ID: 917862995

View in Genome Browser
Species Human (GRCh38)
Location 1:179165954-179165976
Sequence GTGAATACAAAAAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102431
Summary {0: 1, 1: 17, 2: 980, 3: 24546, 4: 76887}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917862995_917862999 -10 Left 917862995 1:179165954-179165976 CCCAGCTAATTTTTTGTATTCAC 0: 1
1: 17
2: 980
3: 24546
4: 76887
Right 917862999 1:179165967-179165989 TTGTATTCACAGTAGAGACGGGG 0: 1
1: 24
2: 4202
3: 110495
4: 223310
917862995_917863000 4 Left 917862995 1:179165954-179165976 CCCAGCTAATTTTTTGTATTCAC 0: 1
1: 17
2: 980
3: 24546
4: 76887
Right 917863000 1:179165981-179166003 GAGACGGGGTTTTACCATGTTGG 0: 1762
1: 44253
2: 143111
3: 151661
4: 87100
917862995_917863001 13 Left 917862995 1:179165954-179165976 CCCAGCTAATTTTTTGTATTCAC 0: 1
1: 17
2: 980
3: 24546
4: 76887
Right 917863001 1:179165990-179166012 TTTTACCATGTTGGCCAGATTGG 0: 7
1: 672
2: 16242
3: 148219
4: 205199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917862995 Original CRISPR GTGAATACAAAAAATTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr