ID: 917881328

View in Genome Browser
Species Human (GRCh38)
Location 1:179339488-179339510
Sequence GAGGATAAAGAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1689
Summary {0: 1, 1: 0, 2: 12, 3: 150, 4: 1526}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917881328_917881332 9 Left 917881328 1:179339488-179339510 CCCTCCTCATTCTCTTTATCCTC 0: 1
1: 0
2: 12
3: 150
4: 1526
Right 917881332 1:179339520-179339542 GTAGTAGATTACATTGATGAAGG 0: 1
1: 0
2: 0
3: 9
4: 110
917881328_917881333 13 Left 917881328 1:179339488-179339510 CCCTCCTCATTCTCTTTATCCTC 0: 1
1: 0
2: 12
3: 150
4: 1526
Right 917881333 1:179339524-179339546 TAGATTACATTGATGAAGGAAGG 0: 1
1: 0
2: 3
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917881328 Original CRISPR GAGGATAAAGAGAATGAGGA GGG (reversed) Exonic
900332024 1:2140047-2140069 GAGGCTATAGAGAGTGAGGGTGG + Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901963569 1:12847451-12847473 GATGAAAAAGAGGCTGAGGAAGG - Exonic
902260672 1:15222665-15222687 GAAGATAAATAGAAAGGGGAAGG + Intergenic
902976626 1:20093212-20093234 GAGGAAGAAGAGGAGGAGGAAGG - Intergenic
903057272 1:20644977-20644999 GGGGATACAGAGGGTGAGGAAGG - Intronic
903207296 1:21792192-21792214 GGGGCTAGACAGAATGAGGATGG - Intergenic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903331723 1:22600093-22600115 GAGGAAGGAGAGAAGGAGGAAGG + Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904412477 1:30332820-30332842 GGGGAAACAGAGAAGGAGGAGGG - Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904439270 1:30519346-30519368 GATGATAAAGAGGATGATGATGG + Intergenic
904676895 1:32204284-32204306 GACGATGAAGAGGAAGAGGATGG + Exonic
904683914 1:32247461-32247483 GAGGACGAGGAGGATGAGGAGGG + Exonic
904920131 1:34000958-34000980 GAGTAGAAAGAGGAGGAGGAAGG + Intronic
905112782 1:35609265-35609287 GAGGATACTGAGAGTCAGGAAGG + Exonic
905120215 1:35676062-35676084 GAGGAAGAAGAGAGGGAGGAAGG - Intergenic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905319057 1:37102875-37102897 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
905489787 1:38334378-38334400 GAGAATCAAGAGAATTAGGCGGG - Intergenic
905683639 1:39892921-39892943 GGGGAAAAAGAGGATGGGGATGG - Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906237114 1:44218797-44218819 GAGGATGGAGACAATGAGCAAGG - Intronic
906460074 1:46030167-46030189 GAGGAAGAAGTGAGTGAGGATGG + Exonic
906860814 1:49357193-49357215 GAGGACACAGAGAAGCAGGAGGG - Intronic
907289999 1:53407505-53407527 AAGGCTAGAGAGGATGAGGATGG + Intergenic
907505888 1:54918074-54918096 GAGGAGAGAGAGATGGAGGAGGG - Intergenic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
907692150 1:56679830-56679852 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
907703229 1:56810042-56810064 GAGAAGGAAGAGAAAGAGGAGGG + Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908567119 1:65368684-65368706 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909802200 1:79823834-79823856 GAGGAGACAGAAGATGAGGAAGG - Intergenic
909855342 1:80522582-80522604 GAAGATAGAGAGTAGGAGGATGG + Intergenic
910108964 1:83661581-83661603 GAGGGCAGAGAGAGTGAGGACGG - Intergenic
910174495 1:84414494-84414516 GAGGAGAAAGATAGTGAGGTTGG - Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910501599 1:87898029-87898051 GTGGATAAATAGAAAGAGTAAGG + Intergenic
910865529 1:91784880-91784902 GAGGATGAAGACAATGAAGGGGG - Intronic
911172926 1:94789187-94789209 GAGGATGTAGAGAAAGGGGAAGG + Intergenic
911215240 1:95185930-95185952 GAGACAAAAGTGAATGAGGAAGG + Intronic
911437053 1:97874094-97874116 GATGATGAAGACAATGAGGATGG - Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911720539 1:101186734-101186756 GGGGAGAAAGAGAAAGAAGAAGG - Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
912933648 1:113984794-113984816 GAGGATATTGAGAACAAGGAGGG - Intergenic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913257599 1:116967992-116968014 GAGTATAAAGAAAGAGAGGAGGG + Intronic
913295152 1:117312097-117312119 GAGGAAACAGAGAATTAGAAAGG + Intergenic
913309332 1:117472183-117472205 GAGGACATAGAGAAGGCGGAAGG - Intronic
913423500 1:118699940-118699962 GAGGAAAAAGAGGAGTAGGAGGG - Intergenic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
913690625 1:121276610-121276632 GAGGAGAAAGAGAGAGAGAAAGG - Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914146913 1:145003348-145003370 GAGGAGAAAGAGAGAGAGAAAGG + Intronic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914686117 1:149981098-149981120 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
915110455 1:153561572-153561594 CAGGAGAAAGTGGATGAGGAGGG - Exonic
915257088 1:154641887-154641909 GAGGAGGAAGAGGGTGAGGAGGG - Intergenic
915473159 1:156137696-156137718 GAGGACGACGAGGATGAGGATGG + Exonic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915543912 1:156585141-156585163 GAAGATGAAGAGTTTGAGGAGGG + Exonic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916392398 1:164344784-164344806 GAAGATAAAGAGAGGGTGGATGG - Intergenic
916521452 1:165567190-165567212 GAGGATTCAGAGAAAGAAGAAGG + Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
916636316 1:166673244-166673266 GAGGAGGAAGAGAATCAGGGAGG + Intergenic
916982379 1:170152730-170152752 GATGAAAAATATAATGAGGAGGG + Intronic
917138049 1:171806709-171806731 AAAGAAAAAGAGAAAGAGGAAGG - Intronic
917156309 1:172003546-172003568 GAGGAAAAAGAGGAAGGGGAGGG - Intronic
917485230 1:175449437-175449459 GAGGAAGAAGAAAAAGAGGAAGG - Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918002924 1:180514566-180514588 GAGGAAGAAGAGGAGGAGGAGGG + Intergenic
918117443 1:181509115-181509137 GAGGATTAAGAGAAGGACTAGGG + Intronic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919534689 1:198773246-198773268 GAGGAAGAAGAAAATGAAGAGGG + Intergenic
919944163 1:202307672-202307694 GTGGATAGAGAGGATGGGGATGG - Intronic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920070774 1:203301481-203301503 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920228201 1:204453111-204453133 CAGATTAAAGAGACTGAGGAGGG - Intronic
920477945 1:206295099-206295121 GAGGAGAAAGAGAGAGAGAAAGG - Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920603576 1:207355358-207355380 GAGGAAAGAGAGAATGAGGATGG + Intronic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
920733044 1:208505984-208506006 GAGGACAGAGAGGAAGAGGAAGG - Intergenic
921123400 1:212156276-212156298 GGGGTTCAAGGGAATGAGGAAGG - Intergenic
921295929 1:213703919-213703941 GAGGAGATAGAGAATGAGACAGG - Intergenic
921515960 1:216092931-216092953 GGGGCTAAAGGGAGTGAGGAAGG - Intronic
921536308 1:216352871-216352893 GAGGATCAGGATAATGAGAAAGG + Intronic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
922001372 1:221481869-221481891 GAGGAGGAAGAGGAAGAGGAAGG - Intergenic
922300914 1:224299731-224299753 GAGGATAAAGAGAAAAAAGGTGG - Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922648131 1:227311815-227311837 GGAGAAAAAGAGAATGAGTAGGG - Intronic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922710777 1:227829265-227829287 GAGGATGAAGAGAAAAGGGAAGG - Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923227303 1:231949956-231949978 GAGGATAAGGAGACTGGGGCTGG - Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923769687 1:236927603-236927625 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
923968959 1:239177837-239177859 GAGGACAAAGAGAATTTAGACGG + Intergenic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924664609 1:246058284-246058306 GAGGATGCTGAGAATGAGGGAGG + Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063552345 10:7044935-7044957 GGGGATAATGAGAAAGAGAAAGG + Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063764308 10:9120535-9120557 GATGATACAGAGTATGAGGGTGG - Intergenic
1063929103 10:11011321-11011343 GAGTAGACAGTGAATGAGGAGGG + Intronic
1064178791 10:13098013-13098035 ACAGATAAAGGGAATGAGGAAGG + Intronic
1064294543 10:14066463-14066485 CTGGATAGAGAGAATGAGTAGGG + Intronic
1064414495 10:15136614-15136636 GAGGATCAGGAGGATCAGGAGGG - Intronic
1064839393 10:19573518-19573540 GAAGAGAAAGAAAATGAGGGAGG - Intronic
1064850824 10:19706968-19706990 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065023003 10:21516537-21516559 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1065145452 10:22763630-22763652 GAGGAAGAAGATGATGAGGATGG + Intergenic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065752442 10:28899457-28899479 GAACACAAAGAGAAAGAGGAGGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065871697 10:29961246-29961268 GAGGAGGCAGAGAATAAGGAAGG - Intergenic
1065941175 10:30565192-30565214 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1065979901 10:30883399-30883421 GAGGATGATGATAATGATGATGG - Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1066997630 10:42578360-42578382 GAGGATGAAGAGGAGGAGTAGGG - Intronic
1067287140 10:44914874-44914896 GAGGTTAAAGGGTAAGAGGATGG - Intronic
1067400540 10:45969683-45969705 GTGTTTAAAGAGTATGAGGAAGG - Intergenic
1067483642 10:46624358-46624380 GAACATAAAGAGAATGAAAAAGG + Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067611114 10:47717285-47717307 GAACATAAAGAGAATGAAAAAGG - Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1067853479 10:49769881-49769903 GAGGAAAAAGAGAGGAAGGAGGG + Intergenic
1068017273 10:51532863-51532885 GAGGATAAAGAAAGGGAGAAGGG - Intronic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068345420 10:55771722-55771744 GAGGATACTGATAATGAGGGAGG - Intergenic
1068435753 10:56989070-56989092 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1068467593 10:57415089-57415111 GAAGAGAAAGAAGATGAGGAGGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1068913408 10:62403304-62403326 GAGGAGGAAGAGGAGGAGGAAGG + Intronic
1069342033 10:67422367-67422389 GAAGAGAGAGAGAATGAGAAAGG + Intronic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070172210 10:73941317-73941339 AGGGATAAAGACCATGAGGACGG - Intergenic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070472390 10:76795731-76795753 GAGGACAAAGAGATGCAGGAGGG + Intergenic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070692071 10:78534245-78534267 GAGGAGACAGAGGAGGAGGAGGG - Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071104561 10:82079434-82079456 GAGGATATTGATAATGTGGAAGG - Intronic
1071203811 10:83251727-83251749 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1071262021 10:83928963-83928985 TAGGATAATGGGAATGGGGATGG - Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071431900 10:85613015-85613037 GAAGTAAAAGAGAATCAGGAAGG + Intronic
1071466820 10:85948343-85948365 GAGGATGAAGTGGTTGAGGATGG + Intronic
1072061104 10:91811323-91811345 GATGATTAGGAAAATGAGGAGGG - Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072167001 10:92823441-92823463 GAAGATAAAGAAAAAGAGGCCGG + Intergenic
1072703578 10:97663390-97663412 GAGGATGAAAGGAATGAGAAAGG - Intronic
1072797192 10:98365106-98365128 GGGGATGAAGAGAAAAAGGAGGG + Intergenic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1073003474 10:100303049-100303071 GGGGAAAGAGAGAATGAGAAAGG + Intronic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073337635 10:102722057-102722079 GAGAATAAACAGGATGTGGATGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073597728 10:104817419-104817441 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1074369191 10:112885748-112885770 GAGATTAAAGAGACTGAGGGGGG + Intergenic
1074487398 10:113899120-113899142 GAGAAGAGAGAGAAAGAGGAAGG - Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074648696 10:115493257-115493279 GAGGATGGAGAGTAAGAGGAGGG - Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1075065627 10:119287255-119287277 GAGGAGGAAGGGAAGGAGGAAGG + Intronic
1075065651 10:119287338-119287360 GAGGAGGAAGGGAAGGAGGAAGG + Intronic
1075066500 10:119292249-119292271 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1075304493 10:121355747-121355769 GAGGAAAGAGACAATGATGAAGG + Intergenic
1076074417 10:127522063-127522085 GGGGAGAGCGAGAATGAGGATGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076082951 10:127600011-127600033 GAGAACACAGAGAATGGGGAGGG + Intergenic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076241625 10:128912926-128912948 GAGGATAAAACAAATTAGGAAGG + Intergenic
1076286452 10:129302268-129302290 GAGGAAGACGAGAATGAGCAAGG + Intergenic
1076556383 10:131324230-131324252 GATGATAAAGAACATGAAGAGGG + Intergenic
1076926662 10:133493958-133493980 GTGGCAAGAGAGAATGAGGAGGG + Intergenic
1077663364 11:4088487-4088509 GATGAAAATGAGAATGAGAATGG - Intronic
1077728034 11:4696384-4696406 GATGAGAGAGAGAAAGAGGAGGG - Intronic
1077898322 11:6470753-6470775 GAGGGTAAAGAGAGAAAGGAGGG + Intronic
1078024228 11:7679546-7679568 CAGGAGAGAGAGAATGAGGGAGG - Intergenic
1078168222 11:8909404-8909426 GAGGAAGAAGAGGAAGAGGAAGG + Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078777007 11:14403044-14403066 GAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079740775 11:24057163-24057185 AAGAATAAAGAAAATGAGGTAGG + Intergenic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1081007657 11:37767060-37767082 GAGGAGAAAGAGAAATATGAAGG + Intergenic
1081154863 11:39677499-39677521 GAGGAGACAGAGAAAGAGAAAGG + Intergenic
1081184566 11:40026234-40026256 GAAGAGGAAGAAAATGAGGATGG + Intergenic
1081282329 11:41225093-41225115 GAGGATAGAGAGTAGAAGGATGG + Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081610622 11:44561066-44561088 GAAGGTAAAGAGAATGAGTGCGG - Intergenic
1081748112 11:45487317-45487339 GAAGAGAAAGAGAAAGAGAAAGG + Intergenic
1081842872 11:46215877-46215899 GAGGACAGAGAGAATGGGCAAGG - Intergenic
1082180151 11:49107048-49107070 GAGGAAAAAGAGAAAGAGTGGGG + Intergenic
1082868019 11:57917602-57917624 GATGGTAAAGAGGATGAGCAAGG + Intergenic
1082914817 11:58421742-58421764 GAGGATATTGACAATGAGGGAGG + Intergenic
1083010663 11:59395269-59395291 GAGGAGGAAGAGTAAGAGGAGGG - Intergenic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083067469 11:59939707-59939729 GAAGAGAAAGAGAAAGAGGAAGG - Intergenic
1083477061 11:62921546-62921568 GAGGAGAAAGGACATGAGGAAGG + Exonic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1083799562 11:65038670-65038692 GAGGAGGAAGAGGATGGGGAAGG + Exonic
1083875861 11:65524362-65524384 GAGGAAGGAGAGACTGAGGAGGG - Intergenic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084469693 11:69351334-69351356 GAGGAAAAAAAGATTGAAGAAGG - Intronic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084690132 11:70720329-70720351 GAGGCTACAGAGAATGAGCCTGG + Intronic
1084892863 11:72244922-72244944 GACGAGAAAGAGAGTGAGGGAGG + Intronic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1085957590 11:81418660-81418682 GAGGATAAAGAAAATGTGAATGG + Intergenic
1086267674 11:85020791-85020813 GATGAAAAAGAGGCTGAGGAAGG - Intronic
1086291707 11:85317757-85317779 GAGGATGAAGGGTAGGAGGAGGG + Intronic
1086463161 11:87025714-87025736 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087526061 11:99314746-99314768 GAGGAGAAAGAAGAAGAGGATGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087781342 11:102304091-102304113 GAGGAGAAAGAGAGAGTGGAAGG + Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088964613 11:114705684-114705706 GAGGAAAAAGAGGAAAAGGAAGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089419993 11:118324649-118324671 GTGGATAAAGAAAATGTGGGAGG + Intergenic
1089687617 11:120166755-120166777 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1089735983 11:120550529-120550551 GGGGATACAGATATTGAGGAGGG + Intronic
1089905920 11:122038336-122038358 GAGGCAAAAGAGAGAGAGGAAGG + Intergenic
1090028605 11:123188405-123188427 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090330132 11:125924859-125924881 TAGGATAAGGAGAACCAGGATGG - Intergenic
1090585336 11:128205996-128206018 GAGGAGCAAGAGAGGGAGGAGGG + Intergenic
1090853750 11:130593749-130593771 GGGGTTAGAGAAAATGAGGAAGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1092087281 12:5773555-5773577 GATGATAAAGATGATGATGATGG - Intronic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092689986 12:11097738-11097760 GATGATGAAGAGAATGATGATGG + Intronic
1092904027 12:13085914-13085936 GGAGATTAAGAGAATGTGGATGG + Intronic
1092918940 12:13213702-13213724 GATGATAGAGAGAATCATGAAGG - Exonic
1093128130 12:15355058-15355080 GAGGATGAAGAGAGAGAGAAAGG + Intronic
1093268647 12:17029580-17029602 GAGGAAGGAGAGAATGAGAAAGG + Intergenic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093683925 12:22034795-22034817 GAGTATAAAGTGAAAGAAGAGGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094551623 12:31457257-31457279 TAGGATAGAGAGAATGAGAGTGG - Intronic
1094800261 12:34024845-34024867 GAGGATACAGAGAAGGAGCAGGG + Intronic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095607379 12:44085939-44085961 GAGGATGAAGAGTATGAGAAAGG + Intronic
1095854538 12:46845440-46845462 GGGGAAAAAGAGAGTGAGGAGGG + Intergenic
1096066488 12:48744762-48744784 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1096231594 12:49899939-49899961 GAGGATATGGGAAATGAGGAAGG + Intronic
1096594999 12:52689433-52689455 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1096648974 12:53052774-53052796 GAGGAGAATGAGGAGGAGGAAGG + Intronic
1096972098 12:55675096-55675118 GGGGATACTGATAATGAGGAAGG + Intergenic
1096973699 12:55686351-55686373 GAGGATGGAAAGATTGAGGAAGG + Intronic
1097776507 12:63652772-63652794 GAGGGTGAAGGGTATGAGGAGGG + Intronic
1097832127 12:64236371-64236393 GAGGAAGAAGAGGAGGAGGAAGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098146631 12:67504183-67504205 GAGGAAACAGATTATGAGGAAGG + Intergenic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1098200692 12:68052247-68052269 GATGATAAACAGAATGAGTATGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098558205 12:71842852-71842874 AAAGAAAAAGAAAATGAGGAGGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1099012289 12:77305823-77305845 GAGGCTAAAAAGAATGATCAAGG - Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099643387 12:85319518-85319540 GAGGACAAAGAGGAGGGGGAGGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099989237 12:89707063-89707085 GAGGATAAAGAAAAAGAGAGGGG + Intronic
1100580778 12:95938431-95938453 AAGGATAAAGGGAATGAGAGTGG - Intronic
1100621329 12:96277139-96277161 GAGGAAAAAAAGAATTAGCAAGG + Intergenic
1100731105 12:97470447-97470469 GAGGAGGAAGAGAATGACAATGG + Intergenic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1100870337 12:98904190-98904212 GGGGATAAAGAAGATGAGGAGGG + Intronic
1100952257 12:99864202-99864224 GGGGATAAAGAGATTGAAGGTGG - Intronic
1101177363 12:102168121-102168143 GAAGAAAAAGAGAATGAGAGAGG - Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101255567 12:102973669-102973691 GAGGAGGGAGAGATTGAGGAAGG - Intergenic
1101285630 12:103309263-103309285 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1101385145 12:104250700-104250722 GATGATAAGGAGATTGAAGAAGG + Intronic
1101456250 12:104834431-104834453 AAGTATAAAGAGAATGATAAAGG - Intronic
1101575660 12:105994155-105994177 GAGGAAAGAGAGATTGAAGAAGG - Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101626265 12:106445110-106445132 GAAGACAAAGAGAAAGAGGAAGG - Intronic
1101683831 12:106996600-106996622 GAGGATGCAGAGAAAAAGGAAGG - Intronic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1102570238 12:113823063-113823085 GAGGAGACAGGGGATGAGGAAGG - Intronic
1102734185 12:115143513-115143535 GATGGTAAAGATAATGATGATGG - Intergenic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103076938 12:117991132-117991154 GAGGAGGGAGAGAACGAGGAGGG + Intergenic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103262203 12:119597112-119597134 AAGGACAAAGAGGAAGAGGAAGG + Intronic
1103934261 12:124467092-124467114 GAGGATGACGAGGATGATGAGGG - Intronic
1104083179 12:125450312-125450334 GAAGATAAAAAAAATGATGATGG + Intronic
1104091454 12:125521215-125521237 GAAGAGGAAGAGAAGGAGGAAGG - Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104714397 12:131006692-131006714 GAGGATGAGGGAAATGAGGAGGG + Intronic
1105432826 13:20352533-20352555 GAGGTCAAATAAAATGAGGATGG - Intergenic
1105652135 13:22390622-22390644 CAGCATAAAGAGAATGAAAAGGG - Intergenic
1105907180 13:24823538-24823560 GAAGAGACAGAGAAAGAGGAAGG + Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106243086 13:27925474-27925496 GAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106663614 13:31828084-31828106 GAACAAAAAGAGAAGGAGGAAGG - Intergenic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1107560082 13:41550599-41550621 GAGGATGAAAGGAATCAGGAGGG + Intergenic
1107650727 13:42542063-42542085 GAAGATAAAGAGAAGGAGAGAGG - Intergenic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108411582 13:50153815-50153837 TAGGATTAAGAGGATGGGGAGGG + Intronic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108475270 13:50810146-50810168 GAAAGTATAGAGAATGAGGATGG - Intronic
1109004106 13:56847071-56847093 GAAGAAAAAGAAAAAGAGGAAGG - Intergenic
1109175583 13:59151350-59151372 GAGGATGGAGAGTGTGAGGAGGG - Intergenic
1109369196 13:61399146-61399168 GAAGAGAAAGAGGAAGAGGAAGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110085939 13:71379833-71379855 GAGGAAAAAGACAATGACCAAGG - Intergenic
1110268729 13:73569221-73569243 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110374249 13:74774657-74774679 GAAGAAAAAGAAAAGGAGGAAGG - Intergenic
1110426046 13:75368740-75368762 TTTGATAAAGAGAATGAGGCCGG + Intronic
1110480538 13:75969220-75969242 GAGGACAAAGAGACTGAAGAAGG + Intergenic
1110556334 13:76863728-76863750 GAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111713568 13:91848564-91848586 GAGGAGAAAGAGAAAGTAGAAGG + Intronic
1112064890 13:95782432-95782454 GAGGATGTAGAGAAATAGGAAGG - Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112499854 13:99934457-99934479 GAGGAAGGAGAGAAAGAGGATGG + Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112553353 13:100443914-100443936 GAAGATACATAGAATGGGGAAGG - Intronic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113095947 13:106663822-106663844 CATGACAAAGAGGATGAGGAAGG - Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113436845 13:110299107-110299129 GAAGACAAAGAGAACGGGGAGGG + Intronic
1114158904 14:20140455-20140477 CAAGATAAAGTGAATGAGGAAGG + Intergenic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1114282919 14:21211266-21211288 GATGAAAAAGAGGCTGAGGAAGG - Exonic
1114428616 14:22641304-22641326 GAGGAAAGAGAGAGAGAGGAAGG + Intergenic
1114557268 14:23569193-23569215 GAGGAGGAAGAAAATGAAGAAGG - Exonic
1114748780 14:25180754-25180776 GAAGACAAACAGAATGATGAGGG + Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115350948 14:32395171-32395193 GAGGTGAAAGAGAAAGAAGATGG - Intronic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1115670453 14:35605989-35606011 GAAGAGAAAGAGCATCAGGAAGG + Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1115989338 14:39135829-39135851 GAGGATAATGAGGATAAAGATGG - Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116183181 14:41561672-41561694 GAGACTAAAGTGAAAGAGGATGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116364921 14:44048016-44048038 GAGGATGTAGAGAAATAGGAAGG + Intergenic
1116374169 14:44176324-44176346 GAGGATGAAAAGGAAGAGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117315395 14:54567038-54567060 GAGGAGTAAGAGGAGGAGGAAGG + Intergenic
1117334132 14:54742327-54742349 GAGGAGAAATAGAATGGGGGGGG + Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117763002 14:59052054-59052076 GGAGAGAAAGAGAAAGAGGAAGG - Intergenic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118832258 14:69445294-69445316 GAGGATGAGGAGGAAGAGGAGGG - Intronic
1118979118 14:70701768-70701790 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120703821 14:87726991-87727013 GAGGAAGAAGAGGAAGAGGAGGG + Intergenic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121625787 14:95384606-95384628 AAGGAAAAAGACATTGAGGATGG - Intergenic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122431419 14:101649833-101649855 GAAGAAAAAAAGAAAGAGGATGG + Intergenic
1122612633 14:102996050-102996072 GCCAATTAAGAGAATGAGGATGG + Intronic
1124476526 15:30039657-30039679 GAGGAAGAAGAGAAAGAAGAAGG - Intergenic
1124546897 15:30637260-30637282 CAGGATAAAGAGGATAAAGATGG - Intronic
1124780499 15:32627256-32627278 CAGGATAAAGAGGATAAAGATGG - Intronic
1124817546 15:33010624-33010646 GATTATAAAGAGAAAAAGGAAGG + Intronic
1124859166 15:33421410-33421432 TAGGATAACGACATTGAGGATGG + Intronic
1124993852 15:34703495-34703517 GAAGAAGAAGAGAAGGAGGAGGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125298506 15:38228987-38229009 GAGAAAGAAGAGAAAGAGGAAGG + Intergenic
1125428520 15:39573619-39573641 GAAGAGAAAGAAAAAGAGGAAGG + Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125569635 15:40706394-40706416 AATGATAAAGAGATAGAGGAAGG + Intronic
1125626341 15:41112425-41112447 TAGCATATAGAGAATGAGAAGGG - Intronic
1125969139 15:43897912-43897934 CAGGAAAGAGAGAATGAGGGGGG - Intronic
1126051766 15:44692752-44692774 GAGGAACAAGAGTAAGAGGAGGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126370682 15:47943393-47943415 GAGGAAAAAGGAAAGGAGGAAGG + Intergenic
1126487637 15:49199849-49199871 GAGCAACAAGAGAATGAGGCAGG + Intronic
1126623766 15:50666505-50666527 GAGGAAAAAGAAAAAGAGGCCGG + Intronic
1126830905 15:52603791-52603813 GAAGATAAAGGGTATAAGGATGG + Intronic
1126859803 15:52872737-52872759 AAGGGTCAAGTGAATGAGGAAGG - Intergenic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1126940511 15:53760355-53760377 GAAGATAGAGAGTAGGAGGATGG - Intronic
1127430381 15:58901259-58901281 GAGGAAGAAGAAAATGAGAAAGG - Exonic
1127754608 15:62079226-62079248 GAAGTCAAAGAGAGTGAGGATGG + Intergenic
1127754917 15:62082911-62082933 GAAGACAAAGAGGATGAGGATGG - Intergenic
1127804018 15:62502013-62502035 TAGGACAAAGAGAGCGAGGAAGG - Intronic
1128466242 15:67914965-67914987 GAGGAGGAAAAGAATAAGGAGGG - Intergenic
1128631365 15:69271572-69271594 GAGCTTAGAGAGAATGGGGAGGG + Exonic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129227598 15:74179082-74179104 GAGGAGAATGAGAATACGGAGGG - Intergenic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129705378 15:77791230-77791252 GAGGGACAAGAGGATGAGGAGGG + Intronic
1129912178 15:79237090-79237112 GATGATGATGATAATGAGGATGG + Intergenic
1129912188 15:79237143-79237165 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1130020432 15:80226180-80226202 CAGTAAAAAGAGAATGAGGTGGG + Intergenic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130214789 15:81958050-81958072 GAGATTACAGGGAATGAGGAAGG - Intergenic
1130616541 15:85414511-85414533 GATGATATAGAGAATGAAGATGG + Intronic
1130680939 15:85996207-85996229 GAGGGTGAAGTGAATAAGGATGG - Intergenic
1130713355 15:86306336-86306358 GAAGATAAAGAGTAGAAGGATGG - Intronic
1130753815 15:86741950-86741972 GTGGATAAAGAGAATTAATATGG - Intronic
1131399041 15:92110014-92110036 GAGGAGAAAGGGAATCAGGCTGG + Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131548481 15:93335703-93335725 GATGCAAAAGAGAAAGAGGAAGG + Intergenic
1131937776 15:97525773-97525795 GAGGAAAAAAAGAAAGAGAAGGG + Intergenic
1133000796 16:2850480-2850502 GAGGAAAAAGAGGAAGACGAGGG + Intergenic
1133136850 16:3717967-3717989 AAAGCTAAAGCGAATGAGGAAGG + Intergenic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1133475623 16:6118821-6118843 GGGGAAAGAGAGAAAGAGGAAGG - Intronic
1133545805 16:6805388-6805410 GAGGATAGAGGGTAGGAGGAGGG + Intronic
1133668264 16:7992421-7992443 GGAGAGAAAGAGAAGGAGGAAGG + Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1134068219 16:11243487-11243509 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1134073228 16:11273417-11273439 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134205354 16:12233068-12233090 GAAGATGAAGACAAAGAGGAAGG - Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134405687 16:13956627-13956649 GAGGATGAAGAAAACGAGGATGG + Intergenic
1134414170 16:14029630-14029652 GACGATGAAGACAATGATGATGG - Intergenic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135053001 16:19207521-19207543 GAAGAGACAGAGAATGGGGAGGG + Intronic
1135161589 16:20101405-20101427 GAGGTGATAGAGAAAGAGGAAGG + Intergenic
1135671501 16:24379561-24379583 AAGGATAAAGATACTGAGGCTGG - Intergenic
1135770301 16:25213156-25213178 TGGGAAAAAGAGAATGTGGAGGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1136230152 16:28880967-28880989 GAGGATCAAGAGGATGACAAAGG - Exonic
1136499697 16:30664267-30664289 GAGGACGAAGAGGATGATGAGGG - Exonic
1136602168 16:31299790-31299812 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1137257536 16:46789471-46789493 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1137622418 16:49884638-49884660 GAGGATAAAGAAAGGAAGGAAGG + Intergenic
1137674605 16:50298100-50298122 GAGGAAAGAGGGAATGGGGAGGG - Intronic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1137865698 16:51893717-51893739 TAGGATAATGTGGATGAGGAAGG + Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1137951410 16:52787139-52787161 GAGTACAAAGAAAATGAAGAGGG - Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1138532049 16:57639803-57639825 GAGGAAAAAGATAAAGGGGAAGG - Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1140119123 16:72068163-72068185 GAGGATATAGAGAAAGAAGCTGG + Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141046998 16:80724209-80724231 GAGAAGAAAGAGGAAGAGGAGGG + Intronic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141490194 16:84367688-84367710 GATGATGAAGAGGAGGAGGATGG + Intergenic
1141847578 16:86621501-86621523 TAGGAGAAAGGGAAAGAGGAAGG - Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1142324870 16:89408278-89408300 AAGGCTAAAGTGAATGTGGAAGG - Intronic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1143178334 17:4969074-4969096 GATGATCAAGAGGATGAGTAAGG + Intronic
1143249430 17:5511835-5511857 GAAGAGAAAGAGGAAGAGGAAGG - Intronic
1143391340 17:6561002-6561024 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391355 17:6561063-6561085 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391424 17:6561269-6561291 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143647316 17:8239109-8239131 AAGGAAAAAGAAAATAAGGATGG + Intronic
1143702571 17:8672203-8672225 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1143729345 17:8872052-8872074 GAGGGTAAAGAAATTGAGGAGGG - Intergenic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144152879 17:12467513-12467535 GAGAATGATGAGAATGAGAAGGG + Intergenic
1144453300 17:15398950-15398972 GAGGATACAGAAAAGGAGGGTGG - Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144594485 17:16556636-16556658 GAAGAAAATGAGAATGTGGATGG + Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145408536 17:22633532-22633554 GAGGATACTGATAATGAGGGAGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146110003 17:30080728-30080750 GAGGAAAAAGAGTATGAGGATGG - Intronic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146455219 17:33004418-33004440 GAAGAGAAAGAGAAAGGGGAAGG + Intergenic
1146670726 17:34735794-34735816 GAGTATTAAGTGGATGAGGATGG + Intergenic
1146701247 17:34962056-34962078 GAGGAGGAAGAGGAGGAGGAAGG + Exonic
1146713351 17:35062102-35062124 GAGCATAAAAAGAATGAACAAGG + Intronic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147575120 17:41594564-41594586 GAGGATGGAGAGTAAGAGGAGGG + Intergenic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148079602 17:44960399-44960421 GAGGAGAGAGAGGATGAGAAGGG + Intronic
1148134919 17:45286065-45286087 GAGGAAAAAGGGAAGGAGGTGGG + Intronic
1148179636 17:45594989-45595011 GAGGAAGAAGAGGAAGAGGAAGG + Intergenic
1148269267 17:46250909-46250931 GAGGAAGAAGAGGAAGAGGAAGG - Intergenic
1148391463 17:47275946-47275968 GAGGACATAGTGAATAAGGAGGG - Intronic
1148606379 17:48932386-48932408 GAGGATGAGTAGAATGAGGCAGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148947981 17:51282458-51282480 GAAAATGAAGAGAAAGAGGAAGG + Intronic
1149114175 17:53071794-53071816 AAAGAAAAAGAGAAAGAGGAGGG + Intergenic
1149309170 17:55377526-55377548 GAAGAAATAGAGAATGAGAAAGG - Intergenic
1150465198 17:65386688-65386710 GAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1150541356 17:66103376-66103398 GAGGATAGAAAGAAAGAAGAGGG + Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151145565 17:72037338-72037360 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152609191 17:81307375-81307397 GAAGAGAAAGGGAAGGAGGAGGG - Intergenic
1152936704 17:83142422-83142444 GAGGAGAATGTGGATGAGGAAGG + Intergenic
1152985254 18:315176-315198 GAGAATGAAGAGAATGAGTCTGG + Intergenic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153416685 18:4853521-4853543 GAGGAGGAAGAGAACAAGGAGGG + Intergenic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1153505483 18:5792665-5792687 GAGGATGAAGAGTGGGAGGAGGG + Intergenic
1153785118 18:8527894-8527916 GATGTTAAAAAGAATGAGGCAGG + Intergenic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154339702 18:13492767-13492789 GGGGATGGAGAAAATGAGGAAGG - Intronic
1155072697 18:22330230-22330252 GAGGTTAAAGAGAATGACTGAGG - Intergenic
1155121767 18:22828017-22828039 AAGGATAAAGAGAGTGATTATGG - Intronic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155816332 18:30315901-30315923 GAGGAAAAAGATGATGGGGAAGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156472876 18:37388476-37388498 GAGGAGGAAGAGGAGGAGGATGG - Intronic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1156688290 18:39675970-39675992 CAGGATGAAGAGAATGAGTTGGG + Intergenic
1156701112 18:39826294-39826316 GAGGACAAAAAGAATAAGAAGGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157222096 18:45835857-45835879 GAGGACAGTGAGGATGAGGAAGG + Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157398775 18:47368230-47368252 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1157636215 18:49157423-49157445 GAGGATTAAATGAATGAGGTAGG - Intronic
1157915016 18:51655907-51655929 GAGCATAAAGAAAAAGTGGATGG + Intergenic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158555646 18:58472555-58472577 AAGGATAAAGAGCCTGGGGAGGG + Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159047899 18:63386713-63386735 GGGGATAAGGAGCATCAGGAGGG + Intergenic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159088874 18:63824090-63824112 GATGATAATGAGGATGATGATGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159279398 18:66266338-66266360 GAGGATAAAGAGAAAAAGTGAGG + Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159410991 18:68074007-68074029 GCGGCAAAAGAAAATGAGGAAGG - Intergenic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1159871360 18:73762349-73762371 GGAGATAAAGAGAGAGAGGAAGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160545535 18:79650812-79650834 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1160925356 19:1542255-1542277 GAGGAGAAAGAGGAAGAGAAGGG - Intergenic
1161121962 19:2532528-2532550 GAGGAGAGAGAGAATGAAGCAGG + Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1161478957 19:4501244-4501266 GAGGACAAGGAGCACGAGGAGGG + Exonic
1161501438 19:4618249-4618271 GGGGAAAGAGAGAATGAGAAAGG - Intergenic
1161922839 19:7279447-7279469 GAGGGAGAAGAGAGTGAGGAGGG + Intronic
1161966832 19:7553795-7553817 GAGGAAGAAGAGGAGGAGGAGGG + Intronic
1162071898 19:8157912-8157934 GAGGAGAAAGAGAGGAAGGAAGG + Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162200841 19:9018853-9018875 GGGGATAAAGAGAAGGAACAAGG + Intergenic
1162428989 19:10615610-10615632 GAGGAGGAAGAGGAAGAGGAAGG + Intronic
1162527169 19:11213053-11213075 GAGCATAATGAGCAGGAGGAGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163061291 19:14763985-14764007 GAGGATAAAGAGGAAGAAAAAGG - Intronic
1163640120 19:18457327-18457349 GAGGACACAGGGTATGAGGATGG + Intronic
1164188317 19:22892767-22892789 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1164316025 19:24088577-24088599 GATGATAAAGTGAATTAGGGAGG - Intronic
1164667546 19:30051523-30051545 GAGGAAACAGAAAAGGAGGAGGG - Intergenic
1164863593 19:31583437-31583459 GAGGAGAGAGAGCAAGAGGAGGG + Intergenic
1164921892 19:32094470-32094492 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165298746 19:34952866-34952888 GAAGAAGAAGAGAAAGAGGAAGG + Intergenic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1165832754 19:38737313-38737335 GAGGATGACGAGGATGAGGAAGG - Exonic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166338558 19:42123197-42123219 GAGGTTACAGAGGATGAGGTTGG - Intronic
1166369175 19:42291915-42291937 GGGGACACAGAGAAGGAGGAGGG - Intronic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1166541276 19:43607708-43607730 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166723265 19:45009782-45009804 GAAGAGAAAGAGAAAGAGAAAGG - Intronic
1167017297 19:46849641-46849663 GAGGATGCAGAGATTCAGGACGG - Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167262118 19:48464676-48464698 GAGGACGATGAGACTGAGGAAGG + Exonic
1167308490 19:48722217-48722239 GAGGATACAGGAAATGAGTAGGG + Intronic
1167621341 19:50562697-50562719 GAGGAGGAAGAGAGTGAGGCAGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167725016 19:51205553-51205575 CATGAGAAAGAGAGTGAGGAAGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168053459 19:53847288-53847310 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
1168361776 19:55746924-55746946 GAAGATGAAGATAATGATGATGG + Intergenic
1168368786 19:55813695-55813717 GATGATCAAGAGAAGCAGGAAGG + Intronic
1168559448 19:57370859-57370881 GAGGGTGTAGAGATTGAGGAAGG + Intronic
925436873 2:3846125-3846147 GAGGAAGAAGAGGACGAGGAGGG - Intronic
926411850 2:12612857-12612879 GAATACAAAGAGAATCAGGAAGG + Intergenic
926412532 2:12619617-12619639 GAGGAAGAAGAGAGGGAGGAGGG - Intergenic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926644957 2:15280410-15280432 GAGAATAAAGAGGATGGGGAAGG + Intronic
926772318 2:16389411-16389433 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926935406 2:18082806-18082828 GAGTAAAAAGAAAAAGAGGAGGG - Intronic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928105825 2:28470055-28470077 GGGGAGAAAGAGGAGGAGGAAGG + Intronic
928123945 2:28603301-28603323 GGGGAAGAAGAGAATTAGGAGGG + Intronic
928139414 2:28715497-28715519 GAGGATAAAAAAACTGAGGAAGG + Intergenic
928251186 2:29682157-29682179 GATGGCAAAGAGATTGAGGAGGG + Intronic
928301336 2:30127946-30127968 GAGGGTGAAGGGAATGAGTAGGG - Intergenic
928700226 2:33891520-33891542 GAGGATAAGGAAAATAAGTATGG + Intergenic
929013602 2:37472337-37472359 GAGGAGGAAGAGAAGGAGAAAGG + Intergenic
929217169 2:39427246-39427268 CAAAATAAAGACAATGAGGAGGG + Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
930082176 2:47459880-47459902 CAAGATGAAAAGAATGAGGAAGG - Intronic
930221679 2:48752811-48752833 GAAGATACAGGGAATGAGGGAGG - Intronic
930648989 2:53945433-53945455 GAGGATAAAGAGACTAAAAAGGG + Intronic
930851599 2:55966843-55966865 GAGGAAAATGAGAATCAGGGAGG - Intergenic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
931682550 2:64763720-64763742 CAGGATACAGAGACTGAGGCTGG - Intergenic
931693242 2:64852955-64852977 GAGGAGGAAGAAAAAGAGGAAGG + Intergenic
931735560 2:65190230-65190252 TAGATTAAAGAAAATGAGGACGG - Intergenic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932439418 2:71722872-71722894 AAGGAAAAAGAGAATGGGAAAGG + Intergenic
932503200 2:72203111-72203133 GATGATAATGACAATGAAGATGG + Intronic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932921847 2:75924956-75924978 GAGGAAGAGGAGAAAGAGGAAGG + Intergenic
933170020 2:79114875-79114897 GAGGAGGAAGAGAGTGATGATGG - Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933305569 2:80593850-80593872 GTGGATAAAGAAAATGTGGGTGG - Intronic
933542470 2:83664890-83664912 GAGGAGAGAGACAGTGAGGAAGG - Intergenic
933564272 2:83930763-83930785 GTGGATAAAGAAAATGTGGTGGG + Intergenic
933781355 2:85804063-85804085 GAGAATGAAGAGAATGATGCAGG - Intergenic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
933902564 2:86860558-86860580 GAGGAAAGAGAGACTCAGGAGGG + Intronic
934135504 2:88992650-88992672 GTAGATGCAGAGAATGAGGATGG + Intergenic
934150121 2:89138434-89138456 GAGGATAGACAGAGTGAGGCTGG - Intergenic
934217175 2:90043595-90043617 GAGGATAGACAGAGTGAGGCTGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
934475975 2:94593785-94593807 GAGGATAAAGAGGAAGAAGAGGG - Intronic
934521665 2:95023881-95023903 GAGGCTTCAGAGGATGAGGAAGG - Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
934725148 2:96611984-96612006 GGGGAGAAAGAAAATGAGCAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935712210 2:105909304-105909326 GAGGACACAGAGAAAGAGGAAGG + Intergenic
935777983 2:106488710-106488732 GAGGAAAGAGAGACTCAGGAAGG - Intergenic
935791059 2:106590591-106590613 GATGAGAAAGAGAAAGAAGAGGG - Intergenic
935859444 2:107312189-107312211 GAAGATTAAGAGAAAGGGGAAGG + Intergenic
935867583 2:107407629-107407651 GAAGAGAAAGAGAAAGGGGAGGG - Intergenic
936479505 2:112872172-112872194 GAGAATAGAGAGAATGAACAAGG + Intergenic
936878619 2:117222628-117222650 GAAGATAAAGAGAATGTATAGGG + Intergenic
936948894 2:117957190-117957212 GAAGATTAAGAGAATGAATATGG - Intronic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937690684 2:124751342-124751364 GAAGATAAAGGAAAGGAGGAAGG + Intronic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
937732948 2:125257166-125257188 GAGTACAAAGAAAAAGAGGAGGG - Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938143103 2:128812417-128812439 GAGGAGGAAGGGCATGAGGATGG + Intergenic
939020369 2:136951096-136951118 GAGGATGAAGGGCATGAGGGAGG + Intronic
939119670 2:138101323-138101345 GATGATGAAGTGAATGAGGACGG - Intergenic
939189273 2:138897281-138897303 GAGGACAATGACAATGAAGACGG + Intergenic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939543355 2:143520463-143520485 GTGGATAAAGAGAATGACTTTGG + Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941533586 2:166696699-166696721 GAATATCAAGAGAAAGAGGATGG + Intergenic
941672403 2:168309229-168309251 GAGGAGGTAGAGAAAGAGGAAGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941898308 2:170653071-170653093 GAGGATGAAGAAAAAAAGGAAGG - Exonic
941927725 2:170913080-170913102 GGGGATAGAGTGAATGAGAAAGG - Intergenic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943376684 2:187086290-187086312 GAGTATAAATAGCATGAGGAAGG + Intergenic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943601315 2:189924151-189924173 GATGAAAAAGAGGCTGAGGAAGG + Intronic
943923980 2:193747057-193747079 GAGGATAAAGGGTGGGAGGAGGG + Intergenic
943975132 2:194466297-194466319 GATGAAAAAGAGGATGAGGATGG + Intergenic
944099098 2:196003177-196003199 GATGGAAAAGAGAATGAGGAAGG + Intronic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944247589 2:197547187-197547209 GAGGAGAAAGAGAAAGAAGTGGG + Intronic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944411103 2:199443095-199443117 GAGGATGATGAGAATAAGGTGGG - Intronic
944777548 2:202982345-202982367 GAGGATACAGGGAATCTGGAAGG + Exonic
944934283 2:204551544-204551566 GGAGAGAAAGAGAAAGAGGAGGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945307077 2:208268772-208268794 GAAGAAAAAGAGGAAGAGGAAGG - Intronic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
945590918 2:211730456-211730478 GAGGAGATAGGGAAAGAGGAAGG - Intronic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
945892820 2:215448415-215448437 AAGAATAAAGAGAATAAGAAAGG + Intergenic
945988967 2:216377583-216377605 GAGGAAGAAGAGGAGGAGGAGGG + Intergenic
946004067 2:216507926-216507948 GCAGATAAGGAGAATGAGGCTGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946142887 2:217706587-217706609 GAGGAGAAAGGGGAGGAGGAAGG + Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946492232 2:220159969-220159991 GAGGAAAAAGAGGAGTAGGAGGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946832654 2:223741839-223741861 GAGGAAAGAGAGGAGGAGGAAGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946879742 2:224164749-224164771 GAGGAAAGAGAGTATGAGCATGG - Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947038186 2:225884259-225884281 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947602221 2:231460668-231460690 GAGGAAGAAGAGGAGGAGGAAGG - Exonic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947836460 2:233179486-233179508 GAGGCTTTAGAGAAAGAGGAGGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948541505 2:238694224-238694246 GAGGAGAAAGAGGAAGAGGGAGG + Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948618374 2:239216405-239216427 GAGGAGGAAGACGATGAGGAGGG + Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
949077292 2:242069024-242069046 GAGAATGAAGTGAAAGAGGAGGG - Intergenic
1168798352 20:627411-627433 GAGGATGTGGTGAATGAGGATGG + Intergenic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169832727 20:9841749-9841771 GAAGGTAAAGAGAATGAGCTGGG - Intergenic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171354544 20:24534055-24534077 GGGGAGCAAGAGAAAGAGGAGGG + Intronic
1171823017 20:29872890-29872912 GAAGATATAGAGAAAGAGGCAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172415433 20:34763199-34763221 GAAGATAAAGAAATTGAGGAGGG - Intronic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172694153 20:36810122-36810144 GGGGACACAGATAATGAGGAGGG + Intronic
1172832592 20:37848751-37848773 GAGGACAGAGAGGATCAGGAAGG - Intronic
1172928629 20:38564869-38564891 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1173772793 20:45678005-45678027 GAGAAAAAAAAGAATGAAGAAGG - Intergenic
1173891017 20:46510415-46510437 GAGGAAAAGGAGAATTAAGATGG + Intronic
1174056774 20:47803551-47803573 GAGGAATAAGAGAAAGAGAAGGG + Intergenic
1174287543 20:49483510-49483532 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1174371910 20:50096136-50096158 GAAGACGAAGACAATGAGGATGG - Intronic
1174508963 20:51036693-51036715 GGAGATAAAGAAAATGGGGATGG - Intergenic
1174523045 20:51147503-51147525 GAGGAGCAAGAGGAAGAGGAGGG + Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175038571 20:56023698-56023720 GAGGGTGAAGAGGGTGAGGAGGG + Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175717139 20:61262766-61262788 GAGGAGAGAGGGAAGGAGGAAGG - Intronic
1175929702 20:62487874-62487896 GAAGAGAAAGAGCAAGAGGAAGG - Intergenic
1176037885 20:63049218-63049240 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1176037907 20:63049294-63049316 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1177060264 21:16364485-16364507 GAGGAGAAAGAGGAGAAGGAAGG - Intergenic
1178139640 21:29668311-29668333 AGGGATATAGAGAATGAGAAGGG + Intronic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178467714 21:32863727-32863749 GAAGAGGAAGAGAATGAGGGAGG + Intergenic
1179048694 21:37870034-37870056 GAGGATGAAGGGAAGGAGAAAGG + Intronic
1179122957 21:38565723-38565745 GAGAAGCAAGAGACTGAGGAAGG - Intronic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179425557 21:41275509-41275531 GACGATTAAGACAAGGAGGATGG - Exonic
1179488590 21:41726512-41726534 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1180178425 21:46103887-46103909 GAGGAAAAAGAGAAAAATGAAGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181711845 22:24696136-24696158 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1181877153 22:25948547-25948569 GAAGAAAAAGAGAAAGAGAAAGG - Intronic
1182816279 22:33166836-33166858 GAAGCAAAAGAGAATGAGAAAGG + Intronic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183468545 22:37993047-37993069 GAGGATTAAGAGAGTGGGGAAGG + Intronic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183627554 22:39014028-39014050 GAAGAGAAAGAGAAAGAGAAAGG - Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184380816 22:44143878-44143900 GAGGGGGAAGAGAGTGAGGAAGG - Intronic
1184449712 22:44575756-44575778 GAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1184449764 22:44575977-44575999 GGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184877583 22:47285260-47285282 GAGGAAAAAGAGGAGCAGGAGGG - Intergenic
1185003429 22:48261062-48261084 GATGATAACGAGGAAGAGGATGG - Intergenic
949103082 3:169403-169425 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949323686 3:2840362-2840384 GAGGAGAAAGAGGAGGAGAAGGG - Intronic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949613776 3:5731131-5731153 GAGGTTAAAGGGAATGAACAAGG - Intergenic
949879707 3:8651797-8651819 GGGGAGAAAGAGAATTAGGGTGG - Intronic
949977549 3:9474848-9474870 AAGGATGAAGAGAAAGAAGACGG + Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950320379 3:12046953-12046975 GACAATAAAGAGAATGATTATGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950413207 3:12852597-12852619 GAGGAAGAAGGGAATGAGGTGGG + Intronic
950582024 3:13868638-13868660 GAGGAGAAAGAAAAAAAGGAGGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950862849 3:16165451-16165473 GAGGTGAGAGAGAATGAAGAAGG - Intergenic
950927612 3:16758527-16758549 GAAGATAAAGAGATAGGGGAGGG - Intergenic
951141238 3:19163748-19163770 GAGGAAGAAGAGGAAGAGGAGGG - Intronic
951416621 3:22431796-22431818 GAGCATGATGAGAAAGAGGAAGG + Intergenic
951584250 3:24198916-24198938 GAGGATAGAGTGGATGAGAAAGG + Intronic
951705599 3:25541243-25541265 GAGGCTGAAGAGGATGAGGAGGG - Intronic
951800519 3:26590631-26590653 CAGGAAAAAGAGAAAGAGAAGGG - Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952388167 3:32858075-32858097 GAGGAGGAAGAGAGAGAGGAGGG + Intronic
952500171 3:33954276-33954298 GAGGAGAAAGAGATTGGGGCAGG + Intergenic
952633439 3:35498104-35498126 GAAGAAAAAGAGAAAGAGAAAGG - Intergenic
953405800 3:42659217-42659239 GAGGAAGAAGAGGAAGAGGAAGG + Exonic
953405820 3:42659295-42659317 GAGGAAGAAGAGGAGGAGGACGG + Exonic
953411040 3:42690672-42690694 GAGGAGCAAGAGAATGGGGAAGG + Intronic
953438217 3:42896658-42896680 CAGGATTAAGGGAATGAGGGGGG + Intronic
953457197 3:43052756-43052778 TAGGACAAAGAGGTTGAGGATGG - Intronic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
953702970 3:45210828-45210850 GAGGGTAAAGTGGATGGGGAGGG + Intergenic
953900992 3:46843983-46844005 GAGGATAAGGAGGATTTGGAAGG - Intergenic
953964748 3:47295553-47295575 GAGGAGAAAGAGAAAGGGAAAGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954479729 3:50787807-50787829 GAGGAGGAAGAGAGAGAGGAAGG - Intronic
954748114 3:52798490-52798512 GAGGAGAAAGGGGAGGAGGAGGG - Intronic
955307446 3:57848530-57848552 GAGGAAAAAGGGAAGGAAGAAGG - Intronic
955603541 3:60673993-60674015 GAGGATAGAGAGAATGAGGGAGG - Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955929929 3:64046390-64046412 GAGCATCAAGAGTATGTGGAGGG - Intergenic
955940987 3:64146958-64146980 GAGGAGGAAGAGGAAGAGGAAGG - Exonic
955945143 3:64186738-64186760 GCAGATAAATAGATTGAGGAAGG + Intronic
956205013 3:66746360-66746382 GTGGATAAAGATCATGAGAAAGG + Intergenic
956358298 3:68418099-68418121 GAGGCTCTAGAGAATGATGATGG + Intronic
956445629 3:69323042-69323064 AAGGAAAAAGACAATGAGGGAGG + Intronic
956705737 3:71997464-71997486 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
956733123 3:72214864-72214886 GAGGAGGAAGAGAAAGTGGATGG - Intergenic
956806556 3:72819608-72819630 GAGGAATAAGAGGAAGAGGAAGG + Intronic
956832460 3:73065120-73065142 GAGGATGAAGAGGAAGAAGAAGG + Exonic
956847927 3:73200979-73201001 CAGGCTGAAGGGAATGAGGAGGG - Intergenic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957341900 3:78910582-78910604 GTGGATAAAGAGGATTAGGATGG + Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957520342 3:81311215-81311237 GAGGAGGAAGAAAAGGAGGAAGG + Intergenic
957592589 3:82219652-82219674 CTGGATAAAGAAAATGTGGATGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958033254 3:88139770-88139792 GAGGAGGAAGAGGATGAAGAAGG + Exonic
958443453 3:94184779-94184801 GAGGCTCAAGAGAATGGGAAAGG + Intergenic
958849940 3:99312468-99312490 GAGGATATAGGGAGGGAGGAGGG + Intergenic
958929247 3:100191336-100191358 GAGGGTGAAGAGAGTGAGGGAGG - Intronic
958997967 3:100927619-100927641 TAGGAGGAAGAGAAAGAGGAAGG + Intronic
959165656 3:102774843-102774865 GAGGTTAAAGAGAATATGAAGGG + Intergenic
959241768 3:103806074-103806096 GAGGATTACAAGACTGAGGAGGG - Intergenic
959416444 3:106080987-106081009 GAGGATAGAGAGTGGGAGGAGGG - Intergenic
959430843 3:106252918-106252940 GAGGGTAAAGGGTGTGAGGAGGG + Intergenic
959445700 3:106436037-106436059 GAAGAAAAAAAGAAAGAGGAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959901299 3:111664508-111664530 GAGCATAAAGGGAAGGAGGAAGG + Intronic
960298833 3:115976777-115976799 GAGGAGAAAGAGAGTTAAGAGGG - Intronic
960324648 3:116280961-116280983 GAGGAGAAAGAGAAAGAAAAGGG + Intronic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
960979385 3:123208077-123208099 GAAGATAAAGAGAAGGAAAAAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961805355 3:129485473-129485495 GAGGAAGAAGGGAATGAGGTGGG + Intronic
962259855 3:133895499-133895521 GAGGAAAAAGCGAAGGAGCAGGG + Exonic
963054024 3:141169238-141169260 GAGGAAAAAGAGACAGAGAATGG - Intergenic
963200855 3:142584585-142584607 GAGGAGAGAGAAAATGAGAAAGG - Intergenic
963258935 3:143175091-143175113 CAGGATTAAGAGAACGAGCAGGG + Intergenic
963462752 3:145637819-145637841 GAGAATGATGAGAATGATGAAGG - Intergenic
963490807 3:145998115-145998137 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
963592834 3:147285427-147285449 GAGAAGAAAGAGGAAGAGGAGGG - Intergenic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964023647 3:152044983-152045005 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
964067076 3:152593330-152593352 GGAGAAAAAAAGAATGAGGAGGG + Intergenic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
964369806 3:155988117-155988139 GAAGATGAAGATAATGATGAAGG + Intergenic
964453945 3:156839994-156840016 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
964458667 3:156897047-156897069 GAGGATAGAGGGTAGGAGGAAGG + Intronic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965120380 3:164547004-164547026 GAGGAGAAAGAGAGCAAGGAGGG - Intergenic
965333596 3:167407738-167407760 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
965530579 3:169766535-169766557 GAGAATAAATTGAATGAGGAAGG - Intergenic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965617394 3:170608925-170608947 GAGGTGAAAGAGTAAGAGGAAGG - Intronic
965972673 3:174581524-174581546 GGGGATAAAAAGAATTGGGAAGG + Intronic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966547782 3:181170272-181170294 GAGGATAAAGAGAGAAATGAAGG - Intergenic
966598045 3:181745089-181745111 GAGGAGAAAGAAAAAAAGGAAGG - Intergenic
967344050 3:188433714-188433736 GAGGCCAGAGAGAAAGAGGAAGG + Intronic
967466412 3:189811193-189811215 GATGAGAAAGAGGATGAGAATGG + Intronic
967512426 3:190327053-190327075 GAGGAGAGAGAGAGAGAGGAAGG + Intronic
968227239 3:196980900-196980922 GAGGATGAAAAGAAATAGGAAGG + Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969145908 4:5123862-5123884 GAGGATGAGGAGATTGATGATGG - Intronic
969696813 4:8739705-8739727 GAGGCTCGAGACAATGAGGAGGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970105164 4:12574438-12574460 AAGGAAGAAGAGAGTGAGGAGGG + Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970331544 4:14990867-14990889 GAGAAATCAGAGAATGAGGATGG + Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970499377 4:16661778-16661800 GAGGAAAAAGAGAGTAAAGAAGG + Intronic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970737548 4:19192298-19192320 AAGGATAAAAAGAAAGTGGAAGG - Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
970807141 4:20050239-20050261 GAGGAAAAATAGGAAGAGGAGGG - Intergenic
971002693 4:22340360-22340382 GAGGAGAACGAGGAGGAGGAGGG + Intergenic
971133341 4:23838204-23838226 GAGGAGAAAGATAACGAAGAGGG - Intronic
971420247 4:26467875-26467897 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
971420659 4:26471110-26471132 GAGGAGAGAGAGAATTGGGAGGG + Intergenic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
971865661 4:32168258-32168280 GAAGAGAAAGAGGGTGAGGAGGG - Intergenic
972037289 4:34541634-34541656 TAGGATAAAAATACTGAGGAGGG + Intergenic
972540866 4:40038209-40038231 GAGAATAAAGGGTATGAGGGTGG + Intergenic
972578669 4:40375599-40375621 GAGGGGAAAGAGGATGAGTATGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972847300 4:43005143-43005165 CAGGAAAAAGAGAGTGAGGGGGG - Intronic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973101944 4:46283278-46283300 GAGGAAGAATAAAATGAGGAAGG - Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973542395 4:51947313-51947335 CAGGACCAAGAGAGTGAGGAGGG - Intergenic
973567602 4:52204003-52204025 GAGGATAAAGGGAAGAAGGAAGG - Intergenic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
973769748 4:54195504-54195526 GAAAAGAAAGAGAATGAAGAGGG + Intronic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974029690 4:56765078-56765100 GAGGATAAAGAGTCTGTGGTTGG + Intergenic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974743175 4:66034472-66034494 GAGGAGAAAGAGAGAGAGAAGGG + Intergenic
974877602 4:67717329-67717351 GAAGATGAAGAGCACGAGGAAGG + Intergenic
974958547 4:68672898-68672920 GAGGATAAAGGCAATGAGGGCGG - Intergenic
975159457 4:71109323-71109345 GAGGAAAAAGAGAAAAACGAAGG + Intergenic
975231484 4:71939399-71939421 GGGGAGATAGAGAAAGAGGAAGG - Intergenic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
975369309 4:73566750-73566772 GAGGATTAAGAGAACGAGATGGG - Intergenic
975651655 4:76599234-76599256 GTGGTTAAAGAGTAAGAGGAGGG + Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976361776 4:84187551-84187573 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
976517320 4:85983790-85983812 GTAGATTCAGAGAATGAGGAAGG - Intronic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
976786107 4:88823365-88823387 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977167878 4:93724133-93724155 GAGGAAAAAGTGAATCTGGATGG - Intronic
977257803 4:94758871-94758893 GAGGATGAAGGGACAGAGGAGGG - Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977323919 4:95550752-95550774 GAAGATGAAGAGAGTGAAGAAGG - Intergenic
978112594 4:104980109-104980131 GAGGATATAGAGAAAGAGACAGG + Intergenic
978693795 4:111550447-111550469 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
979033793 4:115685713-115685735 GAGGATAGAGAGTGTGAGGAAGG - Intergenic
979098396 4:116581402-116581424 GAGTAGAAAGAGAAAAAGGAAGG - Intergenic
979159577 4:117442694-117442716 GTGGATAAAGAAAATGTGGGGGG - Intergenic
979547314 4:121952181-121952203 GAAGAGAAAGAGAGTGGGGAGGG - Intergenic
979740809 4:124148298-124148320 GAAGAGAAAGAGAGGGAGGAAGG - Intergenic
979749652 4:124262994-124263016 GAAGGAAAAGAGAAAGAGGAGGG - Intergenic
979821640 4:125180743-125180765 GAAGAGAAAGAGAAAAAGGAAGG + Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980726764 4:136771814-136771836 GAGGGATAAGAGAATGAGTAGGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980945997 4:139320945-139320967 GAGGATAAAAAGAAGGTGGCTGG - Intronic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981093495 4:140756380-140756402 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
981182763 4:141765094-141765116 GAGGATGAAGGGCAGGAGGAGGG - Intergenic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981567529 4:146116268-146116290 GAGGATAAAGAGAAAGGGAGTGG + Intergenic
981735213 4:147942608-147942630 GAGAATAAAGAGGATAAGGAGGG - Intronic
981754095 4:148122566-148122588 GAGGAAGAAGGGAAAGAGGAAGG - Intronic
981855591 4:149287254-149287276 GAGGAAAAAGAGAATTATGCTGG + Intergenic
981955946 4:150474364-150474386 GAGTACAATGAAAATGAGGAAGG + Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982645829 4:158024341-158024363 GAAGAAGAAGAGAATGAGAAAGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983392608 4:167151768-167151790 AAGGATAAAGAGAAAAAGAAGGG + Intronic
983569076 4:169185203-169185225 GAGGATAAAATGAATGAACAAGG + Intronic
983640390 4:169939776-169939798 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983827822 4:172286409-172286431 GCAGATAAATAGGATGAGGAGGG + Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984406255 4:179334956-179334978 CAGGAGAAAGAGAATAATGATGG + Intergenic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
984521445 4:180806649-180806671 GAGAATAAAGATAATGACAAGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984761234 4:183364598-183364620 GAAGAGGAAGAGAAAGAGGATGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985507144 5:289409-289431 GAGGATGAAGAGGAAGAAGAAGG - Intronic
986346847 5:6843748-6843770 GAGGCTAAAAAGGAAGAGGACGG + Intergenic
986436750 5:7741647-7741669 GATGATGATGATAATGAGGATGG - Intronic
986641232 5:9873977-9873999 GAAGAAAAAGAGAGAGAGGAAGG + Intergenic
986796528 5:11218044-11218066 GAGGAAGAAGGGAAGGAGGAAGG - Intronic
986834332 5:11618048-11618070 GAGGAGGCAGAGAATGATGAAGG - Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987068204 5:14309840-14309862 GAGAAGAAAGGGAATAAGGAAGG - Intronic
987286547 5:16463640-16463662 GAGGAGGAAGAGGCTGAGGAAGG - Exonic
987432166 5:17848091-17848113 GAGGGAAAAGAGAGTGAGGCAGG + Intergenic
987731626 5:21780959-21780981 GAAAACAAAGAGAATGAGGATGG + Intronic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987747623 5:21996478-21996500 GAGGAAATTGAGAATCAGGAAGG + Intronic
987771507 5:22311363-22311385 GAACATAAAGATAATGAGTAAGG + Intronic
988031530 5:25769730-25769752 CAGGAGAAAGAGAGTGAGTAGGG + Intergenic
988164738 5:27572067-27572089 GAGAAGAAAGATAAAGAGGAGGG + Intergenic
988174960 5:27710953-27710975 GAGGATAAGGAGAGAGATGAGGG - Intergenic
988216287 5:28277770-28277792 GAAGAGAAAGAGAGAGAGGAAGG - Intergenic
988513921 5:31888985-31889007 GAGCATCAAGAAACTGAGGAAGG - Intronic
988597182 5:32605987-32606009 AAGGATAAAGAAAAATAGGATGG + Intergenic
988619429 5:32807695-32807717 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
988626333 5:32879199-32879221 GAGGATAAGGAGAAATAGGAAGG + Intergenic
988628885 5:32907758-32907780 GAGGATATGGAGAAACAGGAAGG - Intergenic
988629757 5:32916418-32916440 GTAGATTAACAGAATGAGGATGG + Intergenic
988710642 5:33770838-33770860 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
989016934 5:36947387-36947409 GGGGAGAAAGAGACAGAGGATGG - Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989134943 5:38144454-38144476 AAGGAAATAGAGAAAGAGGAAGG - Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989432488 5:41372057-41372079 GGGGGTAGAGAGAATAAGGATGG - Intronic
989548438 5:42702418-42702440 GTGGATAAAGAAAATGTGGTAGG - Intronic
989586036 5:43074479-43074501 GAGGAGAAAGACAATCAGGGTGG + Intronic
989605420 5:43239784-43239806 GAGGATAAAAAGAATAAGAGTGG - Intronic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
989814844 5:45723260-45723282 GAGGAGAAAGAAAATGAAAAGGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990339170 5:54805435-54805457 GAGGAGAGAGAGATAGAGGATGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990847326 5:60157486-60157508 GAAGATTTAGAGAATGAGGAGGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991669677 5:69035546-69035568 AAGGACAAAGAGATTGGGGAGGG + Intergenic
991767805 5:70006274-70006296 GAGGAAATTGAGAATCAGGAAGG + Intergenic
991847039 5:70881352-70881374 GAGGAAATTGAGAATCAGGAAGG + Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992466078 5:77006357-77006379 TAGGTGAAAGGGAATGAGGAGGG - Intergenic
992549470 5:77847195-77847217 GGGAGAAAAGAGAATGAGGATGG - Intronic
992684054 5:79181992-79182014 GAGGAAAGAGAGGCTGAGGAGGG - Intronic
992819000 5:80475490-80475512 GAGGATAAAGAAAAGTATGAAGG - Intronic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993164646 5:84336620-84336642 GAGGAGAAAGAGGTTGAAGAAGG + Intronic
993401786 5:87462333-87462355 GGTGATAAAGAGATTGATGATGG - Intergenic
993622588 5:90186285-90186307 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
993697088 5:91074318-91074340 GAGGGTAGAGGGAAAGAGGAGGG - Intronic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993850083 5:92997386-92997408 GATGATAAAGAGACTGAAGAAGG - Intergenic
993957047 5:94246997-94247019 GAAGATGAAGAGAATGAAGAAGG - Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994126607 5:96174119-96174141 GAAGATAAAGAATCTGAGGAAGG + Intergenic
994153633 5:96477792-96477814 GAGGATCAAGGGAATGAGAGAGG + Intergenic
994167778 5:96626040-96626062 GAGGATAAAGGGGAAGAGGGAGG - Intronic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994397799 5:99240504-99240526 GAGAATAAAGAGAACATGGATGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
994781810 5:104098575-104098597 GAGCAAAAAAAGGATGAGGACGG - Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
994903475 5:105805262-105805284 GAAGATAAATAGATTGAGGAAGG - Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995054369 5:107743071-107743093 GAGGACAGAAAGAATGAGAATGG + Intergenic
995283504 5:110360881-110360903 GTGCATAAAGAGTCTGAGGATGG - Intronic
995294074 5:110498276-110498298 AAGAATAAAGAAACTGAGGATGG + Intronic
995351743 5:111184857-111184879 GAGGATGAAGAGGATGAAGGAGG - Intergenic
995443050 5:112212856-112212878 CAGTCTAAAGAGAATGAGGGTGG - Intronic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995887077 5:116907474-116907496 GAGGATGGAGAGGATCAGGAAGG - Intergenic
995919956 5:117299826-117299848 GAAGAAAAAGAAAATGAGGTGGG + Intergenic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996497189 5:124172601-124172623 GAGTAGAAAGAGAAAGAGAATGG + Intergenic
997413546 5:133708110-133708132 GAAGAGAAAGAGAAGGGGGAGGG + Intergenic
997462888 5:134066765-134066787 GAGGAAAAGGAGAAAGAGAAGGG + Intergenic
997756274 5:136402485-136402507 GAGGTTACAGGGGATGAGGAGGG + Intergenic
997795690 5:136808608-136808630 GAGGATATAGAGATTCAGAAAGG - Intergenic
997804640 5:136905092-136905114 GAGGAGGAAGAGAAAGATGAAGG - Intergenic
997808920 5:136947574-136947596 TAGGATAAAGAAAATGTGGGGGG - Intergenic
997811872 5:136978667-136978689 GATGACAAAGAGGATGAGGTCGG - Exonic
998019742 5:138759467-138759489 GAGGAAAAAGAGAAAAATGAAGG + Intronic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998416455 5:141949738-141949760 GAGGAAACAGAGTAAGAGGAGGG - Intronic
998527429 5:142855627-142855649 GAAGATGAAGACACTGAGGATGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
999739940 5:154542396-154542418 GAGGAAGGAGGGAATGAGGAGGG - Intergenic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000292449 5:159883149-159883171 GGGGAAAAAGAGAAGGAGCAAGG - Intergenic
1000335833 5:160240731-160240753 GGGGAGAGAGAGAAAGAGGAAGG + Intergenic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1000593750 5:163189970-163189992 AAGGATAAAGAGAAAGGAGAAGG + Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001319558 5:170669028-170669050 GATGAGAAAGAGAAGCAGGAGGG - Intronic
1001332051 5:170769329-170769351 GAAGAGAAAGAGGCTGAGGAAGG + Intronic
1001736930 5:174013214-174013236 GAGGAAAGAGAGAGAGAGGAAGG - Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1001976684 5:176006145-176006167 GGGGGTAAAGAGAATGAGACAGG + Intronic
1003001398 6:2338009-2338031 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1003286264 6:4736397-4736419 GAGGATAGTGAAAATAAGGATGG + Intronic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1003411355 6:5865614-5865636 GAGGGTAATGAGAGTGGGGAAGG + Intergenic
1003477610 6:6498538-6498560 GAGGATAAAGGGGAGGAAGAGGG - Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004146343 6:13070466-13070488 GAGGGTAAAGAGGCTTAGGAGGG + Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004334271 6:14750070-14750092 GAGCAGGAAGAGCATGAGGAAGG - Intergenic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004633529 6:17444889-17444911 GAGAATGAAGGGAATGAGGCGGG - Intronic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005089200 6:22038549-22038571 GAAGAAAAAGACAAGGAGGAGGG - Intergenic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005451546 6:25977695-25977717 GAGGAGGAAGAGAAAGAGGTGGG + Intronic
1005495266 6:26382828-26382850 AAAGAAAAAGAGAATGAGAAAGG + Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006671595 6:35732688-35732710 ACTGGTAAAGAGAATGAGGAAGG + Intergenic
1007039379 6:38707603-38707625 GAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007236341 6:40393413-40393435 GAAGATGAAGGGAATGAGAAAGG + Intronic
1007273345 6:40655453-40655475 CAGGATTAAGAGAATTAGTAAGG + Intergenic
1007648327 6:43399807-43399829 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1007813975 6:44507062-44507084 GAGGATGATGAGGATGATGATGG + Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008077877 6:47164644-47164666 AAGGTTAAAGAGAATGGAGAAGG - Intergenic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008113269 6:47517131-47517153 CAGGAACAAGAGAAAGAGGAGGG - Intronic
1008362314 6:50635472-50635494 GAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008505149 6:52222979-52223001 GAGCAAGAAGAGAATGATGAGGG - Intergenic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009372211 6:62919646-62919668 GAGAATAGAAAGAATGAGGCAGG - Intergenic
1009547996 6:65046952-65046974 GAGGATAGAGAGAGTGGGGCAGG - Intronic
1009621950 6:66088779-66088801 GAAGAAAAAGAAAATAAGGAGGG + Intergenic
1009746183 6:67819500-67819522 GAGGAAAAAGAGAGAGAGGGAGG - Intergenic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010451820 6:76012573-76012595 GAGGCAAGAGAGACTGAGGAAGG + Intronic
1011309783 6:85969138-85969160 GAGGTTAAATAGAATAAGGATGG + Intergenic
1011996678 6:93598231-93598253 GAAGAAATAGAGAATGAGGCAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012266080 6:97144533-97144555 GAGGACAAAGAACATGAGAAAGG + Exonic
1012399922 6:98834651-98834673 GAGGAGAAAGAGAGCGAGGGCGG + Exonic
1012736769 6:102957543-102957565 GGGGAAAAAGAGGAAGAGGAGGG - Intergenic
1012905469 6:105059874-105059896 GAGAATAAAGAAAATGAAAAGGG - Intronic
1013036757 6:106392483-106392505 AAGGCAAAAGAGAATCAGGAAGG + Intergenic
1013311533 6:108899087-108899109 GAGGAAACAGAGACTCAGGAAGG + Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013670802 6:112400230-112400252 GTGGAATTAGAGAATGAGGAAGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013862353 6:114650953-114650975 TAGGACAAAGAGTGTGAGGATGG + Intergenic
1014147552 6:118015436-118015458 GAGGATAAAGGGTACAAGGAAGG - Intronic
1014318339 6:119894498-119894520 GAGGAGGAAGAGAAGGACGAAGG - Intergenic
1014374197 6:120651916-120651938 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014657745 6:124129256-124129278 GAGGAGAAAGGGAAGAAGGAAGG + Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1015076327 6:129162873-129162895 GAGAATGAAGAGAACTAGGAGGG + Intronic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015402149 6:132798712-132798734 GTGGATTAAGATAATGAGGCGGG - Intergenic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015608275 6:134984459-134984481 GAGGATACAGAGAATACAGAGGG + Intronic
1015655039 6:135508499-135508521 GAGGAAAAATTGAATAAGGAAGG + Intergenic
1015711990 6:136152058-136152080 GAGGAAGAAGAGGAAGAGGAGGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016129153 6:140443900-140443922 GAAGATAAAGGGAATGATAAGGG - Intergenic
1016138431 6:140576776-140576798 GAGAAAAAAGAGAGAGAGGATGG - Intergenic
1016173169 6:141044907-141044929 AAGGATAAAGAAAATGTGGTAGG - Intergenic
1016199625 6:141392837-141392859 GAAGAAAGAGAGAAGGAGGAAGG - Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016411018 6:143784781-143784803 GCGGCAAAAGAAAATGAGGAGGG + Intronic
1016544864 6:145209723-145209745 GAGGACACAGAGAATGGGCAGGG + Intergenic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016725343 6:147358827-147358849 GAAGAGAAAGAGAAAGAGGGAGG + Intronic
1018190349 6:161304838-161304860 GATGGTAAATGGAATGAGGAAGG + Intergenic
1018276664 6:162139511-162139533 CAGGGTAAAGAGAATCAGCATGG + Intronic
1018305739 6:162453310-162453332 AAGGAAAAAGAGAGAGAGGAGGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018592099 6:165438143-165438165 GAGGATGAAGTGTATGATGAAGG - Intronic
1018597229 6:165494439-165494461 GTGGATAAAGAAAATGTGGGGGG + Intronic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019212458 6:170417580-170417602 GAAGATACAGAAAAAGAGGATGG + Intergenic
1019517529 7:1446466-1446488 GAGGATAGAGAGGAGAAGGAAGG + Intronic
1019562626 7:1666045-1666067 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1019964136 7:4484941-4484963 GAGAAGAGAGAGAAAGAGGAGGG + Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020879829 7:13746218-13746240 GAGGATATAAAGGATGATGATGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021383243 7:19994654-19994676 GAGGATGAAGAGTTGGAGGAGGG - Intergenic
1021622452 7:22562230-22562252 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1021887337 7:25152690-25152712 GAAGAGAGAGAGAAAGAGGAAGG - Intronic
1022208746 7:28187747-28187769 GAGGATACTGAGAATCAGGATGG + Intergenic
1022323151 7:29305803-29305825 GAGGAGAAAGACGAGGAGGAAGG - Intronic
1022416691 7:30184349-30184371 GATGATGAAGATAATGATGATGG - Intergenic
1022464670 7:30645519-30645541 GAGGAAAAAGAAAACAAGGAAGG - Intergenic
1022658068 7:32339575-32339597 GAGGTTAAATAAGATGAGGACGG + Intergenic
1022935419 7:35170376-35170398 GAGGGTGAAGGGTATGAGGAGGG + Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023230119 7:38019090-38019112 GATAATAAAGATAATGAAGAAGG + Intronic
1023281750 7:38577769-38577791 GGAGAGAAAGAGAAGGAGGAAGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023427093 7:40049213-40049235 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1024168364 7:46758110-46758132 GAGGAGAAAGAAAGAGAGGAAGG + Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024407025 7:48993589-48993611 GAGGAAAGAGAGGATGTGGAAGG - Intergenic
1024639312 7:51316707-51316729 GCGGAAAAAGTGAATGAGGGCGG - Exonic
1024663903 7:51526857-51526879 GAGGATATGGAGAAAGGGGAAGG + Intergenic
1024728932 7:52233286-52233308 GAATAAAAAGAGAAAGAGGATGG + Intergenic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1025770600 7:64501664-64501686 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026200467 7:68210089-68210111 AAAGATAGAGAAAATGAGGAAGG - Intergenic
1026205742 7:68255669-68255691 GAGGAGAAAGAAAAGGAGAAAGG - Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026330471 7:69347915-69347937 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
1026360787 7:69599464-69599486 GAGGAGAAAGAAAAGGGGGAAGG - Exonic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026900936 7:74037133-74037155 GAGGATAAAAAGAAATAGGAAGG - Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027589920 7:80105690-80105712 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1027633780 7:80643577-80643599 GAGGATAAAGAGTGTCAGGCAGG + Intronic
1027664649 7:81030306-81030328 GAGAATAATGGGAATAAGGATGG - Intergenic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028378398 7:90172099-90172121 GAGGATATAGAGAATACGAAGGG - Intronic
1028636891 7:92998859-92998881 GAAGATAAAGATAAGCAGGAAGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028645504 7:93092307-93092329 GAGGATATAGAGAAAGAGATTGG - Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028887501 7:95950410-95950432 GAGGACAAAGTAAATGTGGATGG - Intronic
1028966467 7:96807204-96807226 GAGGAGAAAGTGAAGGGGGAAGG + Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029831377 7:103263145-103263167 GAGGGTGAAGGGTATGAGGAGGG + Intergenic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030148816 7:106382401-106382423 GAGGAGAAAGAGGAGGCGGAGGG + Intergenic
1030488231 7:110198725-110198747 GAAGATAAAGAGTAGAAGGAGGG - Intergenic
1030495336 7:110291625-110291647 GATGATAAAGATAATGGTGATGG - Intergenic
1030528123 7:110677990-110678012 GAGGATGAAGAAAATGATGCTGG - Intronic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030742976 7:113131610-113131632 TAGGGTAGAGACAATGAGGATGG + Intergenic
1030754805 7:113274177-113274199 CAGGAAAGAGAGAATGAGCAAGG + Intergenic
1030832694 7:114245213-114245235 GAGGAAAAAGAGAGCAAGGATGG - Intronic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031392362 7:121231433-121231455 GAGCTTAAGGAGAATGATGAAGG + Intronic
1031634321 7:124083330-124083352 GGGGAAAGAGAAAATGAGGATGG - Intergenic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031728397 7:125266083-125266105 GATGATAAAGAAAAGAAGGAAGG - Intergenic
1031894610 7:127334817-127334839 GAAGATGCAGAGAAAGAGGAAGG + Intergenic
1032309798 7:130774475-130774497 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1032341753 7:131080259-131080281 GAACATAGAGAGAAAGAGGAGGG + Intergenic
1032439760 7:131933401-131933423 GAGGAAAAAGAGGAAGAAGAAGG + Intergenic
1032466793 7:132151238-132151260 GAGGATGAAGAGGAAGAAGAAGG + Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032523492 7:132562900-132562922 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1032523622 7:132563428-132563450 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1032765075 7:134984003-134984025 GAGGAAGAAGAGGAAGAGGAAGG - Intergenic
1032931353 7:136676330-136676352 GTGGATAAAGAAAATGTGGAGGG - Intergenic
1033263628 7:139865738-139865760 GAGGAGGAAGAGGAGGAGGAAGG + Intronic
1033285244 7:140035840-140035862 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1033318616 7:140319206-140319228 GAGCAGAAAGAGAAACAGGATGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033619979 7:143053182-143053204 AAGGATAAAGGGATTGAGAAAGG - Exonic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1034014369 7:147566305-147566327 GAGGAGTAAGAGGAGGAGGAGGG + Intronic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034424207 7:151005955-151005977 GAGGTTACAGTGAATGATGATGG + Intronic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1035262494 7:157670936-157670958 GAGCAAAAAGAAAATTAGGAAGG - Intronic
1035834152 8:2730347-2730369 GAGGATAAAGAGAAAGAATGGGG + Intergenic
1036055689 8:5251478-5251500 GTGGTTAAAGCGAATGAGTAAGG - Intergenic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036651841 8:10649227-10649249 GTGGATGAGGAGAATGAAGAAGG - Intronic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1036904844 8:12699558-12699580 GAGGATAAAGACGATGATGACGG - Intergenic
1037201619 8:16260613-16260635 GATGATAATGAGGATGATGATGG + Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037213820 8:16424947-16424969 GAGGAAGAAGAGGAGGAGGAAGG - Intronic
1037231387 8:16662938-16662960 GGGGAAAAAGAGAATCATGAAGG + Intergenic
1037301919 8:17460942-17460964 GAGGATACAGGGAGTGAGGGGGG + Intergenic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1037702076 8:21284454-21284476 GAGGATGAAGAGGAAGAGCAGGG + Intergenic
1037707276 8:21325949-21325971 GAGGATAGAGGGAATGAGACAGG - Intergenic
1037786973 8:21909088-21909110 GTGGAAAAAGAGTAGGAGGAGGG + Exonic
1037929958 8:22873116-22873138 GAGTATAAAGAGAAAGGGGCTGG + Intronic
1038234321 8:25737198-25737220 GAAGAGGAAGAGAAAGAGGAGGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483687 8:27918965-27918987 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038898287 8:31812556-31812578 GAGGAGGAAGGGAAGGAGGAAGG - Intronic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1039230920 8:35447017-35447039 GAGGATAATGGCAATGATGATGG - Intronic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1040071962 8:43195738-43195760 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1040071969 8:43195764-43195786 GAGGAAGAAGAGGAGGAGGAGGG + Intronic
1040750602 8:50701693-50701715 GAAGATGAAGAGGAAGAGGAAGG - Intronic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041094682 8:54338136-54338158 GGTGAAGAAGAGAATGAGGAGGG - Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041279222 8:56194777-56194799 TAGGAGAAAGAGAATGGAGATGG + Intronic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041342753 8:56863399-56863421 GGGGAAAAAGAGAAGGGGGAGGG + Intergenic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041378092 8:57222762-57222784 GCAGATAAAGAGAATTAGGCTGG - Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042077370 8:65011050-65011072 GAGGAAAAAGAGAGAGAGGAAGG - Intergenic
1042082374 8:65069679-65069701 GAGGAGATAGAGAAAGAGGTAGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042655064 8:71086890-71086912 GAGGATCATGGGAATGAGAAAGG - Intergenic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043020693 8:74996450-74996472 GAGGTGATAGAGAATGAGGGAGG + Intronic
1043281474 8:78472228-78472250 GAGGATGTAGAGTAAGAGGAGGG + Intergenic
1043398861 8:79864470-79864492 GAGGAAAAAGAAAAGGAAGATGG - Intergenic
1043575870 8:81655585-81655607 GAGAAGAAAGAGACTAAGGAAGG + Intergenic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1045286977 8:100800314-100800336 GAGGATTAAGAGAAAGACTAGGG - Intergenic
1046031352 8:108787049-108787071 GAGGAAAAAGAGGGAGAGGACGG - Intronic
1046124306 8:109884944-109884966 CAGAATAAAGATAATGAAGAAGG - Intergenic
1046139859 8:110077491-110077513 GAGGATAATGAAGATGACGATGG + Intergenic
1046607020 8:116382568-116382590 GAGGAGAGAGGGAAAGAGGATGG - Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1047171409 8:122496625-122496647 GAGGATGAAGAATGTGAGGAGGG + Intergenic
1047561815 8:125994187-125994209 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1047629371 8:126690323-126690345 GACAATAATGATAATGAGGATGG + Intergenic
1047641201 8:126823607-126823629 GCAGAGAAAGAGAAAGAGGAGGG + Intergenic
1047823748 8:128550682-128550704 GGGGAAAAAGAAAAAGAGGATGG + Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1047979418 8:130164993-130165015 GATGATAAACAGCATGAGAAAGG + Intronic
1048188682 8:132267864-132267886 GAGGATATTGAGAATGGGGGAGG - Intronic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1048331845 8:133475965-133475987 GAAGATGAAGAGCACGAGGAAGG + Exonic
1048602556 8:135933461-135933483 AGGGATAAAGAGAATGAGTTTGG + Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049936702 9:506343-506365 GAGGTTAAAATGAATAAGGATGG + Intronic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050646241 9:7722784-7722806 GAGGATAAAGGGTGGGAGGAGGG - Intergenic
1050839584 9:10131131-10131153 AGGAATAAAGAGAGTGAGGATGG + Intronic
1051017270 9:12494006-12494028 TAGTATAAAGAAAATGAAGAGGG - Intergenic
1051158927 9:14183777-14183799 GAGGTGGAAGAGAATGAGGGAGG - Intronic
1051188985 9:14491357-14491379 GAGGATAAATAGGATGAATAAGG + Intergenic
1051895861 9:21988603-21988625 GAGGAGAAAGGGAATGAGCGAGG + Intronic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052050532 9:23842763-23842785 GAGGCCATAGAGAATGAGAAGGG - Intergenic
1052854071 9:33396134-33396156 GAGGATAAAGAGGAAGAAGAGGG + Intronic
1053037821 9:34840508-34840530 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1053076993 9:35141660-35141682 GGGGATCGAGAGAAGGAGGATGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053580533 9:39399419-39399441 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1053606677 9:39666978-39667000 GAGAATGAAATGAATGAGGAGGG + Intergenic
1053682085 9:40492298-40492320 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1053845029 9:42227497-42227519 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1053932072 9:43120624-43120646 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054102120 9:60958224-60958246 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1054246858 9:62675426-62675448 GAGAATGAAATGAATGAGGAGGG - Intergenic
1054281628 9:63132634-63132656 GAGGATAAAGAGGAAGAAGAGGG - Intergenic
1054295182 9:63327795-63327817 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054393202 9:64632301-64632323 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054427851 9:65137511-65137533 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054502525 9:65884027-65884049 GAGGATAAAGAGGAAGAAGAGGG - Intronic
1054560979 9:66709960-66709982 GAGAATGAAATGAATGAGGAGGG - Intergenic
1054584239 9:66948639-66948661 GAGGAAGAAGGGAAAGAGGAAGG + Intergenic
1054756101 9:68959612-68959634 GAGAATAGAGAGGATGAGAAGGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055151930 9:73011048-73011070 GAGGAGAAAGACAAGAAGGAAGG - Intronic
1055218458 9:73897231-73897253 GAGGATGAGGAGAATTAGGAAGG - Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055492629 9:76821351-76821373 GAGGTTAATGGGAATGAGAAAGG + Intronic
1056066650 9:82942408-82942430 GAGGAGAAAGAGGATGGGAAGGG + Intergenic
1056130137 9:83576584-83576606 GAGGATAAAGGGTTGGAGGAGGG - Intergenic
1056238540 9:84620254-84620276 GTGGATGAAGATGATGAGGATGG + Intergenic
1056528448 9:87465871-87465893 GAGGAAAGAGAGAATTGGGAGGG - Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056637169 9:88340772-88340794 AAGGAAAAAGAGAAAGAGAAGGG - Intergenic
1056652637 9:88481105-88481127 GAAAATAATGAGAAAGAGGATGG - Intergenic
1056724729 9:89104734-89104756 GAGGATAGATAAACTGAGGAAGG - Intronic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057775198 9:98002174-98002196 GTGGTTAATGAGGATGAGGATGG - Intronic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058165333 9:101612386-101612408 GAGGAAAAATAGATTTAGGAGGG + Intronic
1058268785 9:102942495-102942517 GAGGATAAATTGAATGATTAAGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058969470 9:110067052-110067074 GGGAAGATAGAGAATGAGGAAGG + Intronic
1059017789 9:110540148-110540170 GATGATAATGATAATGATGATGG - Intronic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059283847 9:113156290-113156312 GAGGAAAATGAGTATGAAGAGGG - Intronic
1059550621 9:115225359-115225381 GGGGATAGGGAGGATGAGGAAGG + Intronic
1059582464 9:115566695-115566717 AAGGAAAAAGAGAGAGAGGAAGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059788450 9:117612962-117612984 GAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1059940366 9:119353305-119353327 AAGGATAAAGAGGAAAAGGAGGG - Intronic
1059965980 9:119614226-119614248 TCAGATACAGAGAATGAGGAGGG + Intergenic
1059997196 9:119923212-119923234 TAGTATCATGAGAATGAGGATGG + Intergenic
1060199467 9:121644200-121644222 GAGGAAGAAGAGGAAGAGGAAGG + Intronic
1060563023 9:124562930-124562952 GAGGATAAAGAGATTTATAAAGG + Intronic
1061348573 9:130045504-130045526 GAGGAGAAAGAGGAAGAGGAAGG + Intergenic
1061360445 9:130138514-130138536 GAGGAGAAAGAGGTGGAGGAGGG - Exonic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062744648 9:138203574-138203596 GACAAGGAAGAGAATGAGGAGGG + Intergenic
1185499183 X:584483-584505 GAGGAAAAAGGGGAGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185569083 X:1119052-1119074 GAGGAGAGAGAGAGAGAGGAGGG - Intergenic
1185635988 X:1552404-1552426 GAGGAGAGAGAGAATGAAAAAGG + Intergenic
1185661931 X:1735208-1735230 GAGGATGAAGGGGAGGAGGAAGG - Intergenic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185662062 X:1735677-1735699 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185662065 X:1735692-1735714 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186060887 X:5705714-5705736 GAGGAAGAAGAGAGAGAGGAAGG - Intergenic
1186075013 X:5868818-5868840 GAAGAGAAAGAGGAAGAGGAGGG + Intronic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186206328 X:7204657-7204679 GAGGAAAAAAGGAAGGAGGAAGG - Intergenic
1186239805 X:7554136-7554158 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186612427 X:11151119-11151141 GAGGAAATAGGGAATGAGAATGG - Intronic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187158858 X:16745829-16745851 AAGGACAAAGAGAATGAGAGAGG - Intronic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187561819 X:20410606-20410628 GAGGAAAGAGAGAATGAGGGAGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187634537 X:21212066-21212088 GGGGAAAGAGAGAGTGAGGAGGG - Intergenic
1187859858 X:23670819-23670841 GAGGCTACACAAAATGAGGAGGG - Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188153306 X:26707175-26707197 CAGTATAAAAAGTATGAGGAAGG + Intergenic
1188543708 X:31278372-31278394 GAGGATTAAAAGATTCAGGAGGG + Intronic
1188636443 X:32437465-32437487 GAGAAAAAAGAGAATAAGGGGGG - Intronic
1188919440 X:35954311-35954333 GAGAAAATAGAGAATTAGGAAGG + Intronic
1189056671 X:37706533-37706555 GCAGATAAAGAGATTGAGGTTGG + Intronic
1189289084 X:39872693-39872715 GAGGAGAAAGAGAAGAAGAAGGG - Intergenic
1189602195 X:42639191-42639213 GAGGAGAAAGAGGAAGAGGAAGG - Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1190287859 X:48972400-48972422 GAGGGTAAAGGGAATGTAGAGGG + Intergenic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1190780728 X:53592444-53592466 GAGGATACAGGGCAAGAGGAAGG - Exonic
1190896177 X:54620313-54620335 GGGGATAGAGAGTATAAGGATGG - Intergenic
1191894515 X:65977664-65977686 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
1191896688 X:66000299-66000321 GAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1192072130 X:67952246-67952268 TAGGAAAAAGAGTTTGAGGATGG - Intergenic
1192106008 X:68317648-68317670 GAAGAAGAAGAGAAGGAGGAAGG + Intronic
1192143956 X:68668213-68668235 GAGAAAAAAGAGAAAGAAGAAGG - Intronic
1192145333 X:68678362-68678384 GAGTAAAAAGGGAAGGAGGAAGG + Intronic
1192184490 X:68937586-68937608 GATGATGAAGGGAATGATGATGG + Intergenic
1192268238 X:69555318-69555340 GGGGATATAGAGAATGTGGCTGG + Intergenic
1192503005 X:71665512-71665534 GAGGATGAAGAGGGAGAGGAGGG + Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1192786383 X:74340176-74340198 GAGGAAAAAGAGAAAAATGAAGG + Intergenic
1193106592 X:77682002-77682024 GAGGATAAAAAGAGTAAGAATGG - Exonic
1193214949 X:78853007-78853029 TGGGATAAAGAGTATGAAGAGGG + Intergenic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193407104 X:81114857-81114879 GATGGAAAAGAGAATGAAGATGG - Exonic
1194235651 X:91380573-91380595 CAGGATAAAGACAATCAGGCAGG - Intergenic
1194400195 X:93432240-93432262 GAGGATCCAGACAAGGAGGAAGG + Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194984778 X:100478530-100478552 AAGGATAAAGAGGCTGGGGAGGG - Intergenic
1195109911 X:101637689-101637711 GAGTCTAGAGAGAATGAGGAAGG - Intergenic
1195449960 X:105000044-105000066 GAGGAAAAAGAAGTTGAGGAAGG - Intronic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195465216 X:105172231-105172253 GAGGAGAAAGGGAAGGAGGTTGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196122854 X:112069057-112069079 GAGGATGATGAGGATGAGGATGG + Intronic
1196517974 X:116635951-116635973 GGAGATAAAGAGAAGAAGGATGG + Intergenic
1196659843 X:118258342-118258364 GAGGAAAAAGGGAAAGATGAAGG + Intergenic
1196904271 X:120416672-120416694 GAGGTTAAGGAGAATGGAGAGGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197492161 X:127130556-127130578 GAGGAGATAGAGAAAGAGAAAGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199074389 X:143512234-143512256 GTGGATAATGAGGATGAGTAGGG - Intronic
1199214943 X:145252665-145252687 GTGGATAATGAGGATGAGTAGGG + Intronic
1199471466 X:148200113-148200135 GAGGAGAAAGAGTTTGGGGAAGG - Intergenic
1199498918 X:148487643-148487665 GAGGATGAAGAGGAAGAGGAGGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199896898 X:152135442-152135464 GAGGAGGAAGAGGAGGAGGAGGG + Exonic
1200336813 X:155359718-155359740 GAGGATAGAGGGTGTGAGGAGGG + Intergenic
1200349657 X:155481509-155481531 GAGGATAGAGGGTGTGAGGAGGG - Intergenic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1202304258 Y:23451580-23451602 GAGTATACAGAGGAGGAGGATGG + Intergenic
1202566552 Y:26219011-26219033 GAGTATACAGAGGAGGAGGATGG - Intergenic