ID: 917869484

View in Genome Browser
Species Human (GRCh38)
Location 1:179229227-179229249
Sequence CCCAGCATGGTGAGTGTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917869484_917869488 4 Left 917869484 1:179229227-179229249 CCAGACACACTCACCATGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 917869488 1:179229254-179229276 GATATTGAAGCCGGTCTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 79
917869484_917869491 18 Left 917869484 1:179229227-179229249 CCAGACACACTCACCATGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 917869491 1:179229268-179229290 TCTCTGTGGTGCGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 85
917869484_917869487 -5 Left 917869484 1:179229227-179229249 CCAGACACACTCACCATGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 917869487 1:179229245-179229267 CTGGGTGAAGATATTGAAGCCGG 0: 1
1: 0
2: 1
3: 11
4: 149
917869484_917869492 30 Left 917869484 1:179229227-179229249 CCAGACACACTCACCATGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 917869492 1:179229280-179229302 GCCCCGCCGGGTCCCGCCTGCGG 0: 1
1: 0
2: 1
3: 20
4: 180
917869484_917869490 17 Left 917869484 1:179229227-179229249 CCAGACACACTCACCATGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 917869490 1:179229267-179229289 GTCTCTGTGGTGCGCCCCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917869484 Original CRISPR CCCAGCATGGTGAGTGTGTC TGG (reversed) Exonic
900614012 1:3556218-3556240 CCCAGGATGGGGAGTGGGGCAGG + Intronic
902251284 1:15155292-15155314 CCCAGCCTAGTGAGGGAGTCAGG + Intronic
902616411 1:17625870-17625892 CCCAGAATGGGGACAGTGTCTGG + Intronic
902628546 1:17690786-17690808 CCCAGCATGGTGGCTGGGGCTGG - Intronic
903275408 1:22218300-22218322 CGTAGCATGGTCAGTGTGACCGG + Intergenic
905277766 1:36829995-36830017 CCCAGCTTGCTGCCTGTGTCTGG + Intronic
906071791 1:43022060-43022082 CTCAGAGTGGTGAGTGTGACCGG + Intergenic
912503401 1:110137427-110137449 CCCAGGATGCTGGGTGTGTTGGG + Intergenic
913222243 1:116668442-116668464 CCCAGCAAGTTGTGTGTGTTGGG - Intergenic
917869484 1:179229227-179229249 CCCAGCATGGTGAGTGTGTCTGG - Exonic
923263537 1:232290058-232290080 CCCAGAGTGGTCAGTGTGGCCGG - Intergenic
923549067 1:234947137-234947159 CCCACCAAGGTGAGTGTCCCAGG + Intergenic
1063665045 10:8055888-8055910 CCCACCACGGTGAGTGCGCCCGG + Exonic
1064467335 10:15597347-15597369 CCCAGCATGGCTTTTGTGTCAGG - Intronic
1064622035 10:17227096-17227118 GCCACCATTGTGAGTGTGCCTGG - Intergenic
1064732283 10:18344833-18344855 CACAGCATGGTGAGCTTGTGGGG - Intronic
1067529855 10:47062201-47062223 CCCAGCCTGATGTGTGTCTCAGG + Intergenic
1068709266 10:60115423-60115445 CCAAGCATGGTCAGAGTGTGTGG + Intronic
1069719470 10:70540491-70540513 CCCTGTGTGGTGCGTGTGTCTGG + Intronic
1069867532 10:71512968-71512990 CCCAGCTTGCTGAATGTGTTTGG + Intronic
1074347843 10:112705519-112705541 CCCAGAAATGTGTGTGTGTCGGG - Intronic
1074767981 10:116714557-116714579 AACTGCAGGGTGAGTGTGTCTGG - Intronic
1075797992 10:125134811-125134833 CCCAGCCTGGAGAGGGAGTCAGG + Intronic
1075871081 10:125773263-125773285 CCCAGAATGGAGAGTGGGTGAGG - Intronic
1076208948 10:128625465-128625487 TCCAGTGTGGTGAGGGTGTCGGG + Intergenic
1077038978 11:509476-509498 GCCAGCATGGTGTCTGTGGCCGG + Intergenic
1078441524 11:11372454-11372476 CCCACCAGGGTGAATGAGTCTGG - Intronic
1079251463 11:18790994-18791016 CCCAGCATGCTGCTTGTTTCTGG - Intronic
1083259919 11:61517365-61517387 CCCTGCACTGTGAGTGAGTCGGG + Intronic
1083722511 11:64610395-64610417 CCCAGCAAGGTGAGTGAGGCCGG + Intronic
1084084755 11:66849904-66849926 CCCAGCATGGTGTGAGGGTGGGG - Intronic
1084747682 11:71183713-71183735 CCCAGCATGCTGGGTGGGCCTGG - Intronic
1084930812 11:72554113-72554135 ACCAACACGGTGAGTGGGTCAGG - Intergenic
1085516663 11:77115806-77115828 ACCAGCTTGGTGAGTGGGTGCGG + Intronic
1089069770 11:115690303-115690325 CCCAGCAGGGTGAGCGCATCTGG - Intergenic
1089389269 11:118088953-118088975 CCCACCATGGTGATGGGGTCTGG + Intronic
1090922781 11:131221615-131221637 CCCAGCTTGGTGAATGAGCCGGG - Intergenic
1091277431 11:134361984-134362006 CCCACCATGGTGAGCGTAACTGG - Intronic
1091599177 12:1907769-1907791 GCCAGCCTGGTGAGTATGCCTGG + Intronic
1093096045 12:14973472-14973494 CCCAGGATGGTGTGAGTGTGAGG + Intronic
1094204180 12:27823262-27823284 CCCAGCATCGTGAGAGAGTGTGG + Intergenic
1096153081 12:49326712-49326734 TCCAGCCTGGTAAGTGTTTCTGG + Exonic
1098290784 12:68955478-68955500 TACAACATGGTGAGTGTGTGTGG + Intronic
1098565660 12:71932861-71932883 GCCAGCATGGTGGGTGTGAGTGG + Intergenic
1102060651 12:109928444-109928466 CCCGGCATGGTGAGCCTGCCAGG + Intronic
1103349724 12:120275752-120275774 CCCAGCATTGTGAGAGTCTGAGG + Intergenic
1103353687 12:120303830-120303852 TCCAGCATGGTGATTTTGTCCGG + Exonic
1103749736 12:123150739-123150761 CCGAGCGGGGTGAGTGCGTCCGG - Intergenic
1104450248 12:128863243-128863265 CCCAGCAAGGCGAGTCTGTCTGG + Intronic
1105007528 12:132730519-132730541 CCCAGCAGCCTGATTGTGTCTGG - Intronic
1109578447 13:64293146-64293168 GCCAGCTTGGTGTGTGTGTTTGG - Intergenic
1113552306 13:111202191-111202213 CCCAGCATGGTGCCTGTGTGGGG + Intronic
1113659617 13:112096627-112096649 CCCAGCATGTTCATTGTGTGGGG - Intergenic
1113922890 13:113924011-113924033 GCCAGCCTGGTCTGTGTGTCTGG - Intergenic
1114418543 14:22560160-22560182 CCAGCCATGGGGAGTGTGTCTGG - Intergenic
1115171110 14:30507832-30507854 CCCAGCATGGCCTGTCTGTCTGG - Intergenic
1119277907 14:73376733-73376755 CTGAGTATGGTGAGTGTGCCTGG + Intronic
1122160466 14:99780633-99780655 CGCATCATGATGAGTGGGTCAGG + Intronic
1122483666 14:102063921-102063943 CCAGGCATGGTGGGTGCGTCAGG + Intergenic
1122795877 14:104205969-104205991 CCCGGCATGGTGTGTGTGCAGGG + Intergenic
1122805889 14:104256811-104256833 CCAAGCATGGTGAGGGATTCTGG + Intergenic
1126100625 15:45116302-45116324 CCCGGTTAGGTGAGTGTGTCAGG + Intronic
1126790311 15:52215444-52215466 CCCTGCATGGTGGGTCTTTCTGG - Intronic
1127556195 15:60089735-60089757 TCCAGCATGGTGACTGTGGCTGG + Intergenic
1128609799 15:69064532-69064554 CTCACCATGGAGAGTGTGTGTGG + Intergenic
1129104741 15:73298603-73298625 CCCAGCAAGGTGAGTGAGGATGG + Exonic
1129333476 15:74839414-74839436 CCCATCTTGGTGAGTGTGGGAGG - Intronic
1129710744 15:77819257-77819279 CCCGGGACGGTGAGTGTGGCCGG - Intronic
1130551229 15:84891048-84891070 CCCAGGATGGGGAGTGGGTAGGG + Intronic
1131183424 15:90255877-90255899 CCCCGCAGAGTGAGTGGGTCTGG + Intronic
1132880109 16:2158402-2158424 TCCAGCCGGGTGAGGGTGTCCGG - Intronic
1132986976 16:2772322-2772344 CCCAGCATGGTCAGTGGGAAGGG - Intronic
1133144135 16:3770940-3770962 CCCAGCATGTTGAGAGGGTTAGG + Exonic
1133355087 16:5130336-5130358 TCCAGCATGGCCAGTGAGTCGGG - Intergenic
1134093629 16:11404690-11404712 GCCTGCAGGGTGAGTGTGTGAGG - Exonic
1135572194 16:23557759-23557781 CCCCGGATGGTGAGTGCGGCGGG + Exonic
1136091453 16:27923178-27923200 CCAAGCTTGGTGGTTGTGTCTGG - Intronic
1136710767 16:32234719-32234741 CCCAGCTAAGTGAGTGAGTCAGG - Intergenic
1136757144 16:32694692-32694714 CCCAGCTAAGTGAGTGAGTCAGG + Intergenic
1136810965 16:33175683-33175705 CCCAGCTAAGTGAGTGAGTCAGG - Intergenic
1136817441 16:33285763-33285785 CCCAGCTAAGTGAGTGAGTCAGG - Intronic
1136824005 16:33342292-33342314 CCCAGCTAAGTGAGTGAGTCAGG - Intergenic
1137010091 16:35312892-35312914 CCCCCCATGTTGAATGTGTCTGG - Intergenic
1138062581 16:53907440-53907462 CCCAGCATCGTGAGAGAGTATGG + Intronic
1141647131 16:85373599-85373621 CCCAGCCTGGAGTGAGTGTCTGG + Intergenic
1142024503 16:87805189-87805211 CCCTGCCTGGGGAGTGTGTGTGG - Intergenic
1203059293 16_KI270728v1_random:955043-955065 CCCAGCTAAGTGAGTGAGTCAGG + Intergenic
1143581976 17:7833066-7833088 CCCAGGATGGTGTCTGGGTCCGG + Exonic
1144021047 17:11240677-11240699 CCGGGCATGGTGAGTGAGTGAGG + Intergenic
1147394035 17:40127619-40127641 CCAAGCATGGTGAGTGCCTATGG - Intronic
1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG + Intergenic
1151897080 17:76987647-76987669 CCCAGCAGGGGAAGTGTGTGTGG + Intergenic
1151905638 17:77046850-77046872 CACAGCATTCTGAGTGTGCCAGG - Intergenic
1151976799 17:77487934-77487956 CCCAGCATGTTGAGCATGTTGGG + Intronic
1152461721 17:80445364-80445386 CCCAGCTGGGTGGGTGTTTCAGG + Intergenic
1153968180 18:10200875-10200897 TCCAGCATGGGGAGGGTGTGTGG + Intergenic
1154170505 18:12047436-12047458 CCCATCATGGGGAGTGGGTTGGG - Intergenic
1155340136 18:24805409-24805431 CCCAGCAAGGCCTGTGTGTCTGG - Intergenic
1156223335 18:35076560-35076582 CCTAGCCTGGGGAGTCTGTCAGG - Intronic
1156369326 18:36458500-36458522 CCAAGGATGGGGAGTGTCTCTGG + Intronic
1156587889 18:38452468-38452490 CCCAGCATTATAAATGTGTCTGG + Intergenic
1157716968 18:49894467-49894489 CCCACCAGGGTGGGTGTGACAGG + Intronic
1160782659 19:884708-884730 GCCAGCATTCTGAGTGTGTTAGG - Intronic
1162376881 19:10310192-10310214 CCCAGCATGTTGAGTGTCCTTGG - Exonic
1163500399 19:17672796-17672818 CCCAGCATGGTCAGTGTTGGAGG - Intronic
1164589623 19:29499549-29499571 CCCTGCATAGTGAGTCTGTGAGG - Intergenic
1164670864 19:30071239-30071261 CCCAGCTTGGTGGGTGAGGCTGG + Intergenic
1164951968 19:32344885-32344907 CGCAGCATGGTGCTTGGGTCTGG - Intergenic
1165020649 19:32921444-32921466 GCCAGCATGGGGAGAGTGTCAGG - Intronic
1165314975 19:35049268-35049290 CCCAGCATGGTGTCTGTTGCAGG + Exonic
1165467230 19:35982229-35982251 CCCAGCATCATGGGTGTGTGGGG - Intergenic
1167272083 19:48511487-48511509 CCCACCCCGGTGAGTCTGTCGGG - Exonic
929978461 2:46656984-46657006 ACAAGCATGGTGAGTGGGGCAGG - Intergenic
935223528 2:101034949-101034971 CCCAACACAGTGAGTGTGCCAGG + Intronic
936373202 2:111919980-111920002 AGCAGCATGGAGAGTGGGTCTGG - Intronic
938246320 2:129780391-129780413 CCCTGCAGGGTGTGTGTTTCTGG - Intergenic
946237119 2:218330836-218330858 CCCAGCTTGCTGACTGTGCCTGG + Intronic
948676212 2:239598322-239598344 CCCAGAATGATGCCTGTGTCTGG + Intergenic
948813961 2:240500239-240500261 CCCAGCTTTGTGTGTCTGTCTGG - Intronic
1169908747 20:10629943-10629965 CCCAGAAGGCTGAGTGTGTGCGG + Intronic
1172513318 20:35515397-35515419 ACCAGCATGGTGTGTCTGCCTGG - Exonic
1173906344 20:46632409-46632431 CCCACCATGGTGATTCTGTGAGG - Intronic
1174670449 20:52302749-52302771 CCCAGCATTTTTTGTGTGTCTGG + Intergenic
1176282636 20:64322999-64323021 CCCAGCAGGGAGAGAGTTTCTGG - Intergenic
1177882154 21:26707088-26707110 GCCAGAATGGAGGGTGTGTCAGG + Intergenic
1178250250 21:30996991-30997013 CCCATCCTGGTGTGTGTTTCTGG - Intergenic
1178282320 21:31294078-31294100 CACAGCATGGTGAGGGTGGGGGG + Intronic
1178724950 21:35043079-35043101 CCCAGCATGTTGAAGGTGACAGG + Intronic
1178919237 21:36727943-36727965 AGAAGCAGGGTGAGTGTGTCAGG + Intronic
1181456132 22:23061185-23061207 CCCAGGCTGGTGGGTGTGTAGGG + Intronic
1182283796 22:29232394-29232416 CCCAGCATGGTGAGTCCCCCTGG + Exonic
1183237240 22:36628643-36628665 CTCAGCTTGGTGTGTGTTTCTGG + Intronic
1183279849 22:36926169-36926191 CCCAGCATGGTGAGGGGCTGGGG + Exonic
1184405537 22:44298596-44298618 CCCAGCAGCGTGAGTGTGCCTGG - Intronic
953250296 3:41239742-41239764 CTCAGCTTGGTTAGTGTGTCAGG - Exonic
954941495 3:54377072-54377094 GACAGGATGGTGAGTGTGGCAGG - Intronic
956206048 3:66755591-66755613 CCAAGCATTGTCAGTGTGTTGGG + Intergenic
960052906 3:113254645-113254667 CCTACCATGCTGAGTGTGTGTGG - Intronic
961181448 3:124881352-124881374 CCAAGCATTGTGGCTGTGTCAGG + Intronic
961486112 3:127217883-127217905 ACAAGCATGGTGAGTGGGACAGG - Intergenic
962743797 3:138382586-138382608 CCCAGCCTGGCTAGTGGGTCTGG - Intronic
967087444 3:186108336-186108358 CCCAGCAGGCTGAGGGCGTCCGG - Intronic
968046490 3:195626668-195626690 CCCACCAAGGAGAGTCTGTCTGG - Intergenic
968308163 3:197663373-197663395 CCCACCAAGGAGAGTCTGTCTGG + Intergenic
970579247 4:17458956-17458978 CACAGGATGGGGAGTGTGGCAGG + Intergenic
972597430 4:40542332-40542354 CCCAGTATGGAGAGAGTGTTGGG - Intronic
972703266 4:41514971-41514993 CCCGGCTTCTTGAGTGTGTCTGG + Intronic
976508873 4:85883686-85883708 CCAAGGATGGTGAGAGTTTCTGG + Intronic
982126411 4:152187750-152187772 CCCAGAAGGGTGAATGTGTTCGG + Intergenic
984064580 4:175032712-175032734 CCCAGCAGGGTGAGTGGGCACGG - Intergenic
985962108 5:3310435-3310457 CCCAGCAGGGTGGGTGTCTTTGG - Intergenic
985966986 5:3345035-3345057 CCCAGGAGGGTGTGTGTGCCAGG - Intergenic
986531463 5:8740798-8740820 CCCAGCAGGGAGAGTCTGTATGG - Intergenic
989111116 5:37907380-37907402 CTGAGCATGGGGAGTGTCTCTGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
999855085 5:155585795-155585817 CCCATCAAAGGGAGTGTGTCCGG + Intergenic
999975723 5:156910097-156910119 CCCACCATGGTTAGTGAGACAGG - Intergenic
1000147354 5:158466480-158466502 GCCAGCATGGTGATTGTGAAGGG + Intergenic
1001412072 5:171519122-171519144 CCCCTCAGGGTGAGTGTCTCTGG + Intergenic
1001584187 5:172821741-172821763 CCCAGCACGGTGAGTGTGGGAGG + Intergenic
1005823958 6:29621087-29621109 TCCAACATGGTGAGAGTGTGGGG - Exonic
1007549852 6:42720841-42720863 CCCAGGTTGGTGGGTGTGTTGGG + Intronic
1008741542 6:54615005-54615027 CCCAGGAAGCTTAGTGTGTCAGG - Intergenic
1010403792 6:75479389-75479411 CCCAGTATGGTGAGGGTATGAGG - Intronic
1014447691 6:121547337-121547359 CACAGGATGGGGAGTGTGGCAGG + Intergenic
1015228303 6:130883912-130883934 CCCAGCATGGAGAAGGTCTCAGG - Intronic
1015709421 6:136122925-136122947 CCCAGCAGTCTTAGTGTGTCTGG - Intronic
1017341646 6:153331070-153331092 CCAAGCATGGTGTGTGTGTCTGG + Intergenic
1017990428 6:159483227-159483249 ACCAGCATGGTGAGTGCAGCTGG + Intergenic
1019274070 7:166744-166766 CCCTGCATGGTGCATGTGGCAGG + Intergenic
1019403841 7:872150-872172 CTGAGCATGGTCTGTGTGTCCGG + Intronic
1019702877 7:2482543-2482565 CCCAGCCTGGTGCAGGTGTCTGG - Intergenic
1020746655 7:12087916-12087938 CTCAGAATGGTGAGTGTGGATGG - Intergenic
1021197575 7:17690183-17690205 ACTAGCATGGTGGGTGTTTCTGG + Intergenic
1022232394 7:28426971-28426993 ACCAGCCTGGTGAGTGTTCCTGG + Intronic
1023369867 7:39502437-39502459 CCCAGCCTTTTGAGTGTGACTGG - Intergenic
1024228542 7:47346637-47346659 CCCAGCACTGAGAGTGAGTCTGG - Intronic
1024446481 7:49485267-49485289 CCCTGCATGCTGAGTGTGGCAGG - Intergenic
1024855737 7:53776924-53776946 TGCAGCATTGTGAGTGTGTTTGG - Intergenic
1026446401 7:70488318-70488340 CCCAGCCTGGAGAGTGCGCCAGG + Intronic
1026965159 7:74434764-74434786 CCCAGGAAGGTGAGTGGGGCTGG + Intergenic
1029682992 7:102125191-102125213 CCCATGATGATGAGTGGGTCAGG + Intronic
1031689794 7:124773420-124773442 CCCAGAAAAGTGAGTGTGCCTGG - Intergenic
1033354101 7:140585584-140585606 CATACCTTGGTGAGTGTGTCAGG + Exonic
1033548696 7:142425686-142425708 CCCAGCAAGGTTAGTGTGTTGGG - Intergenic
1034268823 7:149793612-149793634 CCCTACCTGGTGAGTGTGCCTGG + Intergenic
1035047634 7:155979725-155979747 CACTGCCTGGTGAGTGTGCCTGG - Intergenic
1035307297 7:157941717-157941739 CCCAGCATAGGGAGTGTGGCTGG - Intronic
1038647794 8:29375392-29375414 ACTAGCATGGTGAGTGCGGCAGG - Intergenic
1040415008 8:47188001-47188023 CCCTGCATGGTGACAGTGACTGG + Intergenic
1041152036 8:54944795-54944817 CCCAGCAAGGTGATAGTGGCAGG - Intergenic
1042642337 8:70950470-70950492 CAGAGCATGGTGAGTCTGGCTGG + Intergenic
1042960548 8:74299219-74299241 CCCGGTATGATTAGTGTGTCTGG - Intronic
1043750261 8:83926006-83926028 CACAACATGGTGAGTGGGTTGGG + Intergenic
1044478885 8:92661526-92661548 CTCAGAATGGTGAGTGAATCCGG - Intergenic
1045631506 8:104129132-104129154 CCCAGCATTTTGAGAGTGTGAGG + Intronic
1046944913 8:119965402-119965424 TCCAGCATGGTGAGCGTATTGGG + Exonic
1049352007 8:142169634-142169656 CCCTCCATGTTGAGGGTGTCTGG - Intergenic
1049352023 8:142169684-142169706 CCCTCCATGTTGAATGTGTCAGG - Intergenic
1049352037 8:142169733-142169755 CCCTCCATGTTGAGGGTGTCAGG - Intergenic
1049352052 8:142169783-142169805 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352069 8:142169833-142169855 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352086 8:142169883-142169905 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352103 8:142169933-142169955 CCCTCCATGTTGAGGGTGTCAGG - Intergenic
1050851091 9:10287434-10287456 CCCCGCATGGAGACTGTTTCTGG + Intronic
1050855401 9:10347913-10347935 CCCAGCGTGGTGCATGTGCCTGG + Intronic
1056998340 9:91484584-91484606 CCCACCATGCTGAGGGTGTATGG + Intergenic
1060224043 9:121780702-121780724 CCCAGCAGTGAGAGTGTCTCAGG + Intronic
1061849089 9:133404027-133404049 GCCAGCCTGGTGAAGGTGTCAGG + Exonic
1185786369 X:2894631-2894653 CCAGGCATGGTGAGTGTGTGGGG + Intergenic
1186739044 X:12497948-12497970 CCCAGGCTAGTGAGTGTGGCAGG - Intronic
1187126032 X:16455341-16455363 GCTAGCATGGTGAGTGTGTTGGG - Intergenic
1192361743 X:70445086-70445108 CCGAGCAGTGTGAGTGTGCCAGG + Exonic