ID: 917871379

View in Genome Browser
Species Human (GRCh38)
Location 1:179245119-179245141
Sequence TAAAGATCATCAAATAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917871379_917871385 9 Left 917871379 1:179245119-179245141 CCAAAACTATTTGATGATCTTTA No data
Right 917871385 1:179245151-179245173 AAGTAGCCTTAAAGCGGGGAAGG No data
917871379_917871381 3 Left 917871379 1:179245119-179245141 CCAAAACTATTTGATGATCTTTA No data
Right 917871381 1:179245145-179245167 AGGCCTAAGTAGCCTTAAAGCGG No data
917871379_917871386 10 Left 917871379 1:179245119-179245141 CCAAAACTATTTGATGATCTTTA No data
Right 917871386 1:179245152-179245174 AGTAGCCTTAAAGCGGGGAAGGG No data
917871379_917871388 19 Left 917871379 1:179245119-179245141 CCAAAACTATTTGATGATCTTTA No data
Right 917871388 1:179245161-179245183 AAAGCGGGGAAGGGTATGAATGG No data
917871379_917871383 5 Left 917871379 1:179245119-179245141 CCAAAACTATTTGATGATCTTTA No data
Right 917871383 1:179245147-179245169 GCCTAAGTAGCCTTAAAGCGGGG No data
917871379_917871382 4 Left 917871379 1:179245119-179245141 CCAAAACTATTTGATGATCTTTA No data
Right 917871382 1:179245146-179245168 GGCCTAAGTAGCCTTAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917871379 Original CRISPR TAAAGATCATCAAATAGTTT TGG (reversed) Intergenic
No off target data available for this crispr