ID: 917880809

View in Genome Browser
Species Human (GRCh38)
Location 1:179333955-179333977
Sequence CAACCATGGCGGAGCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917880801_917880809 12 Left 917880801 1:179333920-179333942 CCAAATGGGAGGTCAGAAGCTCA 0: 1
1: 0
2: 0
3: 6
4: 159
Right 917880809 1:179333955-179333977 CAACCATGGCGGAGCCAGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917880809 Original CRISPR CAACCATGGCGGAGCCAGAG GGG Intronic
900604984 1:3519884-3519906 CACCCATGGCAGAGCCAGGTGGG + Intronic
900691510 1:3983316-3983338 CACCCAGAGCGGAGGCAGAGAGG - Intergenic
902650035 1:17831156-17831178 CAACCATGGGGGTGGCAGTGGGG - Intergenic
905023835 1:34836522-34836544 CAACCTTGGCGGAGGCTCAGGGG - Intronic
906263317 1:44408846-44408868 CAGCTACGGCGGAGGCAGAGGGG + Intronic
906633027 1:47388262-47388284 CAACCCTGGCCAAGCCAGAGAGG - Intergenic
907501091 1:54881557-54881579 CAACCATGTGGGAGACAGTGTGG + Intronic
909823744 1:80099044-80099066 CAATCATGGAGTAGCCAGAGGGG - Intergenic
912008270 1:104930842-104930864 CAACCATGGAGGAGTCAGAAGGG + Intergenic
912048337 1:105489935-105489957 CATCCATGGCTGGGCGAGAGAGG - Intergenic
912363491 1:109113947-109113969 CCACCCGCGCGGAGCCAGAGAGG + Intronic
915494625 1:156272952-156272974 CAACCTTGGAGGAGCCATATTGG - Intronic
916625059 1:166546695-166546717 CAACCATTGTGGAGACAGTGTGG - Intergenic
917880809 1:179333955-179333977 CAACCATGGCGGAGCCAGAGGGG + Intronic
918362365 1:183772078-183772100 CACCGATGGGGGAGCCAGAAGGG - Intronic
919311474 1:195916067-195916089 CAAACATGGCAGAGGCAAAGGGG - Intergenic
921068908 1:211642919-211642941 CAGCCATGTCCTAGCCAGAGAGG + Intergenic
922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG + Intergenic
924037219 1:239949754-239949776 CATCCATGGAGGAGACCGAGGGG - Intergenic
1065023211 10:21517392-21517414 CAACTTTGGCGGGGCCTGAGCGG - Exonic
1066982603 10:42432295-42432317 CAACCATTGTGGAGACAGTGTGG - Intergenic
1067262049 10:44701468-44701490 CAAACATGAAAGAGCCAGAGTGG - Intergenic
1069777104 10:70933652-70933674 CAACCTTTGGGGAGCCACAGGGG - Intergenic
1070889450 10:79931078-79931100 CAACCATGGCTGAGATGGAGGGG + Intergenic
1074211376 10:111338411-111338433 CAGCAATGGCAGAGCCAAAGGGG - Intergenic
1074535201 10:114324150-114324172 CAACCATGGGGGAGAAAAAGAGG + Intronic
1075408200 10:122208714-122208736 CAACCATGCCGGTGGCAGAAGGG + Intronic
1075688762 10:124381413-124381435 CAACCATGTCAGAGCCAGAATGG + Intergenic
1076851577 10:133095907-133095929 CATCCATGGCGTGGTCAGAGTGG + Intronic
1080398290 11:31910395-31910417 CAACCATTGTGGAACCAGTGTGG + Intronic
1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG + Intronic
1083709442 11:64539121-64539143 CCACGCTGGCGGAGCCAGAGGGG + Intergenic
1084903380 11:72327210-72327232 ATTCCATGGCAGAGCCAGAGTGG - Intronic
1089179843 11:116575691-116575713 CAACCATTGTGGAGTCAGTGTGG + Intergenic
1092002462 12:5043863-5043885 CAAGCGCGGCGCAGCCAGAGAGG + Intergenic
1093659187 12:21734976-21734998 CAACCATGGTGGAGACAGTGTGG + Intronic
1096174190 12:49501344-49501366 CATGCATGGGAGAGCCAGAGAGG + Intronic
1096334210 12:50740865-50740887 CAAACAGGACTGAGCCAGAGGGG - Intronic
1099528309 12:83742740-83742762 CAACCATTGTGGAGACAGTGTGG + Intergenic
1099619294 12:84980792-84980814 CAATCATGGCAGAGACAAAGGGG + Intergenic
1099786413 12:87269651-87269673 TTACCATGGCGAAGCAAGAGAGG + Intergenic
1107328261 13:39268883-39268905 CCACCATGGTGGACCCAGCGGGG + Intergenic
1107435667 13:40378473-40378495 CAATCATGGCAGAGGCAGAAGGG - Intergenic
1108096124 13:46903280-46903302 TAACCATGGCTGAGACAGACTGG + Intergenic
1111417535 13:87968490-87968512 CAAACATGGTGGAGAAAGAGAGG + Intergenic
1112617126 13:101017325-101017347 CAACAATGGAGCAGACAGAGAGG - Intergenic
1114960330 14:27879450-27879472 CAACCATTGTGGAGACAGTGTGG - Intergenic
1117203039 14:53412064-53412086 CAACCCTGGCTGAGGCACAGAGG - Intergenic
1117981653 14:61347905-61347927 CAAGCTTGGCGGAGGCAGTGGGG + Intronic
1119199063 14:72739736-72739758 AAATCATGGCAGAGCCACAGTGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1122701898 14:103595340-103595362 CAAGCATGGGGGAGCCTGAGAGG - Intronic
1124181790 15:27482905-27482927 AAAGCATGGCGGGGCCAGAGTGG - Intronic
1124206257 15:27723596-27723618 CACCCAGGGAGGAGCAAGAGGGG + Intergenic
1124696933 15:31870949-31870971 CAAGCATGGGAGAGCCGGAGCGG - Intergenic
1125428819 15:39576245-39576267 AAACATTGGTGGAGCCAGAGAGG + Intergenic
1125518538 15:40336035-40336057 CAGCCATGGCAGGACCAGAGAGG + Intronic
1127765077 15:62177859-62177881 AAACCATAGCAGAGCTAGAGCGG - Intergenic
1127879557 15:63144604-63144626 CAACCATGGCGGAAAGAGAAGGG - Intronic
1129166971 15:73784262-73784284 CAGCCATGGAGGAGTCTGAGGGG - Intergenic
1131204926 15:90436039-90436061 CAAGCAGGGAGGAGACAGAGAGG - Intronic
1133737108 16:8624238-8624260 AAACCATGGCTGAGGCAAAGTGG - Intronic
1137840418 16:51636141-51636163 CAGCCATGGCTGCACCAGAGAGG + Intergenic
1137910473 16:52373134-52373156 CAATCATGGCAGAGACAAAGAGG + Intergenic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1141568060 16:84916674-84916696 CAACCCTGGAGGAGCGAGTGTGG + Intronic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1143597911 17:7926383-7926405 CAACTATGGTGGAGCCAGGAAGG + Intronic
1145936562 17:28717845-28717867 CAGCGTTGGCGGAGCCCGAGCGG - Intronic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1152403857 17:80085477-80085499 CCACCATGGGGAAGCTAGAGGGG + Intronic
1154337009 18:13474117-13474139 CAATCATGGCGAAGGCAAAGGGG - Intronic
1156766494 18:40662966-40662988 CATCAATGGTGGAGCCAGAAAGG + Intergenic
1157099881 18:44719746-44719768 CAATCAGGGCCCAGCCAGAGAGG - Intronic
1157593186 18:48848352-48848374 CAGCCATGAGGGAGCCAAAGTGG - Intronic
1159898599 18:74021003-74021025 CAATCATGGCGGAAGCAAAGGGG + Intergenic
1160020753 18:75178921-75178943 CAACCATGGAGGAGGCCGTGTGG - Intergenic
1160518827 18:79493056-79493078 CGAGCATGGCCGAGCCACAGAGG + Intronic
1160900742 19:1426886-1426908 CAACCATGGCCCTGTCAGAGGGG - Intronic
1161267852 19:3373234-3373256 CAATGAGGGCTGAGCCAGAGGGG - Intronic
1165365518 19:35362682-35362704 CCACCATTGCGGAGCTAGAGGGG + Intergenic
1168707259 19:58477226-58477248 CAGGCATGGGGGACCCAGAGGGG - Exonic
929186518 2:39101130-39101152 CAATCATGGCAGAGCCAAAGGGG + Intronic
931378114 2:61726358-61726380 AACCCATGGAGGAGACAGAGAGG + Intergenic
934592655 2:95570112-95570134 CAACCATGTCGAAGACAGTGTGG + Intergenic
934941835 2:98508358-98508380 CCACCATAGAGGAGCCAGACTGG + Intronic
936388258 2:112049830-112049852 CAGCCATGGCAGAGAGAGAGAGG - Intergenic
937224245 2:120359138-120359160 CAACCATGCCGGAGAAGGAGTGG + Intergenic
946474049 2:219990919-219990941 CAACCATGGTGGAGGCAAGGAGG - Intergenic
1172055755 20:32153109-32153131 CAACCAATGCAGAGCCAGACTGG - Intronic
1174481978 20:50837701-50837723 CAGCCAAGCCGCAGCCAGAGAGG - Intronic
1176007456 20:62874231-62874253 CAGCCAAGGCAGAGACAGAGAGG - Intergenic
1177532117 21:22373985-22374007 TAGCCATGCTGGAGCCAGAGTGG + Intergenic
1179143959 21:38751543-38751565 CAACCATGGCGGAAGGAGAAGGG - Intergenic
1179274773 21:39882279-39882301 CAACCGTGGCAGAGCCAATGTGG + Intronic
1180794334 22:18594676-18594698 CAGCTACGGCGGAGGCAGAGAGG - Intergenic
1181227406 22:21400644-21400666 CAGCTACGGCGGAGGCAGAGAGG + Intergenic
1181251244 22:21534195-21534217 CAGCTACGGCGGAGGCAGAGAGG - Intergenic
1183107206 22:35622936-35622958 CACCCATGCTGGAGCCAGAGTGG - Intronic
1183943976 22:41313514-41313536 CAACCTTGAAGGAGCAAGAGGGG + Intronic
1184552547 22:45212262-45212284 CACCCATGGAGCATCCAGAGAGG + Exonic
949898464 3:8790226-8790248 CAACCATGAGAAAGCCAGAGTGG - Intronic
952809114 3:37385597-37385619 CAGCCATGGCTGAATCAGAGGGG + Intergenic
954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG + Intronic
956351082 3:68337228-68337250 CAATCATGGCGAAGGCAGACGGG + Intronic
961378176 3:126480929-126480951 CTTCCATGGCAGAGACAGAGAGG - Intergenic
964683291 3:159366118-159366140 CAATCATGGCAGAGGCAAAGAGG + Intronic
968231306 3:197006364-197006386 CAACGATGCAGGAGGCAGAGGGG + Intronic
968545585 4:1196071-1196093 CAGCGATGGGGCAGCCAGAGGGG - Intronic
968652965 4:1767322-1767344 GAACCACGGCGCAGCCTGAGGGG + Intergenic
968983346 4:3862778-3862800 CAACCATCGGAGGGCCAGAGAGG - Intergenic
969597651 4:8158222-8158244 CAACCCAGGCGCTGCCAGAGCGG + Intronic
969651455 4:8470650-8470672 CAACCATGGGGCAGCCAGCCTGG - Intronic
974797417 4:66770635-66770657 CAACCATGTGGAAGCCAGTGTGG - Intergenic
981477856 4:145206554-145206576 CAATCATGGCAGAGGCAAAGGGG + Intergenic
985509794 5:306588-306610 CAAACATGGCTGAGACAGAGAGG - Exonic
985881576 5:2642312-2642334 CTGCCATGGAGGGGCCAGAGTGG + Intergenic
987029676 5:13964293-13964315 CAACCGTGGAGGAGCCAGAGGGG - Intergenic
994115458 5:96057013-96057035 CAACCATGTAGCAGCCACAGAGG - Intergenic
997580220 5:135012353-135012375 CCATCATGGCTAAGCCAGAGTGG - Intergenic
998220446 5:140273819-140273841 TAACCATGTTGGAGACAGAGGGG + Intronic
998797531 5:145835523-145835545 CCACGCTGGCGGCGCCAGAGCGG + Intergenic
1000071344 5:157743746-157743768 CAAACATGGAGGAGCGGGAGCGG + Exonic
1000106692 5:158066700-158066722 CAATCATGGCAGAGGCAAAGTGG + Intergenic
1001741043 5:174052860-174052882 CCACCTTGGCAGAGCCACAGGGG + Intronic
1002579178 5:180197255-180197277 CAACAATGGCTGGGACAGAGGGG + Intronic
1004560422 6:16744289-16744311 CATCCATGTAGGAACCAGAGAGG - Intronic
1007494711 6:42251969-42251991 CAAGCATGGGGGAGTCAGGGTGG - Intronic
1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG + Intergenic
1011308284 6:85953474-85953496 CAACCATGTGGAAGTCAGAGTGG - Intergenic
1014213839 6:118734415-118734437 CAAACATGGAGGAGCCAGATTGG - Intergenic
1017407552 6:154136291-154136313 AAACCATGGCGCAGTCAGGGAGG - Intronic
1018475825 6:164140492-164140514 CAACCTTGTAGGATCCAGAGAGG - Intergenic
1020150900 7:5680947-5680969 CCGCCATGGCCCAGCCAGAGGGG - Intronic
1021676970 7:23090226-23090248 GAACTCTGGCAGAGCCAGAGTGG + Intergenic
1023748296 7:43343829-43343851 CAACCATTGTGGAGACAGTGTGG - Intronic
1024095890 7:45982505-45982527 GAAGGATGGGGGAGCCAGAGTGG + Intergenic
1026009929 7:66628821-66628843 CAATCAGGGCGGAACCAGCGCGG + Intergenic
1026451567 7:70533942-70533964 CAACCATTGTGTAGGCAGAGTGG - Intronic
1027976994 7:85171392-85171414 CAACCATGATGGAGCTAGAAAGG + Intronic
1034270772 7:149802620-149802642 CAGCCAGGGAGGAGCCAGGGTGG - Intergenic
1035105693 7:156440272-156440294 TAACTCTGGCGGGGCCAGAGTGG - Intergenic
1035130661 7:156650267-156650289 CAACAAGGGAGGAGCCAGAAAGG + Intronic
1037072828 8:14673510-14673532 CAATCATGGCGAAGGCAAAGGGG - Intronic
1037741444 8:21612237-21612259 CACCCATGGCAGAACCAGAATGG - Intergenic
1037936160 8:22916378-22916400 CAGCTATGGCTGAGCGAGAGAGG - Intronic
1037950770 8:23017612-23017634 CCACCGTGGCTCAGCCAGAGAGG + Exonic
1041401640 8:57451353-57451375 CAACTAGGGTGGAGCCTGAGGGG + Intergenic
1043726032 8:83611525-83611547 CAACCTTGGCCAACCCAGAGAGG + Intergenic
1046359609 8:113132536-113132558 CAATCATGGCAGAGGCAAAGAGG - Intronic
1046763581 8:118046209-118046231 TAACCAGGGAGGAGCCACAGAGG - Intronic
1049072945 8:140371040-140371062 CAAGCATCGCGGAGCCTGGGTGG - Exonic
1050403486 9:5282198-5282220 CAACCATTGTGGAAGCAGAGTGG + Intergenic
1050409744 9:5350780-5350802 CACCCATGGAGCAGCCACAGAGG + Intergenic
1053011701 9:34637416-34637438 CAGCCCTGGCGGAGGCAGAGGGG + Exonic
1055787144 9:79883468-79883490 CAACCATGGGGCACCCTGAGCGG - Intergenic
1059626625 9:116073917-116073939 CAACTCTGGCAGAGCCATAGAGG - Intergenic
1061910407 9:133719398-133719420 CAACCCTGGAGGACGCAGAGTGG + Intronic
1062352832 9:136147625-136147647 CACCCATGGCGGGGCCAGGAGGG + Intergenic
1186249305 X:7648874-7648896 CAATCATGTTGGAGACAGAGTGG + Intergenic
1187390965 X:18886481-18886503 GAGCCATGGCAGAGGCAGAGGGG - Intergenic
1190059479 X:47201619-47201641 CGACCATGGGGGAAGCAGAGGGG + Intronic
1193403177 X:81070075-81070097 CAACCATTGTGGAGTCAGCGTGG + Intergenic
1195281945 X:103344735-103344757 CAATCATGGCGAAGGCAAAGGGG + Intergenic