ID: 917867302

View in Genome Browser
Species Human (GRCh38)
Location 1:179209338-179209360
Sequence GACAGCGTGTAGAAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917867302 Original CRISPR GACAGCGTGTAGAAGTCTGA TGG (reversed) Intronic
900393934 1:2445438-2445460 GACAGTGTGTAGAAGACTCGGGG + Intronic
901815150 1:11789537-11789559 GACAGCTTGAAGAGCTCTGAAGG + Exonic
908656852 1:66397261-66397283 GACAGCATGCAAAAGTCTAAAGG + Intergenic
908824638 1:68121590-68121612 GACAGCCTGCAGAAGTCAGATGG + Intronic
911105635 1:94129304-94129326 GACAGTGTGTAGAAATCTTAGGG + Intergenic
916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG + Intergenic
917867302 1:179209338-179209360 GACAGCGTGTAGAAGTCTGATGG - Intronic
922233017 1:223702527-223702549 GACAGCTAGTGGAAGTTTGATGG - Intronic
924822421 1:247506135-247506157 TGCAGAGAGTAGAAGTCTGAGGG + Intergenic
1064780757 10:18835762-18835784 CACAGTGTCTGGAAGTCTGATGG - Intergenic
1065025926 10:21539178-21539200 GAAAGCTTGAAGAAGTTTGAAGG + Intronic
1068019665 10:51565526-51565548 GCCTGGGTGTAGAAGCCTGAAGG + Intronic
1071464477 10:85926735-85926757 GACAGTGTGCAGAAGCCTGGAGG + Intronic
1071963390 10:90828890-90828912 GATAGGATGTAGAAGTCTCAGGG + Intronic
1076706763 10:132306648-132306670 GATAGCGTGCAGAGGTATGATGG - Intronic
1080773409 11:35363497-35363519 GACAGCCTGGAGAGATCTGAAGG - Intronic
1091168526 11:133501197-133501219 GACAGCGTATAGAAGCTGGACGG - Intronic
1094812150 12:34148910-34148932 TGCAGAGAGTAGAAGTCTGAGGG - Intergenic
1104576526 12:129971741-129971763 GACAGCATGCAGAAATCGGAGGG + Intergenic
1110585406 13:77185208-77185230 GACAGCTTCTAGAAGACTCAAGG + Exonic
1112309221 13:98302943-98302965 GGCAGCCTGTAGAAGTGTGGAGG + Intronic
1116955077 14:50915034-50915056 GTCAGTGTGAAGAAGTCAGATGG - Intronic
1127376812 15:58392669-58392691 GACAGTGTGTAGAAATACGATGG + Intronic
1128743501 15:70098654-70098676 GCCTGCGAGGAGAAGTCTGAGGG + Intergenic
1139583013 16:67884300-67884322 TACAGCGTGTGGTAGTCAGAAGG + Exonic
1140501280 16:75435545-75435567 GACTGCGTGGAGAATTTTGAAGG + Intronic
1141234240 16:82200636-82200658 GACAGGGAGTAGGAGTATGATGG - Intergenic
1145126051 17:20300829-20300851 GGCAGCGTGTGGAAGACTGTGGG + Intronic
1145834592 17:27944680-27944702 GACAGGGTGTAGAGATCAGAGGG + Intergenic
1148516397 17:48222325-48222347 GAAAGAGTGTAGGAGTATGAAGG - Intronic
1156834377 18:41534943-41534965 CACAGCGTGTAGGAGGATGAAGG + Intergenic
1159895621 18:73993023-73993045 GCCAGCATGTAGATGCCTGACGG + Intergenic
1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166827698 19:45619566-45619588 GACAGAGCCCAGAAGTCTGAGGG + Intronic
929992279 2:46800601-46800623 GACAGCGTGCTGAAGGCTGAAGG + Intergenic
933687831 2:85157559-85157581 GACAGCTTGTGTAAGCCTGAGGG + Intronic
939600655 2:144185786-144185808 GATAGCTTGTAAAAGTCTGTAGG + Intronic
943204085 2:184868706-184868728 GACAGCTTTTAGGAATCTGAAGG - Intronic
945052836 2:205841772-205841794 GACAGCGTGTAGAAATTGCATGG + Intergenic
945505219 2:210631533-210631555 CAGAGTGTGTAAAAGTCTGATGG + Intronic
947682640 2:232049509-232049531 GACAGAAGGTAGAAGTCGGAAGG - Intronic
948670493 2:239565428-239565450 GAAGGCATGTAGAAGTCTGAAGG + Intergenic
1174842257 20:53911514-53911536 GTCAGCGGGTACAAGTCTGGGGG + Intergenic
1178235329 21:30835047-30835069 GAGAGAGTGAAGAAGTGTGATGG - Intergenic
1180166069 21:46030100-46030122 GACAGCGGGCAGAAATCTGATGG + Intergenic
1180758040 22:18176833-18176855 GACAGCGTGTCAATCTCTGAAGG - Exonic
1180768328 22:18360625-18360647 GACAGCGTGTCAATCTCTGAAGG - Intergenic
1180777981 22:18501766-18501788 GACAGCGTGTCAATCTCTGAAGG + Intergenic
1180810705 22:18759077-18759099 GACAGCGTGTCAATCTCTGAAGG + Intergenic
1180826205 22:18863849-18863871 GACAGCGTGTCAATCTCTGAAGG - Intergenic
1181196853 22:21193332-21193354 GACAGCGTGTCAATCTCTGAAGG + Intergenic
1181212675 22:21299792-21299814 GACAGCGTGTCAATCTCTGAAGG - Intergenic
1185260484 22:49859084-49859106 AACAGCATGTGGAGGTCTGATGG - Intronic
1203229947 22_KI270731v1_random:101513-101535 GACAGCGTGTCAATCTCTGAAGG - Intergenic
1203276347 22_KI270734v1_random:89755-89777 GACAGCGTGTCAATCTCTGAAGG - Intergenic
960006785 3:112789212-112789234 GAGAGTGTGTAGAGGTCTGAAGG - Intronic
963599395 3:147364749-147364771 GACTGGGAGTAGGAGTCTGAAGG + Intergenic
985727101 5:1522362-1522384 GACAGCGTGTGGCAGACAGAGGG + Intronic
989619313 5:43368861-43368883 TTCAGAGTCTAGAAGTCTGAAGG - Intergenic
994671224 5:102764001-102764023 GACAGTGTGTACCAGTCTGGTGG + Intronic
997880895 5:137588703-137588725 GACAGCTTTTAGCAATCTGAAGG - Intronic
998780366 5:145649768-145649790 GACAGGATGTAGAAGTTTGATGG - Intronic
1003019105 6:2494802-2494824 GACATAGTGAAGAAGTCAGATGG + Intergenic
1003211927 6:4076448-4076470 GACATCGTAAAAAAGTCTGAAGG - Intronic
1007926468 6:45653449-45653471 GACAGCCTGCAGATATCTGAGGG + Intronic
1015151041 6:130038068-130038090 GACAGCATGGATAAGCCTGAAGG - Intronic
1021645148 7:22782390-22782412 GGCAGAGTGTAGAAGGCAGATGG - Intergenic
1022126003 7:27358112-27358134 GACAGCCTGTTGTGGTCTGAAGG - Intergenic
1022422852 7:30240393-30240415 GAGAGATTGTAGAAGCCTGAGGG - Intergenic
1026369795 7:69688043-69688065 GATAGCCTGTAACAGTCTGATGG + Intronic
1034949762 7:155289276-155289298 GACAGAGTGGAGAAGTCAGCTGG - Intergenic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1050639768 9:7654797-7654819 GACAGCCTGGATAAGTCAGAAGG - Intergenic
1057630228 9:96713992-96714014 AACAGTGTCCAGAAGTCTGAGGG - Intergenic
1057847746 9:98538603-98538625 GGAAGCGGGTAGAAGGCTGAGGG - Intronic
1058501985 9:105629490-105629512 GAAATCCTGTAAAAGTCTGAAGG + Intronic
1062493332 9:136819689-136819711 GAGAGCGGGTAGAAATGTGAAGG + Intronic
1189511364 X:41665373-41665395 GAAAGCCTGTAGACGTCTGGGGG - Exonic
1190160742 X:48029802-48029824 GGCAACGTGTAGAACTCAGAAGG + Intronic
1191693270 X:63962529-63962551 AGCAGGGTGTTGAAGTCTGAGGG + Intergenic
1195472888 X:105252994-105253016 GGCAGGGTGTAGAAGACAGAAGG - Intronic