ID: 917871378

View in Genome Browser
Species Human (GRCh38)
Location 1:179245111-179245133
Sequence ATCAAATAGTTTTGGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917871378_917871386 18 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871386 1:179245152-179245174 AGTAGCCTTAAAGCGGGGAAGGG No data
917871378_917871385 17 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871385 1:179245151-179245173 AAGTAGCCTTAAAGCGGGGAAGG No data
917871378_917871388 27 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871388 1:179245161-179245183 AAAGCGGGGAAGGGTATGAATGG No data
917871378_917871380 -9 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871380 1:179245125-179245147 CTATTTGATGATCTTTAAAGAGG No data
917871378_917871382 12 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871382 1:179245146-179245168 GGCCTAAGTAGCCTTAAAGCGGG No data
917871378_917871381 11 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871381 1:179245145-179245167 AGGCCTAAGTAGCCTTAAAGCGG No data
917871378_917871383 13 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871383 1:179245147-179245169 GCCTAAGTAGCCTTAAAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917871378 Original CRISPR ATCAAATAGTTTTGGAGAAA TGG (reversed) Intergenic
No off target data available for this crispr