ID: 917871382

View in Genome Browser
Species Human (GRCh38)
Location 1:179245146-179245168
Sequence GGCCTAAGTAGCCTTAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917871378_917871382 12 Left 917871378 1:179245111-179245133 CCATTTCTCCAAAACTATTTGAT No data
Right 917871382 1:179245146-179245168 GGCCTAAGTAGCCTTAAAGCGGG No data
917871379_917871382 4 Left 917871379 1:179245119-179245141 CCAAAACTATTTGATGATCTTTA No data
Right 917871382 1:179245146-179245168 GGCCTAAGTAGCCTTAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917871382 Original CRISPR GGCCTAAGTAGCCTTAAAGC GGG Intergenic
No off target data available for this crispr