ID: 917881147

View in Genome Browser
Species Human (GRCh38)
Location 1:179337164-179337186
Sequence AGTTTTATGCCCCTGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917881144_917881147 -5 Left 917881144 1:179337146-179337168 CCATTCCATGCTCTTCTCAGTTT 0: 1
1: 1
2: 3
3: 52
4: 661
Right 917881147 1:179337164-179337186 AGTTTTATGCCCCTGTTTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 116
917881145_917881147 -10 Left 917881145 1:179337151-179337173 CCATGCTCTTCTCAGTTTTATGC 0: 1
1: 1
2: 1
3: 22
4: 316
Right 917881147 1:179337164-179337186 AGTTTTATGCCCCTGTTTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917881147 Original CRISPR AGTTTTATGCCCCTGTTTGG AGG Intronic
900134656 1:1110696-1110718 ATTTTTGTGCACGTGTTTGGCGG - Intronic
902088502 1:13882607-13882629 AATTTTTTGCTCATGTTTGGAGG + Intergenic
904639562 1:31914350-31914372 TGTTTTAGGGCCCTGTGTGGTGG - Intronic
906324900 1:44839498-44839520 AGTTTTTTGCTGTTGTTTGGGGG - Intronic
907868868 1:58424850-58424872 AGTTCTAAGCCTCTGTTTTGAGG + Intronic
909212317 1:72839928-72839950 GGTTTTCAGCCCTTGTTTGGAGG + Intergenic
912913400 1:113786668-113786690 TGTTTTAAGCCATTGTTTGGGGG + Intronic
917426323 1:174918433-174918455 TGTTTTATGACACTGTTTTGAGG - Intronic
917881147 1:179337164-179337186 AGTTTTATGCCCCTGTTTGGAGG + Intronic
918112493 1:181469363-181469385 AGTTTTGTGCCCGAGTTAGGGGG + Intronic
919021610 1:192113251-192113273 AGTGATATGCCCCTCTTTGAAGG + Intergenic
922159916 1:223071949-223071971 AGTGGCATGCCCTTGTTTGGGGG - Intergenic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
923314268 1:232764651-232764673 TGTTTGAGGTCCCTGTTTGGTGG + Intergenic
1064380986 10:14841611-14841633 TGTTTTATGCTGCTGTTTGAGGG + Intronic
1064990910 10:21256066-21256088 ATTTTTATGTCCCTGTTTTGGGG + Intergenic
1068277216 10:54816023-54816045 AGTTTTATGCAGATTTTTGGTGG + Intronic
1071983220 10:91024554-91024576 AGCTTTAAGCCCCTGTTTCATGG + Intergenic
1072787967 10:98296974-98296996 GGTTTTCTGCCCCTCTTAGGGGG + Intergenic
1073526287 10:104185213-104185235 GGTTATATGCCCCTTTTTTGTGG + Intronic
1074124415 10:110516742-110516764 TGCTTTAAGCCCCTGTTTGGTGG - Intergenic
1074222481 10:111451762-111451784 AGTCTTGTGCCCTTGTTTGGAGG - Intergenic
1074606954 10:114981612-114981634 AGTTTTATGCCTATGTTTGTGGG + Intergenic
1076521862 10:131086324-131086346 TGTTTTAAGCCACTGTTTGCAGG - Intergenic
1081271355 11:41087364-41087386 AGTTTTATGTGTATGTTTGGTGG - Intronic
1082026751 11:47578383-47578405 AGTTTTATGCCCCAGTTATTTGG - Intronic
1085459880 11:76687104-76687126 AGGTTTTTGCGCCTGTTTTGCGG + Intergenic
1091700746 12:2659886-2659908 AATTTCATGCCTCTGTTTTGTGG + Intronic
1092360516 12:7832501-7832523 AGTTTAATTCCCCTAGTTGGGGG + Intronic
1093957846 12:25242153-25242175 AGTATTATGCCCCTCTTTGATGG - Intronic
1094247559 12:28317706-28317728 AGTTTTATGTCCATGTGTAGGGG + Intronic
1096958474 12:55551652-55551674 AGTGTTCTGCTCCTGGTTGGGGG + Exonic
1097795275 12:63855036-63855058 AGTTTAAAGTCACTGTTTGGGGG - Intronic
1102839861 12:116107189-116107211 AATTTTATGTCTCTTTTTGGGGG - Intronic
1105496736 13:20936926-20936948 AGGTTTCTTCCCCTGCTTGGGGG + Intergenic
1106419677 13:29575786-29575808 AGATTTCTGTCCCTGTTTGAGGG + Intronic
1112029097 13:95440687-95440709 AATATTATGCCTCTGTTTGTTGG - Intronic
1114271358 14:21102278-21102300 GGGCTTATGGCCCTGTTTGGAGG + Intronic
1120413526 14:84190233-84190255 ATTTCTATGACCCTTTTTGGAGG - Intergenic
1121594673 14:95151913-95151935 AGTTAAATGACCCTGTTTGAAGG - Intronic
1124471324 15:29988889-29988911 ATTATTCTGCTCCTGTTTGGTGG + Intergenic
1125093473 15:35823755-35823777 AGTTGTATGACTGTGTTTGGTGG - Intergenic
1130347896 15:83066373-83066395 AGTTTTATGTTTTTGTTTGGGGG - Intronic
1133999232 16:10769909-10769931 ACTTTTATGCCCCAGAGTGGAGG - Intronic
1136995363 16:35185354-35185376 AGTTTCCAGCCCCTGTTTTGAGG + Intergenic
1139470806 16:67177230-67177252 AGTTGGATGCCCATGTTTGGAGG - Intronic
1145824710 17:27868218-27868240 AATTTTTTGGCCCTGTGTGGTGG + Intronic
1152320315 17:79605294-79605316 AGTTTCAAGTCCTTGTTTGGGGG - Intergenic
1154262474 18:12848782-12848804 TGTTTTAAGCCACTGTTTTGGGG + Intronic
1156356240 18:36343530-36343552 AGATTAATGCCCATGGTTGGGGG + Intronic
1156875336 18:42003765-42003787 ATTTTTATGCTTCTGTTTTGAGG + Intronic
1157164618 18:45347066-45347088 AGTTTTGTGGCCCTGCGTGGTGG + Intronic
1163903742 19:20132397-20132419 AGTTTTATTTCCCTTTTTTGTGG - Intergenic
1165135818 19:33667960-33667982 AGATTTATGCCCTTGTGTCGGGG + Intronic
926038416 2:9653324-9653346 AGGTTTATACCACTGCTTGGAGG + Intergenic
931673844 2:64673469-64673491 AGATTTAAGCCACTGTTTGTTGG + Intronic
931881333 2:66574362-66574384 AATTTTGTGCCCTTGTTTAGAGG - Intergenic
939749480 2:146024717-146024739 ATTTTTATTCCACTGATTGGGGG - Intergenic
945932041 2:215864893-215864915 AGCTTTCTGCCACTGTATGGTGG - Intergenic
946467105 2:219921661-219921683 AGATTTCTGCCTCTGTGTGGTGG + Intergenic
947614893 2:231549558-231549580 AGTTTTAAGCTCCTGACTGGTGG + Intergenic
1169438919 20:5617884-5617906 TGTTTTATGCACCTCATTGGTGG + Intergenic
1169793111 20:9432545-9432567 ACTTTTCTGCCCTTCTTTGGAGG - Intronic
1170013555 20:11755366-11755388 AGTTTTATTCCTCTGTTTATTGG + Intergenic
1170715611 20:18828471-18828493 GGTTTTATGCCACTGTTTTGGGG + Intronic
1171200437 20:23236714-23236736 ACTTTTATGCCACTGTCAGGAGG + Intergenic
1171429474 20:25072167-25072189 TGTTTTAAGCCACAGTTTGGGGG + Intronic
1171438919 20:25146248-25146270 AGTGTTCTGCCCCTGTGTTGAGG + Intergenic
1175362437 20:58423567-58423589 AGTTTAATGTAGCTGTTTGGTGG + Intronic
950898863 3:16478536-16478558 TGTTTTAAGCCACTGTTTTGTGG - Intronic
951393358 3:22134534-22134556 TGTATTCTGCCACTGTTTGGTGG - Intronic
953398147 3:42589379-42589401 AGCTTTATTCCCCTGAGTGGTGG - Intronic
955844116 3:63142801-63142823 TCTTTTATGCCACTGTTTGAGGG + Intergenic
956223808 3:66933650-66933672 TGTTGTATGCCCTTGTTTTGTGG + Intergenic
963122031 3:141784381-141784403 AGTTTTATGCCCCAGTTTCCGGG + Intronic
963297381 3:143560698-143560720 AGTTTTATTCAACTTTTTGGTGG - Intronic
963724636 3:148906239-148906261 CGTTTCATGCCCCTGATTTGAGG + Intergenic
965901608 3:173647369-173647391 AGTATTTTGCTCCTGTTGGGTGG - Intronic
966633578 3:182106820-182106842 AGTCTTATTCCCATGTTTGCTGG - Intergenic
975278764 4:72535677-72535699 TGTTTTCTGCCCCTCTGTGGAGG - Intronic
976370343 4:84280748-84280770 AGTTTTATGGCCAAGTGTGGTGG + Intergenic
978278201 4:106977765-106977787 AGTTTTGTTCCCTTGTTGGGAGG + Intronic
980556154 4:134408230-134408252 AGGTTTATGGCCCAGTTTGTAGG - Intergenic
980848033 4:138347764-138347786 TGTTTTATGCCTATGTATGGAGG + Intergenic
981594589 4:146405142-146405164 AGTTTTTTGCCTCTGTTTAGTGG + Intronic
982838045 4:160147518-160147540 TGTTTTAAGCCACTGTTTTGGGG + Intergenic
983263093 4:165477639-165477661 AGATTTATTCTTCTGTTTGGTGG + Intronic
985051607 4:185997668-185997690 GTTTTTATGCCACTATTTGGGGG - Intergenic
988900704 5:35729400-35729422 ATTTTTCTGCTCCTGTTTGCAGG - Intronic
989497001 5:42121535-42121557 AGTTTTATGTTTCTGTTTGTAGG - Intergenic
991686523 5:69187180-69187202 CGTTTTATGACCCTTTATGGTGG + Intergenic
992053965 5:72968785-72968807 AGTTTAATACCCCTGGTTTGTGG + Intronic
993113497 5:83689132-83689154 AGTATTAGGCTCCTGTTTGTAGG + Intronic
994698873 5:103107871-103107893 AGTTTTATTAACCTGTTTTGGGG + Intronic
995810320 5:116099729-116099751 ATTTTTATGCCTTTTTTTGGTGG + Intronic
997644816 5:135474503-135474525 ATTTTTATGCCCTTTGTTGGAGG + Intergenic
999028095 5:148258970-148258992 GGTTTGATACCCCTGGTTGGGGG + Intergenic
1005029913 6:21499186-21499208 AGTTTTCAGCCCCTTTCTGGGGG + Intergenic
1006686623 6:35840092-35840114 AGTATTATGCCCGGGTGTGGTGG - Intronic
1006743124 6:36323325-36323347 AGCTTTCTGCCCCTGTGTGTTGG - Exonic
1007855704 6:44854186-44854208 ATTTTTATTCCCCTGTTTGGGGG - Intronic
1009232015 6:61074297-61074319 AGTTTTTTTCCCCCCTTTGGTGG + Intergenic
1013742934 6:113309831-113309853 AGACTGATGTCCCTGTTTGGAGG + Intergenic
1014103212 6:117534511-117534533 AGTTCTTTGTCCCTGTTTGGAGG - Intronic
1014843362 6:126245743-126245765 AGTTTTAGTCTCCAGTTTGGTGG + Intergenic
1021853404 7:24830576-24830598 AACTTTATGCCCCTGGGTGGTGG + Intronic
1023039896 7:36162938-36162960 AGTTTTATTCTCCAGTTTTGGGG - Intronic
1023131351 7:37006176-37006198 TGTTTTATACCTCTGTATGGGGG - Intronic
1024673250 7:51615769-51615791 AGTTTTATGGCCATGTTAGGAGG + Intergenic
1033542504 7:142369827-142369849 AGTTTGATGTTCTTGTTTGGAGG + Intergenic
1035214719 7:157357009-157357031 AGTTTTAGGTCCAGGTTTGGTGG + Intronic
1040541670 8:48362560-48362582 AGTTTGCTGCCCCTGTTGTGAGG - Intergenic
1041704097 8:60827042-60827064 AGTTTTATTCCACTATTTGTAGG + Intronic
1041818549 8:62002758-62002780 ACTTTTCTGTCCCTGTTTGTTGG + Intergenic
1042329870 8:67567622-67567644 AGATTTATTCCCATGTTTTGGGG - Intronic
1042710540 8:71712559-71712581 AGATTTATGCCATTTTTTGGAGG + Intergenic
1043802253 8:84624357-84624379 AGTTTTGTGTTCCTTTTTGGAGG + Intronic
1045653616 8:104365578-104365600 AATTGTATTCCCCTTTTTGGTGG - Intronic
1047567819 8:126064951-126064973 AATTTTATGCCCTTTTTTGTAGG - Intergenic
1051722533 9:20053334-20053356 TGTTTTATGCCCCTCTATTGTGG - Intergenic
1052167907 9:25356633-25356655 AGTTATATCCCCCTGTTTTAGGG + Intergenic
1058144192 9:101393234-101393256 TGTTTTGTGTCCTTGTTTGGTGG - Intronic
1062155460 9:135045835-135045857 AGTTCTTTGCAGCTGTTTGGGGG + Intergenic
1188986910 X:36776091-36776113 AGTTTTAGCCACCTGTTAGGAGG - Intergenic
1190002699 X:46704917-46704939 CTTTTTATGCCTCTGTTTTGTGG - Intronic
1193531500 X:82659906-82659928 AGTTCTAAGCCACTGTTCGGTGG + Intergenic
1193896869 X:87125961-87125983 AATTTGGTGCCCCTGTGTGGAGG - Intergenic
1197569004 X:128126470-128126492 AGTTTTATTCTCCTGTTTATTGG - Intergenic
1199976212 X:152896331-152896353 TATTGTATGCCCCTGTCTGGTGG - Intergenic