-218418834 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
946641166 2:221784868-221784890 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
946846502 2:223863305-223863327 GCCTCAGCTTCCCAAGTAACTGG + Intronic
947771635 2:232675059-232675081 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
947995117 2:234521084-234521106 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
949013921 2:241698841-241698863 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
1168752565 20:293346-293368 GCGTCAGCTTCCCAAGTAGCTGG - Intergenic
1168758960 20:335587-335609 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
1169350710 20:4865945-4865967 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1169530013 20:6474979-6475001 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1169713399 20:8589728-8589750 ACCTCAGCCTTCCAAGTGACTGG + Intronic
1170027686 20:11907884-11907906 GTCTCACCTTTCCCAGTGAGAGG - Intronic
1170224679 20:13978943-13978965 GCCTCAGCCTCCCAAGTGACCGG - Intronic
1170241110 20:14167496-14167518 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1170474650 20:16702874-16702896 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1170586064 20:17734970-17734992 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1170825237 20:19788485-19788507 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1172343221 20:34175782-34175804 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1172708676 20:36902850-36902872 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1172983108 20:38959933-38959955 GCCTCACCTTCCCAACTGGCTGG + Intergenic
1173379501 20:42527076-42527098 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1173513992 20:43652057-43652079 GCTTCAGCTTTCCGAGTAACTGG + Intergenic
1174024852 20:47565599-47565621 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1174216727 20:48921705-48921727 GCGTCACGTGACCACGTGACTGG - Intergenic
1174797615 20:53535523-53535545 GCCTCAGCCTCCCAAGTGACGGG + Intergenic
1174943492 20:54958395-54958417 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1175028598 20:55929820-55929842 GCCTCACCCTCCCAAGTGGCTGG - Intergenic
1175301546 20:57946742-57946764 GCTTCATGTGTCCAAGTGACAGG - Intergenic
1176783235 21:13225095-13225117 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1176799328 21:13408451-13408473 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1176895948 21:14378732-14378754 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1177452748 21:21292872-21292894 GACTCACAGTTCCAAGTGACTGG + Intronic
1177472760 21:21580057-21580079 ACGTCAGCTTCCCAAGTAACTGG - Intergenic
1177511715 21:22095329-22095351 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1177602095 21:23328994-23329016 GCGTCAGCCTCCCAAGTAACTGG + Intergenic
1177658501 21:24051151-24051173 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1177980879 21:27913878-27913900 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1178109054 21:29352633-29352655 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1178322569 21:31616513-31616535 ACGTCAGCTTCCCAAGTAACTGG - Intergenic
1178397427 21:32254414-32254436 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1178444383 21:32625467-32625489 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1178488974 21:33036030-33036052 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1179806240 21:43839289-43839311 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1180187767 21:46148220-46148242 GGGTCGCCTTGGCAAGTGACGGG + Intronic
1180856683 22:19051072-19051094 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1181611368 22:24015149-24015171 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
1181666664 22:24403027-24403049 GCCTCACCCCTCCAAGGGACTGG - Intronic
1181791975 22:25275437-25275459 GCGTCAGCTTCCCAAGTAGCTGG + Intergenic
1182110187 22:27717694-27717716 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1182132349 22:27864821-27864843 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1182363290 22:29760427-29760449 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1182474259 22:30567796-30567818 GCCTCACCCTTCCAAGTAGCTGG + Intronic
1182483853 22:30627503-30627525 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1183161876 22:36119624-36119646 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1183486688 22:38091170-38091192 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1183898238 22:40986071-40986093 GCCTCAGCTTCCCAAGTGTCTGG + Intergenic
1183941338 22:41297093-41297115 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1183997514 22:41646186-41646208 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1184126955 22:42494038-42494060 GCCTCACCCTCCCAAGTAACTGG - Intergenic
1184545689 22:45165348-45165370 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
949335482 3:2970207-2970229 GCCTCACCTTCCCAAGTAATTGG + Intronic
949983059 3:9515486-9515508 GCCTCAGCTTCCCAAGTAACTGG + Intronic
950051653 3:9995750-9995772 GCCTCACCCTTCCAAGTACCTGG + Intronic
950295136 3:11823368-11823390 GCCTCAGCTTCCCAAGTAACTGG + Intronic
950295211 3:11823938-11823960 GCCTCAGCTTCCCAAGTAACTGG + Intronic
950915678 3:16642725-16642747 GCTTCAGCTTCCCAAGTAACTGG - Intronic
952486663 3:33818631-33818653 GCGTCAGCTTTCCGAGTAGCTGG + Intronic
952785587 3:37151710-37151732 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
952799762 3:37278925-37278947 ACCTCAGCCTTCCAAGTGACTGG + Intronic
952811161 3:37404580-37404602 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
953256249 3:41293005-41293027 GCCTCAGCCTCCCAAGTGACCGG - Intronic
953746418 3:45577466-45577488 GCCTCAGCCTCCCAAGTGACTGG - Intronic
954037746 3:47861465-47861487 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
954168578 3:48781083-48781105 GCCTCAGCCTTCCAAGTAACTGG + Intronic
954559894 3:51548004-51548026 GCCTCAGCCTTCCAAGTAACTGG + Intronic
955197716 3:56820552-56820574 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
956471019 3:69566886-69566908 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
956497225 3:69840868-69840890 GCCTCACCCTTCCGAGTAACTGG + Intronic
956603029 3:71043430-71043452 CCAACACCTTTCGAAGTGACAGG + Intronic
957777507 3:84772751-84772773 GCCTCACCCTTCCAAGTAGCTGG + Intergenic
958540004 3:95458747-95458769 GCCTCAGCCTCCCAAGTGACGGG - Intergenic
959564139 3:107816991-107817013 GCTTCAACTTCCCAAGTAACCGG - Intergenic
959702623 3:109312217-109312239 GCCTCAGCCTTCCAAGTCACTGG - Intronic
959730131 3:109591556-109591578 GACTCACAGTTCCAAGTGACTGG + Intergenic
961724564 3:128918356-128918378 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
961855958 3:129871242-129871264 GCCTCACCCTCCCAAGTAACTGG - Intronic
962226523 3:133615360-133615382 GCCTCAGCTTCCCAAGTAACTGG - Intronic
962227995 3:133632288-133632310 GCCTCAGCTTCCCAAGTAACTGG - Intronic
962241154 3:133752205-133752227 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
962483741 3:135821270-135821292 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
962557630 3:136571764-136571786 GCCTCAGCTTTCCAAGTGGCTGG - Intronic
962737280 3:138337259-138337281 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
962811796 3:138965391-138965413 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
963132800 3:141874288-141874310 GCTTCACCCTTCCAAGTAGCTGG - Intergenic
963143990 3:141973232-141973254 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
963772820 3:149406197-149406219 GCCTCAGCCTTCCGAGTGACTGG - Intergenic
964465479 3:156986989-156987011 GCATCACCTTTCAAAGTGGGGGG + Intronic
964556506 3:157945329-157945351 GCCTCAGCTTCCCAAGTTACTGG - Intergenic
964744312 3:159997990-159998012 TAGTCACCATTCCAAGTGAGGGG - Intergenic
965305869 3:167062293-167062315 GCCTCAACCTTCCAAGTAACTGG + Intergenic
965531828 3:169778105-169778127 GCGTCAGCTTCCCAAGTAAGTGG - Intronic
965840682 3:172902150-172902172 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
966217397 3:177517831-177517853 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
966369466 3:179232970-179232992 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
966540050 3:181078922-181078944 GCCTCACCCTCCCAAGTAACTGG - Intergenic
966566630 3:181390085-181390107 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
966611989 3:181876773-181876795 GCCTCACCCTTCCAAGTAGCTGG + Intergenic
966740993 3:183233235-183233257 GCGTCACCCTCCCAAGTAGCTGG - Intronic
967304656 3:188048934-188048956 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
967608432 3:191476066-191476088 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
967781779 3:193448448-193448470 GCCTCAGCTTCCCAAGTAACTGG + Intronic
967975108 3:195030008-195030030 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
968012178 3:195290252-195290274 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
968290922 3:197539252-197539274 GCTTCAGCTTCCCAAGTGGCTGG + Intronic
968630593 4:1648996-1649018 GCGTCAGCTTCCCAAGTGTCTGG - Intronic
968773851 4:2526913-2526935 GCGTCAGCCTCCCAAGTAACTGG - Intronic
969276358 4:6138360-6138382 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
969421964 4:7102715-7102737 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
969797688 4:9538649-9538671 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
970334863 4:15026339-15026361 GCCTCAGCTTCCCAAGTAACTGG + Intronic
970420659 4:15903125-15903147 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
970598082 4:17618124-17618146 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
970953621 4:21785475-21785497 GCCTCAGCCTTCCAAGTAACTGG - Intronic
971541752 4:27826771-27826793 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
972564087 4:40254467-40254489 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
973242021 4:47967186-47967208 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
973717454 4:53691229-53691251 GCCTCAGCTTCCCAAGTAACTGG - Intronic
974040485 4:56853003-56853025 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
974783219 4:66582625-66582647 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
975776588 4:77794035-77794057 GCCTCACCCTCCCAAGTAACTGG - Intronic
975873010 4:78802962-78802984 GCCTCAGCTTTCCAAGTTGCTGG + Intronic
976398147 4:84580011-84580033 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
978062120 4:104351513-104351535 GACTCACCTTTCCCAGTGTCAGG + Intergenic
978328459 4:107586041-107586063 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
978755348 4:112295686-112295708 GCCTCAGCTTCCCAAGTAACTGG - Intronic
978797040 4:112718750-112718772 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
979265911 4:118702659-118702681 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
980131697 4:128822250-128822272 GCCTCAGCTTCCCAAGTAACTGG - Intronic
981431290 4:144663964-144663986 GGGCCACCCTGCCAAGTGACAGG - Intronic
982047574 4:151464138-151464160 GCCTCACCTTTCCAAGTAGCTGG + Intronic
982256160 4:153453420-153453442 GCCTCAGCTTTCCAAGTAACTGG + Intergenic
982337310 4:154254720-154254742 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
983201555 4:164865561-164865583 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
983313665 4:166098218-166098240 GCCTCACCCTCCCAAGTAACTGG - Intronic
983642462 4:169955683-169955705 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
983838043 4:172417532-172417554 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
984154675 4:176180592-176180614 GCCTCAGCTTCCCAAGTAACTGG - Intronic
984877503 4:184382547-184382569 GAGTCACTATTCCCAGTGACAGG + Intergenic
984879298 4:184396547-184396569 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
985489128 5:168988-169010 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
986590697 5:9366501-9366523 GCGTCAGCTTCCCAAGTCGCTGG + Intronic
987317284 5:16735453-16735475 GCCTCAGCTTTCCAAATTACTGG - Intronic
987709236 5:21487523-21487545 GCCTCAGCTTTCCAAGTCGCTGG - Intergenic
987744410 5:21951335-21951357 GCCTCACCCTCCCAAGTAACTGG + Intronic
987978975 5:25055128-25055150 GCTTCAGCTTCCCAAGTAACTGG - Intergenic
988046362 5:25960911-25960933 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
988212075 5:28216752-28216774 GCCTCAGCCTTCCAAGTGTCTGG - Intergenic
988515215 5:31898621-31898643 GCATCACTTTGCCATGTGACAGG - Intronic
988572936 5:32390034-32390056 GCCTCAGCTTTCCAAGTAACTGG - Intronic
988750376 5:34186629-34186651 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
988814494 5:34820495-34820517 GCGTCAGCTTCCCAAGTAGCTGG - Intronic
989039022 5:37208061-37208083 GCCTCAGCCTCCCAAGTGACTGG + Intronic
989059519 5:37396714-37396736 GCCTCAGCCTTCCAAGTAACTGG - Intronic
989071371 5:37514899-37514921 GCCTCAGCCTCCCAAGTGACTGG - Intronic
989136783 5:38163701-38163723 GTGCCACCTTTCCCAGGGACAGG + Intergenic
989391055 5:40901244-40901266 GCGTCAGCCTCCCAAGTCACTGG + Intergenic
990120907 5:52450296-52450318 GCTTCAGCTTCCCAAGTGGCTGG - Intergenic
990288251 5:54322346-54322368 GCCTCAGCTTTCCAAGTAACTGG - Intergenic
990584444 5:57196894-57196916 GCCTCAGCTTTCCAAGTAGCCGG + Intronic
990675058 5:58174846-58174868 ACCTCAGCTTTCCAAGTAACTGG + Intergenic
991147697 5:63325880-63325902 GCCTCAGCATTCCAAGTGGCTGG + Intergenic
991395028 5:66196499-66196521 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
991548628 5:67811983-67812005 GCCTCACCCTCCCAAGTGGCTGG + Intergenic
991738637 5:69649828-69649850 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
991759561 5:69906599-69906621 GCCTCAGCTTTCCAAGTCGCTGG - Intergenic
991787775 5:70211519-70211541 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
991790212 5:70229569-70229591 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
991814961 5:70504660-70504682 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
991818096 5:70525945-70525967 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
991838790 5:70781665-70781687 GCCTCAGCTTTCCAAGTCGCTGG - Intergenic
991880221 5:71211883-71211905 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
991882661 5:71229909-71229931 GCCTCAGCTTTCCAAGTCGCTGG + Intergenic
992308517 5:75468506-75468528 TCCTCACCTATCCCAGTGACAGG + Intronic
992431157 5:76713265-76713287 GCGTCAGCCTCCCAAGTAACTGG + Intergenic
994085275 5:95751376-95751398 GCCTCAGCCTTCCAAGTCACTGG - Intronic
994364396 5:98895636-98895658 GCCTCACCCTTCCAAGTAGCTGG - Intronic
994485684 5:100385448-100385470 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
994546446 5:101172831-101172853 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
995153295 5:108878018-108878040 GCCTCAGCTTTCCAAGTAATTGG + Intronic
995448049 5:112268261-112268283 GCCTCACCTTCCCAAGTAGCTGG - Intronic
996675302 5:126168152-126168174 GCACTACCTTTCCAAGTGGCAGG - Intergenic
997170594 5:131715369-131715391 GCCTCACCCTTCCAAGTAGCTGG - Intronic
997644986 5:135476104-135476126 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
998739441 5:145182036-145182058 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
999656789 5:153818411-153818433 CTGTCAACTTTCCAAGGGACAGG - Intergenic
999803773 5:155062772-155062794 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
999990712 5:157047434-157047456 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1001274514 5:170340688-170340710 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1001625122 5:173125926-173125948 GCCTCAGCCTTCCAAGTGACTGG - Intronic
1002551705 5:179998546-179998568 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1003131805 6:3401221-3401243 GCCTCAGCCTCCCAAGTGACTGG - Intronic
1003537715 6:6990106-6990128 GCTTCAGCTTCCCAAGTAACTGG - Intergenic
1003574280 6:7278513-7278535 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1004147485 6:13081710-13081732 GCTTCAGCTTCCCAAGTGGCTGG - Intronic
1004197572 6:13518664-13518686 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1004375996 6:15091255-15091277 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1004377838 6:15106160-15106182 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
1004625922 6:17377015-17377037 GCTTCAGCTTTCCAAGTAGCTGG - Intergenic
1004626072 6:17378412-17378434 GCTTCACCCTCCCAAGTGGCTGG - Intergenic
1005062981 6:21794668-21794690 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1005085562 6:22003021-22003043 GCCTCAGCTTTCCGAGTGGCTGG - Intergenic
1005348916 6:24915467-24915489 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1005472377 6:26173867-26173889 GCCTCACTTTCCCAAGTAACAGG + Intergenic
1005476349 6:26211614-26211636 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1005548444 6:26892932-26892954 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1005800445 6:29416849-29416871 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1005865769 6:29934921-29934943 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1006135407 6:31892829-31892851 AGGTCACCTTTCCCAGTGAGTGG + Exonic
1006770920 6:36551848-36551870 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1006802297 6:36766967-36766989 GCCTCACCCTCCCAAGTGTCTGG + Intronic
1007125102 6:39419237-39419259 GCCTCAGCTTCCCATGTGACTGG - Intronic
1007414066 6:41682001-41682023 ACAACACCTTTCCAAGTGTCAGG - Intergenic
1007537542 6:42607280-42607302 GCCTCAGCCTTCCAAGTAACTGG + Intronic
1007671361 6:43557011-43557033 GCCTCACCCTCCCAAGTAACTGG - Intronic
1008102437 6:47406336-47406358 GCTTCAGCTTCCCAAGTGGCTGG - Intergenic
1008151747 6:47961404-47961426 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1008198413 6:48554629-48554651 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1008546134 6:52585300-52585322 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1009019204 6:57934042-57934064 GCCTCACCTTTCCAAGTAGCTGG + Intergenic
1010153164 6:72760109-72760131 GGGTCCCCTTTCCAGATGACAGG + Intronic
1011419684 6:87157801-87157823 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1011472445 6:87721492-87721514 GCTTCAGCTTTCCAAGTAGCTGG + Intergenic
1012255128 6:97022582-97022604 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1012807618 6:103915036-103915058 GTGTCACATTTGAAAGTGACAGG + Intergenic
1012842102 6:104342352-104342374 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1013129143 6:107214865-107214887 ACCTCAGCTTTCCAAGTAACTGG + Intronic
1013203258 6:107922389-107922411 GCTTCACCTTCCCAAGTAGCTGG - Intronic
1013280802 6:108635184-108635206 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1013568180 6:111391178-111391200 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1013774427 6:113663812-113663834 GCTTCAGCTTCCCAAGTAACTGG - Intergenic
1013987572 6:116213974-116213996 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1014041403 6:116831194-116831216 GCCTCACCTTCCCAAGTAGCTGG + Intergenic
1014325131 6:119984697-119984719 GCGTCACCCTCCCAAGTAGCTGG + Intergenic
1014327464 6:120017396-120017418 GAGTCACAGTTCCAAGTGGCTGG + Intergenic
1014951473 6:127560709-127560731 GCCTCAGCCTTCCAAGTAACTGG - Intronic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1015404503 6:132821945-132821967 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1016021395 6:139239605-139239627 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1016696667 6:147004176-147004198 GCGGCATCTTCCCACGTGACAGG + Intergenic
1016856630 6:148677106-148677128 GCCTCAGCTTCCCGAGTGACTGG - Intergenic
1016922174 6:149306635-149306657 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1016955937 6:149626867-149626889 GCCTCAGCTTTCCAAGTAACTGG - Intronic
1017156855 6:151330207-151330229 ACCTCAGCTTCCCAAGTGACTGG - Intronic
1017165988 6:151408809-151408831 TCCTCACCTTTTCCAGTGACTGG - Intronic
1017166390 6:151412114-151412136 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1017236731 6:152124189-152124211 GCCTCAGCCTCCCAAGTGACTGG - Intronic
1017788488 6:157775241-157775263 GCTTCAGCTTCCCAAGTGGCTGG - Intronic
1017977473 6:159370747-159370769 ACGTCCCCATTCCAAGTGGCAGG + Intergenic
1018021456 6:159765228-159765250 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1018315852 6:162555874-162555896 GCCTCGCCTTCCCAAGTAACTGG - Intronic
1018389809 6:163333523-163333545 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1018404656 6:163466008-163466030 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1018562680 6:165118568-165118590 GATTCACCATTCCATGTGACTGG - Intergenic
1019302543 7:314772-314794 GCATCACCTTCCCAAGTAGCTGG + Intergenic
1019467641 7:1198707-1198729 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1019669774 7:2271156-2271178 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1019813457 7:3182280-3182302 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1021083153 7:16386903-16386925 GCCTCACCCTTCCAAGTAGCTGG - Intronic
1021398718 7:20183820-20183842 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1021448634 7:20760268-20760290 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1021563076 7:21988054-21988076 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1022001657 7:26231842-26231864 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1022082639 7:27037714-27037736 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1022305313 7:29141433-29141455 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1022526329 7:31039954-31039976 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1022736610 7:33081943-33081965 GCGTCAGCCTCCCAAGTGGCTGG - Intergenic
1022919837 7:35002008-35002030 GCTTCAGCTTTCCAAGTAGCTGG - Intronic
1023455419 7:40333520-40333542 GCCTCACCCTCCCAAGTAACTGG - Intronic
1023604787 7:41919890-41919912 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1023922872 7:44643223-44643245 GCCTCTGCTTCCCAAGTGACTGG + Intronic
1024102917 7:46051125-46051147 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1024835969 7:53519251-53519273 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1025054488 7:55753887-55753909 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
1025175285 7:56797472-56797494 GCCTCACCCTTCCAAGTAGCCGG + Intergenic
1025276765 7:57588929-57588951 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1025696516 7:63778936-63778958 GCCTCACCCTTCCAAGTAGCCGG - Intergenic
1025958762 7:66202821-66202843 GCTCCACCTTCCAAAGTGACGGG - Intergenic
1026340862 7:69432827-69432849 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1026835820 7:73638417-73638439 GCTTCAGCCTTCCAAGTGGCTGG + Intergenic
1026860386 7:73783379-73783401 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
1026956967 7:74382963-74382985 GCCTCACCTTCCCAAGTATCTGG - Intronic
1027220295 7:76209717-76209739 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
1027664219 7:81024224-81024246 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1027679071 7:81196265-81196287 GCCTCACCCTTCCAAGTAGCTGG - Intronic
1028310464 7:89326947-89326969 GCATCACTTTTACAAGTGAGGGG + Intronic
1028553875 7:92102039-92102061 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
1028593027 7:92518682-92518704 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1028686950 7:93601019-93601041 GCCTCACCATTCCAAGTAGCTGG - Intronic
1028818912 7:95183250-95183272 GCGTCACCCTCCCAAGTAGCTGG + Intronic
1029384871 7:100237055-100237077 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
1029495010 7:100891893-100891915 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1029546896 7:101215325-101215347 GCTTCAGCCTTCCAAGTAACTGG + Intronic
1030028471 7:105347740-105347762 GCTTCAGCTTTCCAAGTAGCTGG - Intronic
1031621404 7:123938215-123938237 GCTTCAGCTTTCCAAGCAACTGG + Intronic
1032124242 7:129180799-129180821 GCCTCAGCCTTCCAAGTGGCTGG + Intergenic
1032238820 7:130145545-130145567 GCCTCACCCTCCCAAGTGGCAGG - Intergenic
1032960995 7:137033779-137033801 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1033137478 7:138797330-138797352 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1033351239 7:140563861-140563883 GCCTCATCTTCCCAAGTAACTGG - Intronic
1033883934 7:145921253-145921275 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1033889614 7:145995132-145995154 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1034158576 7:148975721-148975743 GCTTCAGCTTTCCAAGTAGCTGG + Intergenic
1034383160 7:150716675-150716697 GGCTCACCTTTCCTGGTGACAGG - Exonic
1034596823 7:152204181-152204203 GCGTCAGCGTCCCAAGTGGCTGG - Intronic
1034650392 7:152685573-152685595 GCATCACCTTCCCAAGTAGCTGG + Intergenic
1034759166 7:153655007-153655029 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1035720802 8:1790342-1790364 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1036524206 8:9519809-9519831 GCCTCAGCCTTCCAAGTGGCTGG - Intergenic
1036552042 8:9824453-9824475 GCTTCAGCCTTCCAAGTAACTGG - Intergenic
1036698167 8:10992946-10992968 ATGTCACCTTTCCCAATGACTGG + Intronic
1036736663 8:11324740-11324762 GCCTCAGCTTTCCTAGTGGCTGG - Exonic
1037380304 8:18277895-18277917 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1037587333 8:20287186-20287208 GCCTCTCATTTCCAAGTGACCGG - Intronic
1038173721 8:25162270-25162292 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1038281205 8:26166711-26166733 GCTTCAGCTTCCCAAGTAACTGG - Intergenic
1038322022 8:26536034-26536056 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
1038459003 8:27700490-27700512 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
1038731230 8:30129588-30129610 GCCTCACCCTTCCAAGTAGCTGG - Intronic
1039472040 8:37819481-37819503 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1039539908 8:38357002-38357024 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1039574062 8:38609682-38609704 GACTCACCATTCCATGTGACTGG + Intergenic
1039872118 8:41555208-41555230 GCGTCAGCCTCCCAAGTGGCTGG + Intergenic
1039902482 8:41763099-41763121 GCCTCACCCTCCCAAGTAACTGG - Intronic
1040006199 8:42622957-42622979 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1040372550 8:46791414-46791436 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1040458067 8:47620387-47620409 GCCTCACCCTTCCAAGTAACTGG + Intronic
1040491025 8:47922355-47922377 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1040832609 8:51694246-51694268 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
1041078008 8:54186780-54186802 GGGTTCCCTTTCCAAGTGCCAGG - Intergenic
1041449298 8:57990319-57990341 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1041668267 8:60467072-60467094 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1041744949 8:61198492-61198514 GCGTCAGCCTTCCAAGTAGCTGG + Intronic
1042139873 8:65667159-65667181 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1042248116 8:66728439-66728461 GCCTCAGCCTTCCAAGTCACTGG + Intronic
1042296328 8:67222378-67222400 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1042327826 8:67546937-67546959 GCCTCAGCCTTCCAAGTCACTGG + Intronic
1043152208 8:76731954-76731976 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1043850463 8:85210564-85210586 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1044659010 8:94577570-94577592 GCTTCAGCTTTCCAAGTAGCTGG - Intergenic
1044986114 8:97757735-97757757 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1045393567 8:101738427-101738449 GCCTCACCTTCCCGAGTAACTGG - Intronic
1046226890 8:111293756-111293778 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1046675494 8:117103587-117103609 GCCTCACCTTCCCAAGTAGCTGG + Intronic
1046753775 8:117952645-117952667 GCCTCAGCCTCCCAAGTGACTGG - Intronic
1046954328 8:120047480-120047502 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1047047537 8:121071659-121071681 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
1048383068 8:133885154-133885176 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1048602081 8:135929375-135929397 GTGTCATCTTTCCCAGTGAATGG + Intergenic
1049007979 8:139868242-139868264 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1049028928 8:140018436-140018458 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1049077988 8:140415438-140415460 GCCTCAGCTTTCCGAGTAACTGG - Intronic
1049334755 8:142077651-142077673 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1049871546 8:144982524-144982546 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1050433287 9:5583870-5583892 GCGTCAGCCTCCCAAGTAACTGG - Intergenic
1050890982 9:10824102-10824124 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1051793748 9:20839371-20839393 GCTTCACCCTTCCAAGTAGCTGG + Intronic
1052563659 9:30117790-30117812 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1052805676 9:33011026-33011048 GCCTCAGCTTCCCAAGTAACTGG - Intronic
1053486877 9:38465224-38465246 GCCTCAGCTTTCCAAGTAGCGGG - Intergenic
1055439687 9:76325750-76325772 GCTTCAGCTTCCCGAGTGACTGG + Intronic
1056159008 9:83869610-83869632 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1056290634 9:85140303-85140325 GCGTCAGCCTCCCAAGTAACAGG + Intergenic
1056394659 9:86170602-86170624 GCCTCAGCTTTCCAAGTAGCTGG + Intergenic
1056398140 9:86200331-86200353 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1056421508 9:86432041-86432063 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1056700471 9:88901765-88901787 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1057108288 9:92442281-92442303 GCGTCAGCCTCCCAAGTGGCTGG - Intronic
1057155997 9:92839930-92839952 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1057159021 9:92872114-92872136 GCCTCACCTTTCCGAGTAGCTGG - Intronic
1057185712 9:93056617-93056639 GCCTCAGCTTCCCAAGTAACTGG + Intergenic
1057256063 9:93548216-93548238 GCCTCACCCTTCCAAGTAGCTGG + Intronic
1057618965 9:96618934-96618956 GGGTCACCTTTCTAAGTTGCGGG - Intronic
1057727439 9:97578168-97578190 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1058791861 9:108455579-108455601 GCTTCACCCTCCCAAGTGGCTGG + Intergenic
1059206830 9:112475142-112475164 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1059850714 9:118335852-118335874 TCGTCACCTCTCCTGGTGACAGG - Intergenic
1060591915 9:124822530-124822552 ACGTCAGCCTTCCAAGTAACTGG - Intergenic
1060957072 9:127649640-127649662 GCCTCACCCTCCCAAGTGGCTGG + Intronic
1061886142 9:133591928-133591950 TCCTCTCCTTTCCAGGTGACTGG + Intergenic
1061975054 9:134063877-134063899 GGGACACTTTTCCAAGTGGCTGG + Intronic
1062100983 9:134728488-134728510 GCGTCAGCTTTCCAAGGAGCTGG + Intronic
1062152088 9:135025516-135025538 GCCTCAGCCTCCCAAGTGACTGG + Intergenic
1062300786 9:135867393-135867415 GCCTCAGCCTTCCAAGTGGCTGG - Intronic
1062583740 9:137239670-137239692 GCCTCACCTTCCCAAGTAGCTGG - Intergenic
1062639632 9:137511907-137511929 AAGTCACCTGTCCACGTGACAGG - Intronic
1185454447 X:301556-301578 GCCTCAGCTTCCCAAGTAACTGG + Exonic
1186074842 X:5866792-5866814 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1186437845 X:9558400-9558422 GCCTCACCTTCCCAAGTAGCTGG - Intronic
1186484297 X:9922166-9922188 GCCTCAGCTTTCCAAGTAGCTGG + Intronic
1187024771 X:15423499-15423521 GCCTCAGCTTTCCAAGTACCTGG - Intronic
1187029744 X:15473669-15473691 GCCTCAGCTTCCCAAGTAACTGG + Intronic
1187138772 X:16573415-16573437 GCCTCAGCTTTCCAAGTAGCTGG - Intergenic
1187423060 X:19153358-19153380 GCCTCAGCTTCCCAAGTGGCTGG + Intergenic
1187762392 X:22602286-22602308 TCCTCACCTTCCCAAGTAACTGG + Intergenic
1188405788 X:29807498-29807520 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1189358614 X:40330567-40330589 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
1189686095 X:43564970-43564992 AAGTCACCTTTCCAAGCTACAGG + Intergenic
1190254159 X:48750078-48750100 GCCTCAGCTTCCCAAGTGGCTGG - Intergenic
1190271040 X:48863807-48863829 GCCTCACCCTTCCAAGTAGCTGG - Intergenic
1190523235 X:51300783-51300805 GCCTCACCCTCCCAAGTGGCTGG - Intergenic
1190717072 X:53114011-53114033 GCCTCAGCCTTCCAAGTAACTGG + Intergenic
1192107454 X:68329030-68329052 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1192523924 X:71825182-71825204 GCATCAGCTTTCCAAGTAGCTGG + Intergenic
1193104057 X:77649047-77649069 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1193378118 X:80785913-80785935 GCGTCAACCTCCCAAGTAACTGG - Intronic
1193823246 X:86191824-86191846 GCCTCAGCTTCCCAAGTGGCTGG - Intronic
1196125801 X:112097519-112097541 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1196799542 X:119530352-119530374 GCCTCACCCTCCCAAGTAACTGG - Intergenic
1196870989 X:120113566-120113588 GCCTCAGCCTTCCAAGTGGCTGG + Intronic
1197051514 X:122064330-122064352 GCCTCAGCCTTCCAAGTAACTGG - Intergenic
1197404735 X:126036478-126036500 ACGTCACCATTCCAAGTTGCAGG - Intergenic
1197698209 X:129573667-129573689 GCCTCAGCCTCCCAAGTGACTGG + Intronic
1198072183 X:133159733-133159755 GCCTCAGCTTCCCAAGTAACTGG - Intergenic
1198194557 X:134346744-134346766 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1198461861 X:136870997-136871019 GCCTCAGCTTTCCAAGTAGCTGG - Intronic
1199457065 X:148041535-148041557 GCCTCACCCTCCCAAGTGGCTGG + Intergenic
1200055653 X:153458871-153458893 GCCTCAGCTTCCCAAGTGGCTGG + Intronic
1200526598 Y:4280835-4280857 ACATCACCTTTCCAAGTTGCGGG + Intergenic
1201391284 Y:13500068-13500090 GCCTCAGCCTCCCAAGTGACTGG - Intergenic
1201516778 Y:14826453-14826475 GCGTCAGCTTCCCAAGTAGCTGG + Intronic
1201586159 Y:15563538-15563560 GCGTCAGCTTCCCAAGTAGCTGG - Intergenic
1201949397 Y:19547420-19547442 GCTTCAGCCTTCCAAGTGGCTGG + Intergenic