ID: 917872842

View in Genome Browser
Species Human (GRCh38)
Location 1:179257128-179257150
Sequence CAGAATCAAGAGAAGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917872838_917872842 1 Left 917872838 1:179257104-179257126 CCAGACAGTTTGAGAGACAGGGC No data
Right 917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917872842 Original CRISPR CAGAATCAAGAGAAGTAGGA TGG Intergenic
No off target data available for this crispr