ID: 917863766

View in Genome Browser
Species Human (GRCh38)
Location 1:179173943-179173965
Sequence CAGGGTTTTCTTGAGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917863766_917863770 14 Left 917863766 1:179173943-179173965 CCTACCTTCTCAAGAAAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 187
Right 917863770 1:179173980-179174002 TACTTGCAAGAAAAAGAAAATGG 0: 1
1: 0
2: 7
3: 140
4: 1147
917863766_917863773 26 Left 917863766 1:179173943-179173965 CCTACCTTCTCAAGAAAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 187
Right 917863773 1:179173992-179174014 AAAGAAAATGGTTTCTGGCCGGG 0: 1
1: 2
2: 18
3: 149
4: 1040
917863766_917863772 25 Left 917863766 1:179173943-179173965 CCTACCTTCTCAAGAAAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 187
Right 917863772 1:179173991-179174013 AAAAGAAAATGGTTTCTGGCCGG 0: 1
1: 1
2: 14
3: 102
4: 781
917863766_917863771 21 Left 917863766 1:179173943-179173965 CCTACCTTCTCAAGAAAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 187
Right 917863771 1:179173987-179174009 AAGAAAAAGAAAATGGTTTCTGG 0: 1
1: 2
2: 22
3: 247
4: 2030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917863766 Original CRISPR CAGGGTTTTCTTGAGAAGGT AGG (reversed) Intronic
901744547 1:11363795-11363817 CAGGGACTTCCTGAGAAGGGCGG + Intergenic
904123183 1:28216778-28216800 CAGGCTTTTTTTGTGAAGGTGGG + Intronic
905758460 1:40532685-40532707 TTGGGCTTTCTTGAGAAGGCTGG - Intronic
906517004 1:46445540-46445562 CATGGTATTCATGAGAAGGAAGG - Intergenic
906638230 1:47424721-47424743 GAGGGTTTTCTAGAGGAGGTGGG - Intergenic
907338050 1:53713463-53713485 CAGGGTGGTCTTGAAAAGATGGG - Intronic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908493773 1:64673382-64673404 CAGGTTTTTCTTTACAAAGTTGG - Exonic
909490028 1:76215889-76215911 CAGTGCTTTCTAGAGATGGTGGG + Intronic
910587276 1:88893403-88893425 CACTGTTTTCTTGAGAAGGTGGG + Intergenic
912146272 1:106798000-106798022 CAGGGTTTTCTTGAGCATCAAGG - Intergenic
913281485 1:117189392-117189414 CAAGATTTTCATGAGAAGTTGGG + Intronic
915883123 1:159694326-159694348 CGTGGTTTTCTTGAAAAGGAAGG - Intergenic
915997973 1:160583841-160583863 CAGGATTTTCTTGACTATGTGGG + Intergenic
917147159 1:171904581-171904603 GAGGGTTTTCTTTAGAAGACTGG + Intronic
917863766 1:179173943-179173965 CAGGGTTTTCTTGAGAAGGTAGG - Intronic
921510002 1:216016496-216016518 CAGGGTTTTCATGAAAGGGAGGG - Intronic
1065101817 10:22338812-22338834 AGGAGTTTTGTTGAGAAGGTTGG - Intergenic
1065282972 10:24159098-24159120 CATAGTCTTCATGAGAAGGTGGG + Intronic
1065884506 10:30064975-30064997 CAAGGTTTTATCGAGAATGTGGG - Intronic
1070252176 10:74782572-74782594 CAAGGTTTTCTTGCAAAGGGAGG + Intergenic
1070780215 10:79133218-79133240 CAGGAGTTTTCTGAGAAGGTGGG - Intronic
1070852270 10:79575006-79575028 TAGGATTTTCTTGGGAACGTGGG - Intergenic
1071953060 10:90727298-90727320 TAGGGTTGTCTTGAGTTGGTTGG - Intergenic
1073810063 10:107143075-107143097 TAGTGTTATCTTGAGAAAGTAGG + Intronic
1074714688 10:116207384-116207406 CAGGATTTTCTAGAGAAGCCAGG - Intronic
1075083483 10:119399004-119399026 CAGGGGCTTCTGGACAAGGTTGG - Intronic
1075171162 10:120116148-120116170 CAGTATTTTCTTGAGAGTGTGGG - Intergenic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1080452909 11:32393482-32393504 CAGGATTCTCCTAAGAAGGTGGG - Intronic
1080568112 11:33531014-33531036 CATGGTTTTCTTGATGCGGTGGG + Intergenic
1080887497 11:36380067-36380089 TAGGATTTTCTTGAGAACTTGGG - Intronic
1082697463 11:56387104-56387126 CAGGGATTTCTTCAGAATATTGG - Intergenic
1083680648 11:64350206-64350228 GAAGGTTTTGTGGAGAAGGTGGG + Intronic
1085006913 11:73100242-73100264 AAGGGTTTTCTTGAGAAGGGAGG - Intronic
1085649654 11:78256318-78256340 TAGAGTTTTGTTAAGAAGGTGGG + Intronic
1086328597 11:85730332-85730354 CAGTATTTTATTGAGAATGTTGG - Intronic
1086723046 11:90145342-90145364 CAGGGGGTTCTTGAAAAGATGGG + Intronic
1087659440 11:100969730-100969752 CATGGTTTTCTTGAGGACTTTGG + Intronic
1088890980 11:114043983-114044005 CAGCATGTTCTTGAGAATGTGGG - Intergenic
1093761359 12:22915033-22915055 CAGGCTTTTCTGGAGAAGCTGGG + Intergenic
1094039443 12:26107494-26107516 CAGGGTTGATTTGAGAATGTTGG + Intergenic
1094483063 12:30900339-30900361 GAGAGTTTTCTGGGGAAGGTGGG - Intergenic
1094784419 12:33829903-33829925 CCTGGTTTTCTTGAGGATGTGGG - Intergenic
1094814820 12:34172450-34172472 CAGGTTGTTCTTGTGAAGCTCGG + Intergenic
1096487455 12:51993384-51993406 CAGGGTTTGCTTCAGAGGGCAGG + Intronic
1097102338 12:56598558-56598580 CAGGTTTTTGTTTGGAAGGTGGG + Exonic
1098443286 12:70540274-70540296 CAAAGTTTTATTGAGAATGTGGG - Intronic
1099744847 12:86689320-86689342 CAGAGTAGTCTTCAGAAGGTGGG - Intronic
1100373820 12:93993942-93993964 CTGGGTTTGCTTCAGAAGGTGGG + Intergenic
1100800202 12:98222841-98222863 CAGTGTTTTCTGGAGAAGAGTGG - Intergenic
1101182406 12:102233542-102233564 CTGGGTTTTCTGGAGAGGGAGGG + Intergenic
1102377125 12:112431525-112431547 AGGGTTTTTTTTGAGAAGGTAGG + Intronic
1102552358 12:113700929-113700951 GAGGGCTTTCTGGAGAAGGTGGG - Intergenic
1102735431 12:115154907-115154929 CAGGGCTTACTTGAGAATGGAGG - Intergenic
1104082674 12:125444646-125444668 CAGTGAATTCTTGAGATGGTCGG + Intronic
1104131919 12:125902341-125902363 CTGGGTTTCCTTGAGAATGGTGG - Intergenic
1104552549 12:129770441-129770463 CAGGATTCTTTTGAGAAAGTGGG + Intronic
1104592331 12:130094567-130094589 CAGGGTTTTATTGAGAAGTGGGG - Intergenic
1105359975 13:19702281-19702303 TAGGCATTTCTTGAGAATGTAGG - Intronic
1107000480 13:35538628-35538650 CTGGGTTTTGATTAGAAGGTAGG + Intronic
1109240167 13:59876880-59876902 CAGGCTTTCCCTGAGAAGGAAGG - Intronic
1110043680 13:70799985-70800007 AGGTGTTCTCTTGAGAAGGTTGG - Intergenic
1110707993 13:78617041-78617063 CAGGGCTTTCTTGAGGCGATTGG + Exonic
1113765034 13:112875880-112875902 CAGGACTTTCTTGAGGACGTCGG - Exonic
1115146434 14:30231753-30231775 CAGGTTTGTCTTGAGAAACTGGG - Intergenic
1117274096 14:54174789-54174811 CAGGGTTCTTTTGTGAGGGTTGG - Intergenic
1120846943 14:89134432-89134454 TAGGGTTTTCTTGTGGAGGCTGG + Intronic
1121663162 14:95650949-95650971 CGGGGTTGTGTTGAGAAGGTTGG + Intergenic
1123033223 14:105460889-105460911 CAGGGCTTCCTCGAAAAGGTTGG - Exonic
1123992642 15:25694946-25694968 CAGGTTTTTCTCGAGAGCGTAGG + Exonic
1124655928 15:31507288-31507310 CAGGGTTATATTGAGAAGGTTGG + Intronic
1125452670 15:39825257-39825279 CATGCTTTTCTTAAGATGGTGGG - Intronic
1126280845 15:46947747-46947769 CAAGGTCTTCTTGAGAATGGAGG - Intergenic
1126639494 15:50810987-50811009 TGGGGTCTTCTTGAGAAGGGTGG + Intergenic
1126862410 15:52898822-52898844 CAAAGATTTCTTGAGAATGTGGG - Intergenic
1127633710 15:60849779-60849801 GATGGTTTTGTTGAGGAGGTGGG + Intronic
1129178697 15:73858004-73858026 GAGGGTTCCCTTGAGAAGGCAGG + Intergenic
1133548730 16:6833485-6833507 GAGGGTCTCCCTGAGAAGGTGGG - Intronic
1134163623 16:11913216-11913238 CAGGGTTATATTGAGACTGTTGG - Intronic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1136506048 16:30703968-30703990 CAGTTTTTTCTTGTGAAGATCGG + Intronic
1137327358 16:47455258-47455280 CAAAGTTTTCTTCAGAAGGCAGG - Intronic
1137613367 16:49833778-49833800 CAGGGATTTCGTGGGAAGGGAGG + Intronic
1137925036 16:52532475-52532497 GAGGGTTTGCTTCAGGAGGTTGG - Intronic
1144186847 17:12804475-12804497 CAGAGTTTTCATGGGAAGGAAGG + Intronic
1145084514 17:19925460-19925482 CTGGTTTTTCTTGTGGAGGTGGG - Intronic
1145129997 17:20336286-20336308 CAGGATTTTCTTTAGGAAGTAGG + Intergenic
1157598073 18:48875892-48875914 AAGGGGTTTCTGGAGAAGGCCGG - Intergenic
1157742625 18:50106888-50106910 CAGGGTTTTCTTTATGAGGTGGG - Intronic
1160264264 18:77325651-77325673 CAGTGCTTTCATGAGAAGGCTGG - Intergenic
1161873791 19:6891769-6891791 AAGGGCTTTATTGAGATGGTTGG + Intronic
1162039220 19:7959756-7959778 CAGGGCTGTCTTGCGAAGTTTGG + Exonic
1167666007 19:50823141-50823163 CAGGGTTTTCTGGTGAAATTTGG + Intronic
925066605 2:932595-932617 GAGGGCTTTCTTCAGAAGGAGGG - Intergenic
928479393 2:31666697-31666719 GAGGGTTTTTTAGAAAAGGTGGG - Intergenic
928644442 2:33337056-33337078 CAGGGTTTTCTAAAAGAGGTTGG - Intronic
928913239 2:36444072-36444094 CAGGGTCTTCCTGAAAAGGAAGG + Intronic
930138896 2:47931751-47931773 AAGGGTTTTCTGGAGAATATGGG + Intergenic
930961908 2:57272317-57272339 TAGGATTTTCTTGACAATGTGGG + Intergenic
932374673 2:71225613-71225635 GAGGGTTTTATTTTGAAGGTTGG - Intronic
935126872 2:100232003-100232025 CAACGTTTTCTTTAGATGGTGGG + Intergenic
937354932 2:121192369-121192391 GAGGGCTTCCTGGAGAAGGTGGG - Intergenic
940326770 2:152433823-152433845 GAGCCTTTTCTTTAGAAGGTTGG - Intronic
941587290 2:167376470-167376492 CAGGGCTTTCTTGGGTTGGTAGG + Intergenic
944136317 2:196403924-196403946 CTGGGTTCTATAGAGAAGGTTGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945123974 2:206488377-206488399 GAAGGTTTTCTGGGGAAGGTGGG + Intronic
945840826 2:214886123-214886145 CAGGGTCTTTTTGAGCAAGTTGG + Intergenic
947492939 2:230611394-230611416 CAGGGCTCTCCTGCGAAGGTTGG + Intergenic
948735437 2:240001150-240001172 CACGGTTGTCTTTAGGAGGTGGG + Intronic
948744744 2:240080398-240080420 CAGCGTTTTGTTGTGAATGTGGG + Intergenic
1168733347 20:107001-107023 CAGGGTTTTTTTGGGCTGGTAGG - Intergenic
1170507030 20:17037636-17037658 CAGTGTTATCTTTAGAAGGGTGG - Intergenic
1171196237 20:23201677-23201699 CAGGGTTTTCTTGAGTAGTTTGG + Intergenic
1171209368 20:23304889-23304911 CAGGATGCTCTTGAGAATGTGGG - Intergenic
1172346613 20:34206358-34206380 AATGGTGTTTTTGAGAAGGTGGG - Intronic
1172557153 20:35852231-35852253 CAGGGTTTTCCTAAGAGGGCAGG + Intronic
1173408803 20:42791396-42791418 CAGGGTTGGCAGGAGAAGGTGGG + Exonic
1175051821 20:56162542-56162564 TCGTGTTTTCCTGAGAAGGTGGG - Intergenic
1175902165 20:62364259-62364281 CAGGGGCTCCTGGAGAAGGTAGG + Intronic
1179932197 21:44578487-44578509 CACGGTTTTCTGGAAAAGTTTGG - Intronic
1180740149 22:18047851-18047873 CAGGGTTTTCTTGCTACTGTTGG + Intergenic
1183135713 22:35885288-35885310 CATGGTTTTTTTGGCAAGGTGGG - Intronic
1183499231 22:38168500-38168522 CAGGGTTTGCTTAGGAAGGCTGG - Intronic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
949870202 3:8581864-8581886 CAGGGTTTTGTTGAGAATGGAGG - Intergenic
951090724 3:18570939-18570961 CACATTTTTTTTGAGAAGGTTGG + Intergenic
953420699 3:42751219-42751241 AAGGGTTTTCTTGGGAAGCCAGG - Intronic
957556667 3:81770837-81770859 CAGGGTTCTCTTGAGAAGCTGGG - Intergenic
958126645 3:89365151-89365173 AAAGGTTTTCTTGAAGAGGTGGG + Intronic
959549658 3:107640302-107640324 CAGGGTTCACGTGAGAAAGTAGG - Intronic
962685443 3:137843176-137843198 CAGGGTTTTTTTTATTAGGTTGG - Intergenic
964507013 3:157410540-157410562 CAAGGTTTTATTTAGAAAGTTGG + Intronic
965345488 3:167543890-167543912 TAGGGTTTTCTAGAGAAGTCAGG - Intronic
966368756 3:179222700-179222722 CAGTATTTTCTTGAGATGCTGGG - Intronic
966588293 3:181651661-181651683 AAGGGTTTTCTTGGGAGGGTGGG + Intergenic
966981653 3:185141748-185141770 CAGGGTTTTACTGACAAGGGAGG + Intronic
967777566 3:193400140-193400162 AAGGGTTTTCCTGAGAAAGAAGG - Intergenic
968872128 4:3247475-3247497 CAGGGCTTCCTAGAGGAGGTAGG + Exonic
970993438 4:22238569-22238591 CAGTCTTTTCTTTAGAGGGTGGG - Intergenic
972220961 4:36953734-36953756 CAGGATTTTGTTGAGAATTTTGG + Intergenic
973823735 4:54685039-54685061 CAGGGCCTTCTATAGAAGGTTGG - Intronic
973965390 4:56156645-56156667 CAGGTTTTTCCTGAGCAGTTAGG + Intergenic
974123294 4:57665569-57665591 CAGGGTTTTGATGGGTAGGTAGG - Intergenic
976179893 4:82389143-82389165 CAGGGTTTTCAGTAGAAGATTGG - Intergenic
976426781 4:84913223-84913245 CAGGGTTCTCTTCAATAGGTTGG - Intronic
976837981 4:89397762-89397784 TTGGGTTTTCTTTTGAAGGTGGG + Intergenic
977459696 4:97309852-97309874 CAGGGTTTACTTTTGAAGCTGGG - Intronic
978656656 4:111073641-111073663 CAGGGCTTACTTGAGAATGGTGG + Intergenic
979571011 4:122224730-122224752 CAAGTTATTCTTGAGAAGGTGGG - Intronic
979853785 4:125606882-125606904 AAGGGTTTTCATGGGAAAGTAGG + Intergenic
980713916 4:136608105-136608127 CATGGTTTTCTTTATAAGTTTGG + Intergenic
981254591 4:142646827-142646849 AAGGGTGCTCTTGAGAAGTTTGG + Intronic
984177939 4:176442317-176442339 CAGTGCTTTCTTGAGAAGGAAGG + Intergenic
985539179 5:479913-479935 CAGGGTCCTCATGAGACGGTCGG - Exonic
986206610 5:5630570-5630592 CTGTGCTTTCTTGAGAAGGAAGG + Intergenic
986452724 5:7882189-7882211 CAGGGTTCTCTGGAGCTGGTGGG + Intronic
986465378 5:8015985-8016007 CAGGGTTAACTGGAGAAAGTGGG + Intergenic
992728300 5:79631678-79631700 CAGGCTTTTTTTGGTAAGGTGGG + Intronic
993354567 5:86890073-86890095 TAGGGTTTTATGGATAAGGTGGG + Intergenic
994248122 5:97504294-97504316 AAGGCTTTTCTTGAGCAGCTAGG - Intergenic
994694563 5:103057930-103057952 CATGGTGTTCTTGTGATGGTGGG - Intergenic
999707393 5:154286013-154286035 CAAGGTTTTCTTGAGAAAATTGG - Intronic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1004275322 6:14230780-14230802 GAGAGTTTTCTTGGGAAAGTGGG + Intergenic
1006056454 6:31388513-31388535 TTGGGTTTTCTTAAGAAGGGAGG - Intergenic
1006069176 6:31485469-31485491 TTGGGTTTTCTTAGGAAGGTAGG - Intergenic
1006358828 6:33576210-33576232 CAGCCTCTTCTTGAGTAGGTGGG - Intronic
1007423080 6:41731307-41731329 CAGGGGGTTGTTGAGAACGTGGG - Intronic
1010368400 6:75079378-75079400 TATGGTTTTCTTTAGAATGTGGG - Intergenic
1014320161 6:119917983-119918005 CTGTGTTTTCAGGAGAAGGTTGG + Intergenic
1015380498 6:132562029-132562051 TAAGGTTTTCTGTAGAAGGTAGG + Intergenic
1016832233 6:148445446-148445468 AAGGCTTTTCTTGAGAGGGCTGG + Intronic
1017530681 6:155289228-155289250 CAGGGTCCTCTGGAGATGGTGGG + Intronic
1018916590 6:168136046-168136068 CAGGGATTTCAAGGGAAGGTTGG - Intergenic
1021803686 7:24333816-24333838 CAAGGTGTAATTGAGAAGGTAGG + Intergenic
1022221023 7:28313640-28313662 CAGGGATTTCTGTGGAAGGTGGG + Intronic
1023185340 7:37527268-37527290 CAGTGTATGCTGGAGAAGGTGGG + Intergenic
1024773126 7:52749049-52749071 CAGTCTTTTCTGTAGAAGGTTGG + Intergenic
1028260915 7:88663625-88663647 CAGCTTTTTCTTGTTAAGGTTGG + Intergenic
1029046371 7:97633471-97633493 CAGGGTTTTCCTGAAACTGTCGG - Intergenic
1035589168 8:800067-800089 CATGGCTTTCTTCAGAATGTGGG - Intergenic
1036505538 8:9351842-9351864 CAGGGTATTCTTCAGAATGAAGG - Intergenic
1037000713 8:13715236-13715258 TATGGTTTGCTGGAGAAGGTGGG + Intergenic
1038839691 8:31171912-31171934 GAGGGATTTTATGAGAAGGTTGG - Intronic
1039166094 8:34681651-34681673 CAGGGTTTTCTGTAGAATGTGGG + Intergenic
1041501447 8:58543005-58543027 CAGGCTTCTCTTGTCAAGGTTGG + Intergenic
1045064193 8:98431081-98431103 CAGGGTTTTCATCCAAAGGTTGG + Exonic
1046059864 8:109125587-109125609 GAGGGCTTTGTAGAGAAGGTAGG + Intergenic
1046749221 8:117909581-117909603 CAAGGGTTCCTTGAGAAGGAGGG + Intronic
1053729223 9:41035556-41035578 CAGAGATTTATTGAGAAGGAGGG + Intergenic
1054699290 9:68396510-68396532 CAGAGATTTATTGAGAAGGAGGG - Intronic
1054712852 9:68528987-68529009 GTGGGTTTTCTGGAGGAGGTGGG - Intronic
1055005799 9:71504571-71504593 GAGGGCATTCTGGAGAAGGTAGG + Intergenic
1055054737 9:72013371-72013393 CAGTGGGTTCTTGAGAAAGTGGG + Intergenic
1056700224 9:88898135-88898157 CAGGGTGTTAATGAGAAGCTAGG + Intergenic
1057804761 9:98212148-98212170 GAGGGTGGGCTTGAGAAGGTGGG - Intronic
1059993907 9:119891196-119891218 CAGGATTTCCCTGAGTAGGTGGG + Intergenic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1188191548 X:27176889-27176911 CACAGTTTTCTTGAGAAGTCTGG + Intergenic
1191025387 X:55908292-55908314 CGGGGTATTGTTGAAAAGGTCGG + Intergenic
1192524685 X:71831112-71831134 CAGGGTAGACTTCAGAAGGTGGG + Intergenic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1195000133 X:100636023-100636045 CAAGGTTTTCTTCCTAAGGTTGG - Intronic
1196712212 X:118774455-118774477 CATGGTTTTCATTAGAAAGTGGG - Intronic
1197752188 X:129972574-129972596 TAGGGTTTTATTGAATAGGTTGG - Intergenic