ID: 917886139

View in Genome Browser
Species Human (GRCh38)
Location 1:179386974-179386996
Sequence TCATCTCTAGAAGGTCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 841
Summary {0: 2, 1: 1, 2: 29, 3: 137, 4: 672}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917886137_917886139 16 Left 917886137 1:179386935-179386957 CCTATCTAGTATATATTTTCATC 0: 1
1: 0
2: 0
3: 37
4: 341
Right 917886139 1:179386974-179386996 TCATCTCTAGAAGGTCAGTTTGG 0: 2
1: 1
2: 29
3: 137
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917886139 Original CRISPR TCATCTCTAGAAGGTCAGTT TGG Intronic
900356167 1:2265433-2265455 TCATCTCTAGAAGTTTGATTTGG + Intronic
900921621 1:5675411-5675433 TCATCTCTAGAAGTTCAGGCTGG + Intergenic
900961476 1:5924052-5924074 TCATCTCTAGAAGTTCGTCTGGG - Intronic
901255752 1:7825054-7825076 TAATCTCAGGAAGGTAAGTTTGG + Intronic
901926115 1:12567272-12567294 GCATCTCTACTAGGTCATTTTGG + Intergenic
902751729 1:18518696-18518718 TCATTTTTAGAAAGTCATTTGGG - Intergenic
902940101 1:19794742-19794764 TCATCTGTAGATGGGCATTTGGG - Intronic
904311306 1:29631399-29631421 TCACCTCCAGAAGGGCAGGTAGG + Intergenic
904392923 1:30197600-30197622 TCACCTCCAGAAGGGCAGGTAGG + Intergenic
904471292 1:30737999-30738021 TCTTCTCTACAAGATCATTTTGG + Intronic
905347467 1:37320750-37320772 TCATCTCTTGATGGGCACTTAGG - Intergenic
906137558 1:43510193-43510215 TCATCTCCAGAAGGGCGGGTTGG + Intergenic
906527169 1:46500851-46500873 TCCTCTCTCGATGGACAGTTAGG + Intergenic
906586299 1:46982185-46982207 TCAGCTCTATTAGCTCAGTTTGG + Intergenic
906762510 1:48388658-48388680 TCATCTCCAGAATTTCTGTTTGG - Intronic
906980043 1:50620397-50620419 GCAGCTCTAGAAATTCAGTTTGG + Intronic
908033229 1:60023955-60023977 TTATCTCTAGAAGTTCTATTTGG + Intronic
908387543 1:63656535-63656557 TCATCTGTAGATGGGCACTTAGG - Intronic
908507786 1:64822781-64822803 TCATCACTAGATGGACATTTGGG - Intronic
908777779 1:67657948-67657970 TAATCTCTAGAAGTTCCATTTGG + Intergenic
909067888 1:70958093-70958115 TCATCTGTAGATGGTCATCTAGG + Intronic
909231813 1:73100869-73100891 TCAGTTCTAGAAGTTTAGTTTGG - Intergenic
909467066 1:75984500-75984522 TCAGCTCTATCAGATCAGTTTGG + Intergenic
909705526 1:78579169-78579191 TCATCTGTTGAGGGACAGTTGGG + Intergenic
909818983 1:80034642-80034664 TCATCTCTTGATGGACATTTGGG + Intergenic
910164232 1:84307362-84307384 TCATCTCTAGCAGTTCAATGTGG + Intronic
910202863 1:84717691-84717713 TCATCTGTAGATGGACACTTAGG - Intergenic
910373822 1:86547857-86547879 TCATCTCTTGATGGACACTTAGG + Intronic
910820466 1:91339449-91339471 TCAGCTCTATCAGATCAGTTTGG - Intronic
911375083 1:97042788-97042810 TCAGCTCTAACAGGTCAGTTTGG + Intergenic
911438685 1:97897684-97897706 CCATCTTTAGAAGTTCAATTTGG + Intronic
911479836 1:98424259-98424281 TCTTCTCTTGAAGGTGAGTGAGG - Intergenic
911487898 1:98525647-98525669 TCATCTCTAGATGGTTACTGTGG + Intergenic
911639500 1:100272064-100272086 TCATCTATTGAAGGGCATTTGGG + Intronic
911717201 1:101146870-101146892 TCATCTGTTGAAGGACATTTGGG - Intergenic
911835642 1:102615286-102615308 TCATTTCTACAAGTTCAATTTGG - Intergenic
911877400 1:103185564-103185586 TCAGCTCTATTAGGTCAGTTAGG - Intergenic
911937424 1:103996088-103996110 TCATCTGTAGATGGGCATTTTGG - Intergenic
912614492 1:111084643-111084665 TCAGCTCTATCAGATCAGTTTGG + Intergenic
913040858 1:115021557-115021579 TAATCTCTAGAAGTTCCATTTGG + Intergenic
913106755 1:115621831-115621853 TCATCTCTAGAAGCTCAACTTGG + Intergenic
913315969 1:117552144-117552166 TCATCTGTAGATGGACACTTAGG + Intergenic
913456842 1:119041297-119041319 TTATCTCTAGAAGGCCAAATGGG + Intronic
914796221 1:150922814-150922836 TCATCTCTGGAAGGTATGGTGGG - Intergenic
914983416 1:152436269-152436291 TCATCTGTAGATGGACACTTAGG + Intergenic
915695588 1:157738572-157738594 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
915817587 1:158985991-158986013 TCAGCTCTAGTAGGTTAGTTTGG + Intergenic
916245186 1:162680679-162680701 TCATCTTTAGAATGGCATTTAGG + Intronic
916268499 1:162916845-162916867 TCAGCTCTATCAGATCAGTTTGG + Intergenic
916301722 1:163282881-163282903 TCATCTGTAGATGGTCATTTAGG - Intronic
916544479 1:165789733-165789755 TCATTTCTAGGAGTTCAGTTTGG + Intronic
916633756 1:166645377-166645399 TCATCTCTTGATGGACATTTAGG - Intergenic
916663146 1:166941063-166941085 TCAACTCTACAAGGCCAGTGTGG + Intronic
917022027 1:170600217-170600239 TCATCTTTAGAAGTTTAATTTGG + Intergenic
917055456 1:170977076-170977098 TCAGCTCTATCAGGCCAGTTAGG + Intronic
917886139 1:179386974-179386996 TCATCTCTAGAAGGTCAGTTTGG + Intronic
918153770 1:181822991-181823013 TCATCTCTAGTAGCTCAATTTGG - Intergenic
918200330 1:182260304-182260326 TAATCTCTTGAGTGTCAGTTTGG - Intergenic
918508478 1:185283880-185283902 TCATCTCTTGATGGACATTTGGG + Intronic
918515755 1:185360626-185360648 TCATTTCCAGAACTTCAGTTTGG - Intergenic
918664186 1:187128577-187128599 TCATCTGTTGAAGGACACTTGGG - Intergenic
918769754 1:188541509-188541531 CCATCTCTAGAAGTTTATTTTGG - Intergenic
918867351 1:189920112-189920134 TCATTTCTGGAAGTTCTGTTTGG + Intergenic
918934280 1:190899862-190899884 TCATCTGTAGGATGTCATTTGGG - Intergenic
919128270 1:193423314-193423336 TCCTCTCTAGAACAGCAGTTAGG + Intergenic
919251944 1:195067273-195067295 TCATCTGTTGATGGTCACTTAGG - Intergenic
920790825 1:209089165-209089187 GCATCTCCAGAAGTTCTGTTTGG - Intergenic
920898094 1:210077483-210077505 TCATCACTTGATGGTCACTTGGG + Intronic
921014254 1:211173145-211173167 TCATCTCTAGAAGTTTGGGTTGG + Intergenic
921126870 1:212185665-212185687 TCATCTCTAGGAGTTTCGTTTGG - Intergenic
921830891 1:219726114-219726136 TCATCTCTAGGATTTCTGTTTGG - Intronic
922401024 1:225255891-225255913 TCATTTCTAGAAGGTCTACTTGG - Intronic
922667500 1:227485122-227485144 TCATCTATAGATGGACATTTTGG - Intergenic
923100705 1:230814207-230814229 TCATCTCTAGAAGTTCAATTTGG + Intergenic
923160372 1:231309615-231309637 TTATCTCAATAATGTCAGTTTGG - Intergenic
923192067 1:231628683-231628705 TCCACTCTATAAGTTCAGTTTGG - Intronic
924003323 1:239578154-239578176 GTCTCTATAGAAGGTCAGTTAGG + Intronic
924244186 1:242065693-242065715 TCATCTGTAGATGGACATTTGGG + Intergenic
924304648 1:242674713-242674735 TCTTCTCTAGATAGTCACTTGGG - Intergenic
1063657336 10:8005060-8005082 TAATTTCTAGAAGGTCTGTTTGG + Intronic
1063859920 10:10295829-10295851 TCAGCACTAGAAGCTCTGTTTGG - Intergenic
1064190964 10:13205424-13205446 TCATCTCTTGATGGGCATTTAGG + Intronic
1064219369 10:13427400-13427422 TCATCTCTTGATGGGCACTTAGG - Intergenic
1064235832 10:13574224-13574246 TCATCTCTAGAGGTTCCATTTGG + Intergenic
1065163536 10:22949428-22949450 TCATCTCTAGAAGTTGTATTTGG - Intronic
1066153435 10:32649850-32649872 TCAGCTCAGGAAGTTCAGTTTGG + Intronic
1066649569 10:37641801-37641823 TCATCTGTTGATGGTCACTTAGG + Intergenic
1067052791 10:43032678-43032700 TCAGCTCTAGAATTTCTGTTTGG - Intergenic
1067493984 10:46745834-46745856 TCAGTTCCAGAAGTTCAGTTTGG + Intergenic
1067600678 10:47594570-47594592 TCAGTTCCAGAAGTTCAGTTTGG - Intergenic
1067975702 10:51022604-51022626 TCATCTCAAGCAGCTCACTTGGG - Intronic
1067999011 10:51309842-51309864 TCATCTGTAGATGAACAGTTAGG - Intronic
1068238109 10:54264566-54264588 TCAGTTCCAGAAGTTCAGTTTGG - Intronic
1068378175 10:56212291-56212313 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1068479040 10:57565363-57565385 TCATCTATTGATGGACAGTTAGG + Intergenic
1068564467 10:58557684-58557706 TCATCTTGAGAAGTTTAGTTGGG + Intronic
1068867548 10:61910569-61910591 TCATCTCCAGCAAGTCAGTGAGG - Intronic
1069336681 10:67359536-67359558 TCAATTCTATAAGTTCAGTTTGG - Intronic
1069356871 10:67597099-67597121 TCAGCTCTATCAGATCAGTTTGG + Intronic
1070062607 10:72999174-72999196 TCATCTGTAGATGGACACTTGGG + Intergenic
1070446152 10:76505598-76505620 TCAATTCCAGAAGTTCAGTTTGG + Intronic
1071048486 10:81415311-81415333 TCATCTGTAGACGGGCATTTAGG + Intergenic
1071230272 10:83578618-83578640 TTAGCTCTAGAAGTTCAGTTTGG + Intergenic
1071595697 10:86922296-86922318 TCATCTGTTGATGGTCACTTAGG + Intronic
1072041373 10:91610132-91610154 TCATCTATTGATGGTCACTTAGG + Intergenic
1072050179 10:91696294-91696316 TCATCTGTAGATGGGCATTTAGG - Intergenic
1072078383 10:92002086-92002108 TCATCTCTAGAAGTTCAATTTGG - Intronic
1072395097 10:95031251-95031273 TAATTTCTAGAAGTTCTGTTTGG + Intergenic
1072831755 10:98665099-98665121 TCAATTCTAGAAGTTAAGTTTGG - Intronic
1072839401 10:98754160-98754182 TCAACTCTATCAGATCAGTTTGG - Intronic
1072848987 10:98866185-98866207 TCATCTCTAGAAATTCAATTTGG - Intronic
1072864551 10:99043672-99043694 TCAGCTCTAGAAGTTCAGTTTGG - Intronic
1073316770 10:102587096-102587118 TCATCTCTTGATGGACATTTGGG + Intronic
1073381311 10:103079996-103080018 TCATCTCTACAAAGCCAGTGGGG + Exonic
1073899434 10:108203171-108203193 TCATTTCCAGAAGTTCAGTTTGG + Intergenic
1074691868 10:116013351-116013373 TCATCTCTAGAAGCTTAGTTTGG + Intergenic
1074748846 10:116563729-116563751 TCATCTCTAGAAACTCAGTGTGG - Intronic
1075387601 10:122068154-122068176 TCATCTCTAGAAGTTTGATTTGG + Intronic
1075621841 10:123933932-123933954 TCATCTCTTGTTGGTCAGATTGG + Intronic
1075708190 10:124515325-124515347 TCATCTCTAGAAGCTTGGTTTGG + Intronic
1075828646 10:125384115-125384137 TCATTTTCAGAAGTTCAGTTTGG + Intergenic
1077792822 11:5460426-5460448 TTATTTCTAGAAGTTCAGTTTGG + Intronic
1077852169 11:6084088-6084110 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
1077938086 11:6811941-6811963 TCATTTCCAGAAGTTCTGTTTGG + Intergenic
1077984695 11:7340197-7340219 GCAGCTCTATCAGGTCAGTTAGG + Intronic
1078037188 11:7819301-7819323 TCATCTGTTGATGGACAGTTAGG - Intergenic
1078072259 11:8123051-8123073 TCATCTCTAGAAGTTTCATTTGG - Intronic
1078574647 11:12489311-12489333 TCATTTCTAGAAGTTCTATTTGG - Intronic
1078816203 11:14824445-14824467 TCAGCTCTATCAGATCAGTTAGG - Intronic
1079747989 11:24156717-24156739 TTAACTCTAGAAGATCAGTTTGG - Intergenic
1079814447 11:25038484-25038506 TCAGCTCAAGAAGCTCAGTTTGG + Intronic
1079921102 11:26435727-26435749 TCAGCTCTATTAGATCAGTTAGG + Intronic
1080172560 11:29322977-29322999 TCATCTCTTGATGGACACTTAGG - Intergenic
1080422924 11:32127534-32127556 TCAATTCTAGAAATTCAGTTTGG - Intergenic
1080807780 11:35670659-35670681 TCAACTCTAGAATGTCAATTTGG + Intronic
1081447288 11:43143078-43143100 TCATTTCTAGAAATTCAATTTGG - Intergenic
1081654021 11:44845484-44845506 TCATCTCTACAAGCTCCGTGAGG - Intronic
1082907836 11:58330876-58330898 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1083085417 11:60138254-60138276 TCATCTGTTGATGGACAGTTAGG - Intergenic
1083206697 11:61154388-61154410 TCATCTCTAGAAGTTTGATTTGG - Intronic
1083371394 11:62185056-62185078 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1085365434 11:75938185-75938207 TCATCTCTGAAAGTTCAATTTGG + Intronic
1085731518 11:79002950-79002972 TCAGCTCTATCAGATCAGTTTGG - Intronic
1085931103 11:81085054-81085076 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
1086349529 11:85931634-85931656 TGATTTCTAGAATGTCCGTTGGG - Intergenic
1086839622 11:91668330-91668352 TCAGCTCTATTAGATCAGTTAGG - Intergenic
1087178084 11:95113642-95113664 TCATCTGTTGAAGGACACTTAGG + Intronic
1088148280 11:106712333-106712355 TCCTCTATAGAAGTTCAATTTGG + Intronic
1088386509 11:109263816-109263838 TCAGCTCTAGAATTTCTGTTGGG + Intergenic
1089829135 11:121309833-121309855 TCATCTGTAGAAGGTAATTTGGG - Intergenic
1090078174 11:123592519-123592541 GCAGCTCTAGAAGGTCAGTTAGG + Intronic
1090753618 11:129769186-129769208 TCATTTCTAGAAGTTTACTTAGG - Intergenic
1090789979 11:130083722-130083744 TCATCTCTCGATGGACATTTAGG + Intronic
1090845478 11:130526591-130526613 TCATCTCTTGATGGACATTTGGG + Intergenic
1092275122 12:7054967-7054989 TCAGCTCTATCAGATCAGTTAGG + Intronic
1092579462 12:9822321-9822343 CCAGCTCTAGCAGATCAGTTAGG - Intergenic
1092703052 12:11254529-11254551 TCATCTGTAAAAGGTCACTCTGG - Intergenic
1093239974 12:16658449-16658471 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1093343951 12:18017072-18017094 TCAGCTCTAGAAGATCAGTTTGG - Intergenic
1093528610 12:20135046-20135068 TCAGCTCTATTAGATCAGTTAGG + Intergenic
1093541926 12:20298055-20298077 TCAACTCTATCAGATCAGTTTGG + Intergenic
1093809649 12:23475541-23475563 TCAGCTCTATGAGATCAGTTAGG - Intergenic
1093923344 12:24884097-24884119 TCATCTGTTGATGGACAGTTAGG - Intronic
1094276781 12:28686004-28686026 TCATCTGTTGAAGGACATTTTGG + Intergenic
1094798668 12:34003992-34004014 TCAGCTCTAGAAGTTTAGTTAGG - Intergenic
1095111418 12:38298078-38298100 TCAGCTGTAGAAGTTCAGTTAGG - Intergenic
1095334179 12:41006899-41006921 TCATCTGTACAAGGCCAGTTAGG + Intronic
1095458400 12:42414835-42414857 TCATTTCTAGAAGTTCAATTTGG + Intronic
1095532511 12:43205886-43205908 TCATCTATTGATGGGCAGTTAGG - Intergenic
1096916932 12:55043485-55043507 TCATCTCTTGATGGACATTTGGG - Intergenic
1097303362 12:58042415-58042437 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1097715121 12:62958056-62958078 TCATCTCCAGAATGGCATTTAGG - Intergenic
1097773036 12:63611600-63611622 TCATATCTAAAAGTTCATTTTGG - Intronic
1098145296 12:67490979-67491001 TCAGCTCTATTAGATCAGTTAGG - Intergenic
1098580463 12:72093647-72093669 TCAGCTCTAGAATTTCTGTTTGG + Intronic
1098974994 12:76893226-76893248 TTATCTCTAGAAGTTCAATTTGG - Intergenic
1099054628 12:77823929-77823951 TCATCTCTAGGAGTTCCATTTGG - Intergenic
1099353932 12:81610565-81610587 CCAGCTTTAGAAGTTCAGTTTGG + Intronic
1100075035 12:90769655-90769677 GCATCTCTAGTAGGGCAGCTGGG + Intergenic
1100315825 12:93443240-93443262 TCTTCCCTACAAGGTCAGGTAGG - Intergenic
1100411132 12:94321206-94321228 TCAGCTCTATCAGATCAGTTAGG + Intronic
1101251519 12:102940482-102940504 TCAGCTCTATTAGATCAGTTTGG - Intronic
1101930746 12:109011700-109011722 TCATCTCTTGATGGACACTTAGG - Intronic
1101971746 12:109319179-109319201 TCATCTGTTGATGGGCAGTTGGG - Intergenic
1102648818 12:114421953-114421975 TCATCTCTTGATGGACATTTAGG - Intergenic
1103220207 12:119238068-119238090 TCATCTCTAGAAGTTCAATTGGG + Intergenic
1103268973 12:119656366-119656388 TCATCTATTGATGGACAGTTGGG - Intergenic
1103634418 12:122291550-122291572 TATTTTCTAGAACGTCAGTTTGG + Intronic
1104686019 12:130784817-130784839 TCAACTCTAGAATTTTAGTTTGG - Intergenic
1105880818 13:24605557-24605579 TCAGCTATAGAAGTTCAGCTTGG + Intergenic
1106326504 13:28695603-28695625 TCATCTATTGAAGGTTATTTGGG + Intergenic
1106366815 13:29089779-29089801 TCATTTCTGGAAGTTCAGTTTGG + Intronic
1106443633 13:29802609-29802631 TCACCTCTATCAGATCAGTTTGG - Intronic
1106689086 13:32094753-32094775 TCATCTCTTGATGGACACTTAGG + Intronic
1107096166 13:36538903-36538925 TCATCTCTAGAAGTTCCATTTGG + Intergenic
1107484761 13:40814801-40814823 TCAGCTATCGAAGTTCAGTTTGG - Intergenic
1107776776 13:43852286-43852308 TCAGCTCTATCAGGTCACTTAGG - Intronic
1107866795 13:44710860-44710882 TTAACTCTAGAAAGTGAGTTTGG - Intergenic
1108111138 13:47074006-47074028 TCAGCTCTAGAAGATTAGTTTGG - Intergenic
1108384992 13:49891159-49891181 AAATCTCTTGAAGGTCATTTTGG - Intergenic
1108431778 13:50360603-50360625 CCCTCCCTAGAAGGTCAGCTGGG + Intronic
1109040079 13:57322370-57322392 TCACATCTAGAAGCTGAGTTTGG + Intergenic
1109126912 13:58529183-58529205 AAATCTCTTGAAGGTCATTTTGG - Intergenic
1110175228 13:72548387-72548409 TCATCTCTTGATGGACACTTAGG - Intergenic
1110208004 13:72940336-72940358 TCATTTCTAGAAGTTCAAATTGG + Intronic
1110516956 13:76424974-76424996 TCATTTCTAGAAGTTGAATTTGG + Intergenic
1111112410 13:83731059-83731081 GCATATCTATAAGGTCAATTAGG + Intergenic
1111206941 13:85022714-85022736 TCATCTATTGATGGACAGTTGGG + Intergenic
1111338194 13:86848728-86848750 TCAACTCTACCAGGTCAGTTAGG - Intergenic
1111379913 13:87435794-87435816 TCATCCATTGAAGGACAGTTAGG - Intergenic
1111526789 13:89482126-89482148 TCATCGCTAAAAGCTCAGTGTGG - Intergenic
1113202027 13:107876306-107876328 TTATTTCCAGAAGTTCAGTTTGG - Intergenic
1115188403 14:30719264-30719286 TTCTCTTCAGAAGGTCAGTTTGG - Intronic
1116069848 14:40029952-40029974 TCATCTGTGGATGGTCATTTAGG + Intergenic
1116283913 14:42946930-42946952 TCAGCTCTAGAATTTCAGTTTGG - Intergenic
1116674513 14:47888246-47888268 TTATCTTTAAAAGTTCAGTTTGG - Intergenic
1117785904 14:59284623-59284645 TTATTTCCAGAAGTTCAGTTTGG - Intronic
1117890902 14:60421016-60421038 TCATCTCCTAAAGGACAGTTAGG - Intronic
1118068821 14:62223051-62223073 TCATTTCCAGAAGTTCAGTGTGG + Intergenic
1118198528 14:63650573-63650595 TTATCTTTAGAAGAGCAGTTTGG - Intergenic
1118523124 14:66609771-66609793 TCAATTTTAGAAGTTCAGTTCGG + Intronic
1118662244 14:68027675-68027697 TCAGCTCTAGAATTTCAGTTTGG + Intronic
1120055103 14:79915144-79915166 TCTTGTCAAGAAGGTCAGTTGGG - Intergenic
1120321828 14:82972565-82972587 TCATCTGTAGATGGACACTTAGG - Intergenic
1120928610 14:89823752-89823774 TCATCTCTAGAAGTTCCACTGGG - Intronic
1121505945 14:94476661-94476683 TCCACTCTAGCAGGCCAGTTGGG + Intronic
1121816477 14:96932773-96932795 TCATCTGTTGAAGCTCAGGTTGG - Intergenic
1121855051 14:97260559-97260581 TCATCTCTAGAAGTTCAGTTTGG - Intergenic
1122224334 14:100264936-100264958 CCATCTCTAAAAGCTCAGTTTGG + Intronic
1122253306 14:100456568-100456590 TCATCTCTAGAAGTCCAGTTTGG - Intronic
1122510738 14:102265247-102265269 TCATCTCCTGGAGCTCAGTTAGG - Intronic
1123455978 15:20426547-20426569 TCAGCTCTAGAATTTAAGTTTGG + Intergenic
1123635592 15:22304290-22304312 TCAGCTCTAGAATTTAAGTTTGG - Intergenic
1123709168 15:22974272-22974294 TCATCTGTTGATGGACAGTTAGG - Intronic
1123810831 15:23924469-23924491 TTATCACTGGAATGTCAGTTCGG - Intergenic
1124008472 15:25813704-25813726 TCAACTCTAGAAGTTCAATTTGG - Intronic
1126287394 15:47028523-47028545 TCAATTCTAGAAATTCAGTTTGG - Intergenic
1126659201 15:51015417-51015439 TCATCTCTAGAGGTTCCATTTGG + Intergenic
1126950649 15:53877046-53877068 TCAACTTTAGTAGGTAAGTTGGG + Intergenic
1127037607 15:54935801-54935823 TCATTTCTGGAAGTTCTGTTTGG + Intergenic
1127049225 15:55063396-55063418 TTATCTCTAGAAGTTCATTTTGG - Intergenic
1127097331 15:55526181-55526203 TCAGCTCTATCAGCTCAGTTTGG + Intergenic
1128183217 15:65623221-65623243 TAATCTCTAGAAGGACATCTGGG - Intronic
1128850809 15:70954274-70954296 TCATTTCCAGAAGTTCAGTTTGG + Intronic
1129493567 15:75954297-75954319 TCATCTCTGGAAGTTTGGTTTGG + Intronic
1129559833 15:76554135-76554157 TCAGCTCTATCAGATCAGTTTGG - Intronic
1129583053 15:76832285-76832307 TCATTTCCAGAAGTTCAGTTTGG - Intronic
1130139686 15:81214961-81214983 TCAGCTCTAGAAGTTCAGTTTGG + Intronic
1130174901 15:81558518-81558540 TCAGCTCTAGAAGATCAGTTTGG + Intergenic
1130700125 15:86170181-86170203 TCATCTCCAGAGGTTCAATTTGG - Intronic
1131121210 15:89824308-89824330 ACATCTCCAAAAGGTCAGTCCGG - Intergenic
1131197137 15:90364624-90364646 TCATATCAGGAAGATCAGTTTGG - Intronic
1131220226 15:90577624-90577646 TCATCTGTTGATGGACAGTTAGG - Intronic
1131415191 15:92249634-92249656 TCATCTGTTGATGGACAGTTAGG + Intergenic
1131693595 15:94853326-94853348 TCAGCTCTAGAAGTTCAGTGTGG + Intergenic
1133194814 16:4161657-4161679 TCATCTGTGGATGGACAGTTGGG - Intergenic
1133384633 16:5359208-5359230 TCATCTGTTGATGGACAGTTAGG + Intergenic
1133920081 16:10144698-10144720 TCATCTCTTGATGGACATTTAGG - Intronic
1134464569 16:14463591-14463613 TCATTTCTAGAAGTTCTGTTTGG - Intronic
1135432159 16:22394577-22394599 TCATCTCTTGATGGACATTTGGG + Intronic
1135475786 16:22773412-22773434 TCATCTATTGAAGGACACTTAGG - Intergenic
1135684623 16:24488718-24488740 TCATCTCTTGAAGTTTAATTTGG + Intergenic
1135898085 16:26428755-26428777 TCATCTGTTGATGGTCACTTAGG - Intergenic
1137496880 16:48976568-48976590 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1137544365 16:49390545-49390567 TCATCTCGAGAACTTCAATTTGG + Intronic
1137656722 16:50165817-50165839 TCACCTGTAGAAGGACATTTAGG + Intronic
1138274202 16:55719582-55719604 TTAGCTCTGGAAGTTCAGTTTGG - Intergenic
1138818390 16:60229079-60229101 TCATTACTAGAAGCTCAGCTAGG + Intergenic
1138994698 16:62435191-62435213 TCATCTCTAGCAGGTCTGATTGG + Intergenic
1139050443 16:63118706-63118728 TCATATCTAGAGGTTCATTTTGG - Intergenic
1139695835 16:68673930-68673952 TCATCTCTTGATGGACACTTGGG + Intronic
1139840963 16:69879615-69879637 TCATCTGTAGATGGACATTTGGG + Intronic
1140543814 16:75787209-75787231 TTATTTCTAGAAGCTCAATTTGG + Intergenic
1141155913 16:81597049-81597071 TCTTCTCTTGATGGTCATTTGGG + Intronic
1141312875 16:82932433-82932455 TTTTCTCTAGTAGGTCAGCTAGG - Intronic
1143415533 17:6746155-6746177 TCATCTGTTGATGGTCACTTAGG - Intergenic
1143462234 17:7111320-7111342 TTATCTCTAGAAGTTCACCTGGG - Intronic
1143806296 17:9430612-9430634 TCATCTGTTGACGGACAGTTGGG + Intronic
1144128965 17:12227500-12227522 TCATCTGTGGAAGGACATTTAGG + Intergenic
1145840329 17:27989035-27989057 AAATCTCTGGAAGGACAGTTGGG + Intergenic
1146463965 17:33071409-33071431 TAATCTCTAGAAGTTCAACTTGG + Intronic
1148284756 17:46378158-46378180 TCATCTGTAGATGGACACTTAGG + Intergenic
1148306977 17:46596080-46596102 TCATCTGTAGATGGACACTTAGG + Intronic
1149133499 17:53337043-53337065 TCAGCTCTATCAGTTCAGTTTGG - Intergenic
1149194564 17:54103547-54103569 TCAGCTCTAGAAATTCAGTTTGG - Intergenic
1149327097 17:55543130-55543152 TCATCTCTAGAAGATTAATTTGG + Intergenic
1150330700 17:64292120-64292142 TCATTTTTAGAAGTTCAGTTTGG - Intergenic
1150911143 17:69388898-69388920 TCATCTCTAGATGGACATTTAGG + Intergenic
1151163486 17:72185147-72185169 ACATCTTTAGAAGGCCAGTTTGG - Intergenic
1151981372 17:77511553-77511575 TCATCTCTAGAATTTCCATTTGG + Intergenic
1152522272 17:80863532-80863554 TCATCTCTAGAAATTCAAGTTGG - Intronic
1153267727 18:3287431-3287453 TCATCTGTTGATGGACAGTTAGG + Intergenic
1153399560 18:4667952-4667974 TCAGCTCTATCAGGTAAGTTTGG - Intergenic
1153582102 18:6583502-6583524 TCAGCTTTAGAAGTTCAGATTGG - Intronic
1153712978 18:7819038-7819060 TCTTGTCTAGATGGTCAGTATGG + Intronic
1153770442 18:8411261-8411283 TCATCTCTTGAAGTTCAATTTGG - Intergenic
1154321034 18:13352923-13352945 TCAGCTCTAGAATTTCTGTTTGG + Intronic
1155043830 18:22086839-22086861 TCATCTCTACAAAATCAGCTGGG + Intergenic
1155081730 18:22417311-22417333 AAATCTCTTGAAGGTCATTTTGG + Exonic
1155463727 18:26112767-26112789 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1155675945 18:28429075-28429097 TCAGCTCTAGAAACTCAGTTTGG + Intergenic
1156052066 18:32949564-32949586 TTATTTCTAGAAGTTCAATTGGG + Intronic
1156914722 18:42452127-42452149 GCATCTCAGGAAGGTCAGTTAGG + Intergenic
1157226606 18:45871526-45871548 TCATCTTTTGAAGGACACTTAGG - Intronic
1157564675 18:48671949-48671971 TTATCTCTCGAAGGTCATTGTGG + Intronic
1157649811 18:49316951-49316973 TCATCTGTAGAAGGACATCTTGG + Intronic
1158337326 18:56427013-56427035 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1158822309 18:61175214-61175236 TCATTTCTAAAAGTTCAGTTTGG - Intergenic
1159088092 18:63817472-63817494 CCAATTCTAGAAGTTCAGTTTGG + Intergenic
1159170460 18:64759416-64759438 TCAGCTCTATACGATCAGTTTGG - Intergenic
1159395323 18:67847816-67847838 TCATCTCTATGAGCTCAGTTTGG - Intergenic
1159404287 18:67979368-67979390 TCATCTATAGTAAATCAGTTTGG + Intergenic
1159543462 18:69811047-69811069 TCATCTCTTGATGGACACTTAGG - Intronic
1159600201 18:70421966-70421988 TCATATATAAAATGTCAGTTTGG - Intergenic
1160278753 18:77466110-77466132 TCATCCGTGGAAGGACAGTTAGG + Intergenic
1161142783 19:2658511-2658533 TCATCTCTCGGTGGTCACTTGGG - Intronic
1162698267 19:12494362-12494384 TCATCTGTTGAGGGACAGTTAGG - Intronic
1163028079 19:14525410-14525432 TCATCCATTGAAGGACAGTTAGG - Intronic
1164422553 19:28107668-28107690 TCATTTCTAGAAGTTCTGATTGG - Intergenic
1164496324 19:28766880-28766902 TCAGCTCTATTAGCTCAGTTTGG - Intergenic
1164499166 19:28799259-28799281 TCACCTCAAGAAGTTCAGTTTGG - Intergenic
1167772018 19:51526851-51526873 TCAGCTCTATCAGCTCAGTTTGG - Intronic
1168131657 19:54324855-54324877 TCAGCTCGAGAAGTTCAGTTTGG + Intergenic
1168481183 19:56721328-56721350 TCATCTGTTGATGGTCACTTAGG - Intergenic
925079081 2:1047186-1047208 TCAGCTCTATCAGATCAGTTTGG + Intronic
925162642 2:1696463-1696485 TCAGTTCTAGAATTTCAGTTTGG - Intronic
926049660 2:9736640-9736662 TCATCTGTTGAAGGACATTTGGG + Intergenic
926479894 2:13378622-13378644 TCACCTCTAGAATTTAAGTTTGG - Intergenic
927006850 2:18860340-18860362 TCATTTCCAGAAGTTCAGTATGG + Intergenic
927056597 2:19371114-19371136 TCTTCCCTAGAAGGTCAGGTTGG - Intergenic
928273131 2:29875111-29875133 TCATCTATTGATGGTCATTTGGG - Intronic
928307046 2:30178806-30178828 TCATCTCTACAATGTCCTTTTGG - Intergenic
928488148 2:31753728-31753750 TCATCTCTTGATGGACACTTAGG - Intergenic
928494429 2:31817709-31817731 TCATCTCTTGATGGACACTTAGG + Intergenic
928700701 2:33895872-33895894 TCATATCTTGAAGGTCCCTTTGG - Intergenic
928822263 2:35375526-35375548 TCATCACTAGAAGTTCAATTTGG - Intergenic
929343525 2:40852735-40852757 TGATCTCTAAAAAGTCAGGTGGG + Intergenic
929656550 2:43737970-43737992 TCATCTCTAAAAATTCAATTTGG - Intronic
929699372 2:44148692-44148714 TCATCTCTAGAAATTCTCTTTGG - Intergenic
929752976 2:44736828-44736850 TCATCTCTAGAAGTTTGATTTGG + Intronic
929909557 2:46077807-46077829 GTATTTCTAGAAGGTCAGTGTGG - Intronic
930115635 2:47716033-47716055 TCATCTGTTTAAGGACAGTTGGG - Intronic
930897804 2:56465460-56465482 TCAATTCCAGAAGTTCAGTTTGG - Intergenic
931050561 2:58409266-58409288 TCATCTGTAGATGGACACTTAGG + Intergenic
931222002 2:60296545-60296567 TCCACTCCAGATGGTCAGTTGGG - Intergenic
931852610 2:66267289-66267311 TCATCTGTTGATGGACAGTTAGG + Intergenic
932089517 2:68792669-68792691 TCATCTGTTGATGGACAGTTAGG + Intronic
933118112 2:78499416-78499438 TCATCTCTGTCAGTTCAGTTTGG - Intergenic
933121701 2:78546415-78546437 TCATCTCTCAAAGGACATTTAGG - Intergenic
933173647 2:79153948-79153970 TCACCTCTATCAGATCAGTTTGG + Intergenic
933181697 2:79234868-79234890 TCAGCTCCAGAAGTTCAGGTTGG + Intronic
933327902 2:80862439-80862461 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
933604043 2:84362083-84362105 TCAGCTCTATCAGATCAGTTAGG - Intergenic
933857010 2:86424610-86424632 TCATCTCTAGAAGTACGGTTGGG - Intergenic
934049611 2:88199284-88199306 TCATCTGTTGAAGGACATTTGGG - Intergenic
934530489 2:95084314-95084336 TCATCTCTAGAGGTTCAACTTGG + Intergenic
935020441 2:99225260-99225282 TAAATTCTAGAAGTTCAGTTTGG - Intronic
935323629 2:101913511-101913533 TCATCTCTTGAAGAACATTTGGG + Intergenic
935583609 2:104781406-104781428 TCATCTTTTGATGGACAGTTGGG - Intergenic
935825953 2:106949733-106949755 TCATCTGTTGATGGACAGTTAGG + Intergenic
936488911 2:112953164-112953186 TCAACTCTAAAAGTTCATTTTGG + Intergenic
936840345 2:116760715-116760737 TTATCTCTAGAAACTCACTTGGG - Intergenic
937286473 2:120757049-120757071 TCATCTCTAGAAGTTTGATTGGG + Intronic
937874443 2:126810827-126810849 TCATCTCTTGATGGACATTTAGG + Intergenic
938241985 2:129749360-129749382 TCATTTCCAGAAGTTCTGTTTGG - Intergenic
938868680 2:135451839-135451861 TCACCTCTAGAAGTTTAGTTTGG - Intronic
939945344 2:148403081-148403103 TTATCTCTAGAAGTTCAATTTGG + Intronic
939946322 2:148415800-148415822 TCAACTCTATCAGATCAGTTTGG + Intronic
940057703 2:149530277-149530299 TCATCTCTTGATGGACATTTGGG - Intergenic
940494374 2:154406545-154406567 TCATCTATGGAAGGACATTTTGG - Intronic
940501443 2:154499276-154499298 TCTTCTGTTGAAGGTCATTTGGG - Intergenic
941181925 2:162269625-162269647 TCATCTATGAGAGGTCAGTTTGG - Intronic
941329915 2:164167436-164167458 TCATCTCTAGAAGTTAAAGTTGG + Intergenic
941498412 2:166237463-166237485 TCATCTCCAGAATGGCAGTGGGG - Intronic
941590107 2:167409591-167409613 TCAGCTCCATCAGGTCAGTTAGG + Intergenic
941681097 2:168400636-168400658 TCATGTCCAGAAGTTCAGTTTGG + Intergenic
941963521 2:171277273-171277295 TTATCTCTAGAAGTTTGGTTTGG - Intergenic
942384362 2:175425662-175425684 TCATCTCTGGAAGTTCAGTTTGG - Intergenic
942433326 2:175940826-175940848 TTATCTGTAGAAGTTCAATTTGG - Intronic
942908311 2:181209423-181209445 TCATTTCCAGAAATTCAGTTTGG - Intergenic
944370391 2:198975395-198975417 TCATTTCTAGAAGTTCTGATTGG - Intergenic
944470853 2:200052390-200052412 TCATCTCTACAAAGGCAATTTGG + Intergenic
944562385 2:200953684-200953706 TCATCTGTAGATGGACACTTGGG - Intronic
944580488 2:201128027-201128049 TCATTTCTAGTAGTTCTGTTTGG + Intronic
944624841 2:201560088-201560110 TCAGCTCTAGAATGTCCGTTTGG - Intronic
944789790 2:203113234-203113256 ACATCTCTGGAGGGTCAGCTAGG + Exonic
945357304 2:208855777-208855799 TCAGCTCTATCAGGTCAGTTTGG + Intergenic
945430378 2:209756342-209756364 TCAGCTCTATCAGATCAGTTTGG - Intergenic
945461432 2:210113750-210113772 TCAGCTCTAGAATTTCTGTTTGG - Intronic
945521377 2:210832023-210832045 TCATTTCCAGAAGTTCAGATCGG + Intergenic
945658758 2:212658751-212658773 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
945723338 2:213446394-213446416 TCATTTCCTGAAGTTCAGTTTGG - Intronic
945758791 2:213884827-213884849 TCAGCTTTAGAAGTTCAGTTTGG + Intronic
946262153 2:218502287-218502309 TCATCTCTAGAAGTTTAATTTGG - Intronic
946944806 2:224809920-224809942 TCATCTATAGATGGTCACCTAGG - Intronic
947675399 2:231974515-231974537 TTATCTCTAGAAGTTTAATTTGG + Intronic
947947052 2:234113871-234113893 TCGTCTCTAGAAGTTCTATTCGG + Intergenic
948773722 2:240268982-240269004 TTATTTCCAGAAGTTCAGTTTGG + Intergenic
949054175 2:241916121-241916143 TTATCTCTACCAGGTCAGTTAGG - Intergenic
1168733163 20:104636-104658 TCAGTTCTAGAAGTTTAGTTTGG - Intergenic
1168812536 20:714693-714715 TCATTTCTAGAAGTTCAGTTTGG + Intergenic
1168920443 20:1530439-1530461 TCATCTCTAAAAGTTCAATATGG + Intergenic
1169159418 20:3363948-3363970 TCATCTCTAGAAGTTGATTTGGG + Intronic
1169188437 20:3640175-3640197 TCATTTCTAGAAGTTCCATTTGG - Intronic
1169500577 20:6156993-6157015 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
1169852598 20:10068875-10068897 TCATCTCTTGATGGACACTTAGG - Intergenic
1170378597 20:15731011-15731033 TCAGCTCTATCAGATCAGTTTGG + Intronic
1170863713 20:20133776-20133798 TCATCTCAAGATGGTGATTTGGG + Intronic
1171773007 20:29340904-29340926 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1171815102 20:29779145-29779167 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1172868260 20:38117239-38117261 TCATTTCTAGAAGTTCTATTTGG + Intronic
1175380743 20:58561229-58561251 TCATCTCTAGAAATTCCATTTGG - Intergenic
1175898100 20:62348696-62348718 TCATTTCTAGAAGTTCTGATTGG - Intronic
1176677698 21:9795197-9795219 TCTTCCCTAAAAGTTCAGTTTGG + Intergenic
1176737667 21:10566602-10566624 TCATCTCTTGATGGGCACTTAGG - Intronic
1176899138 21:14418289-14418311 TCAGCTCTAGAATTTCTGTTTGG - Intergenic
1177120736 21:17133858-17133880 TCAATTCCAGAAGTTCAGTTTGG - Intergenic
1177320592 21:19514525-19514547 TCAGCTCTGTAAGATCAGTTTGG - Intergenic
1177321755 21:19531032-19531054 TTATCTCTAGAAAGTCTATTGGG + Intergenic
1178875429 21:36410596-36410618 TCATCTCTAGAGATTCACTTTGG + Intronic
1178966009 21:37118877-37118899 TCATCTCTAGAGGTTAAATTTGG + Intronic
1180318538 22:11299698-11299720 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1180974337 22:19838942-19838964 TCATCCATAGATGGTCATTTGGG - Intronic
1181331248 22:22093547-22093569 TCATCTGTGGATGGACAGTTAGG - Intergenic
1181520608 22:23447346-23447368 TCATCCTTAGAAGGTCAATTTGG + Intergenic
1183274191 22:36881591-36881613 TCAACTCTAGAATTTCAATTTGG - Intergenic
1183685879 22:39361188-39361210 TCTTCTCTAGAAGGTGAGGCAGG + Intronic
1183921215 22:41170559-41170581 CCATGACTACAAGGTCAGTTGGG + Exonic
1184052103 22:42014782-42014804 TCAACTCTAGAATTTCTGTTTGG + Intronic
1184122788 22:42463730-42463752 TCATTTCTAGAAGCTCTATTTGG - Intergenic
1184726304 22:46348675-46348697 TCCTCTATAGCAGTTCAGTTAGG + Intronic
1184896719 22:47411847-47411869 TCATCTCTAGATGTTCAATTTGG - Intergenic
1185394660 22:50580611-50580633 TCATCTCAGGGAGGCCAGTTGGG + Exonic
949145271 3:691917-691939 TTAGCTCTAGAAGTTCAGTTTGG - Intergenic
950600865 3:14034530-14034552 TCAGCTCTATCAGATCAGTTAGG + Intronic
951008892 3:17652905-17652927 TCATCCCTTGATGGACAGTTGGG - Intronic
951270845 3:20622024-20622046 TCATCTGTTGATGGACAGTTAGG + Intergenic
951788055 3:26445326-26445348 CCATCTCAAGAAGCTCAGTTTGG + Intergenic
951905810 3:27706271-27706293 TTATCTCTAGAAGTTCAATTTGG + Intergenic
952204103 3:31162464-31162486 TCATTTCCAAAAGGTCAGCTTGG + Intergenic
952495638 3:33913645-33913667 TCACCTGTAGGAGGTCAGTGGGG - Intergenic
952669760 3:35952749-35952771 TTATTTCCAGAAGTTCAGTTTGG + Intergenic
952672847 3:35992394-35992416 TTATCCCAAGAATGTCAGTTTGG - Intergenic
952694176 3:36246787-36246809 TCAGCTCTAGAAAGTGAATTTGG - Intergenic
952986419 3:38788960-38788982 TTTTCTCTGGAAGGTCAGTTCGG + Exonic
953104399 3:39861647-39861669 TCAGCTCTATCAGATCAGTTTGG - Intronic
954561393 3:51559680-51559702 TCATCTCTAGAACAGCAGCTGGG - Intronic
955168682 3:56541359-56541381 TCATCTTTAGAAGTTCAATTTGG + Intergenic
956540245 3:70328484-70328506 TCATCTCTACAAGTTCAAATTGG - Intergenic
956546140 3:70405515-70405537 TCATCTCTAGAAGTTCCATTTGG - Intergenic
956550899 3:70458388-70458410 TCATCTGTTGATGGACAGTTAGG - Intergenic
956713796 3:72060900-72060922 TTATCTTCAGAAGGTCAGGTTGG - Intergenic
957014004 3:75042572-75042594 TCAATTCTAGTAGTTCAGTTTGG + Intergenic
957027134 3:75194675-75194697 TCATTTCTAGAAGTTCATTTTGG - Intergenic
957211019 3:77258745-77258767 TCATAGCTAGAAGGTCATTAAGG - Intronic
957254903 3:77824678-77824700 TCAGCTCAAGAAGTTTAGTTTGG + Intergenic
957592877 3:82224073-82224095 TTAACTCTAGAAGTTCAGTTTGG + Intergenic
958449188 3:94252346-94252368 TCATATCTAGTATGTAAGTTCGG - Intergenic
958462788 3:94419604-94419626 TCAGCTCTATCAGTTCAGTTTGG - Intergenic
958599321 3:96274612-96274634 TCATCTATTGATGGTCACTTTGG - Intergenic
958806365 3:98815718-98815740 TTATCTCTAGATGTTCAGTTTGG - Intronic
958970121 3:100601733-100601755 TCATCTGTTGATGGACAGTTAGG + Intergenic
959439293 3:106357467-106357489 TCAGCTTTTGTAGGTCAGTTTGG + Intergenic
959699114 3:109281722-109281744 ACATCTCTAGAAGGCCATGTGGG + Intergenic
960218619 3:115075519-115075541 TCATCCATAGAAGGACATTTAGG + Intronic
960483476 3:118222488-118222510 TCATCTGTAGATGGACATTTGGG - Intergenic
960512033 3:118561479-118561501 TTACCTCTAGAATGTAAGTTTGG - Intergenic
960561233 3:119085697-119085719 TCAGCTCAAGAAGTTCAGTTTGG - Intronic
960579383 3:119261973-119261995 TCATCTCTACAAGTTCAATTTGG - Intergenic
960754844 3:121000447-121000469 TCATGTCTATCAGATCAGTTAGG + Intronic
961627815 3:128275830-128275852 TCATCTCTGAAAGGGCAGTAGGG + Intronic
961932955 3:130553485-130553507 TCAGCTCTATCAGATCAGTTTGG + Intergenic
961983111 3:131103003-131103025 TCAGCTCTAGAAGCTCAATTTGG + Intronic
962001584 3:131304245-131304267 TCAGCTCTATCAGATCAGTTTGG + Intronic
962379378 3:134885130-134885152 TCATCTCTAGATGTTCTATTTGG - Intronic
962506004 3:136046900-136046922 TCAATTCTAGAAGTTCAGTTTGG - Intronic
962816033 3:139001381-139001403 TTATCTCTAGAAGTTCCATTAGG + Intergenic
962860860 3:139399844-139399866 TCATCTGTTGATGGACAGTTTGG - Intergenic
963168734 3:142230490-142230512 TCATCTGTTGATGGACAGTTAGG + Intergenic
963285230 3:143428678-143428700 TCATCTGTAGATGGGCATTTAGG - Intronic
963368756 3:144370233-144370255 TCATTTCAAGAAGGTCAGTTAGG - Intergenic
964714747 3:159710185-159710207 TCATCTGTGGATGGTCACTTAGG - Intronic
964816349 3:160721010-160721032 TCAGTTCAAGAAGTTCAGTTTGG - Intergenic
964941819 3:162167231-162167253 TCATTTCAAGATGGTCAGTGAGG + Intergenic
965221310 3:165930636-165930658 ACATCTCTTGAAAGTCAGTGGGG + Intergenic
965810874 3:172590829-172590851 TCAGCTCTATCAGATCAGTTAGG + Intergenic
965901860 3:173651357-173651379 TCATCTGTTGATGGACAGTTAGG + Intronic
966964835 3:184980656-184980678 TCAGCTCTAACAGATCAGTTTGG + Intronic
968358357 3:198125832-198125854 TCATCTGTAGATGGACATTTGGG + Intergenic
968664416 4:1813318-1813340 TCATCTTTTTAAGGTCAGGTTGG - Exonic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
970289698 4:14558169-14558191 TCATCCCTTGAAGGGCATTTAGG + Intergenic
970359901 4:15298515-15298537 TCATCTGCAGAAGGTGAGGTTGG - Intergenic
970622324 4:17835862-17835884 TCATCCATTGAAGGACAGTTGGG + Intronic
970773378 4:19642260-19642282 TCATCTGTTGATGGACAGTTAGG + Intergenic
971096275 4:23408231-23408253 TCAATTCTAGAAGTTCAGTTTGG + Intergenic
971403475 4:26298356-26298378 TCCTCTCTAGATGGTCATTTGGG - Intronic
971511512 4:27432077-27432099 TCATCTGTTGATGGTCAATTAGG - Intergenic
971651700 4:29284196-29284218 TTATTTCTAGAAGTTCATTTTGG + Intergenic
971709224 4:30090076-30090098 TCAGCTCTATCAGTTCAGTTTGG + Intergenic
972025184 4:34366706-34366728 TCATTTTAAAAAGGTCAGTTCGG + Intergenic
972124306 4:35743690-35743712 TGATCTGTAGAGTGTCAGTTGGG - Intergenic
972208462 4:36806811-36806833 TCATCTGTAGATGGACACTTAGG - Intergenic
973034532 4:45389926-45389948 TCAGCTCTAGAAGGTTAGTTTGG + Intergenic
973235113 4:47893036-47893058 TCATCTCTAGAAGTTGGATTTGG - Intronic
974006997 4:56568121-56568143 TAATCTCTAGAGGTTCATTTGGG + Intronic
974342928 4:60637624-60637646 TTAATTCTAGAAGTTCAGTTTGG + Intergenic
974522677 4:63004918-63004940 TCATTTCTAAAAGATCATTTTGG - Intergenic
974599543 4:64059551-64059573 TTAGCTCTAGAAGTTTAGTTTGG + Intergenic
974914287 4:68160810-68160832 TCACTTCCAGAAGTTCAGTTGGG + Intergenic
975175006 4:71278333-71278355 TCATCTCTGGATGGACACTTTGG + Intronic
975316586 4:72960272-72960294 TCATTTCCAGAAGTTCTGTTTGG - Intergenic
975600394 4:76093795-76093817 TTATCTCTAGAAATTCAATTTGG + Intronic
975723495 4:77270362-77270384 TCAGCTCTAAAAGGTCATCTAGG - Intronic
975922523 4:79409075-79409097 TCATCCCTAGAAGCTCAATTTGG + Intergenic
976028447 4:80720933-80720955 CTATCTCTAGAATTTCAGTTTGG - Intronic
976222277 4:82766413-82766435 CCATCTCTAGAAGTTTAATTTGG + Intronic
976368602 4:84260049-84260071 TCATTTCCAGAAGTTCTGTTTGG - Intergenic
976481718 4:85554622-85554644 TCAGCTCTATCAGATCAGTTTGG + Intronic
976492876 4:85692654-85692676 TCAGCTCCAGAAGTTCAGTTTGG + Intronic
976902624 4:90197527-90197549 TCATCTGTTGATGGACAGTTAGG - Intronic
976907777 4:90261929-90261951 TCATTTCTAGAAGTTCTGATTGG + Intronic
977195429 4:94053165-94053187 TCATTTCTAGAAGTTCAGTTTGG - Intergenic
977482367 4:97594304-97594326 TCAGCTCTATCAGATCAGTTTGG - Intronic
977958725 4:103060357-103060379 TCATTTCTAGAAGTTCAAGTTGG + Intronic
977997594 4:103514171-103514193 TCATCTCTAGAAGGTCAGTTTGG + Intergenic
978308221 4:107355507-107355529 TTATATCTAGAAGTTCAATTTGG + Intergenic
978343834 4:107744964-107744986 TTATCTCTAGAAGTTCAACTTGG + Intergenic
978538486 4:109789037-109789059 TTATCCCTAGAAGTTCAATTTGG - Intronic
978940756 4:114433854-114433876 TCAGCTCTATCAGTTCAGTTTGG + Intergenic
979208892 4:118076631-118076653 TCAGCTCTATCAGATCAGTTTGG + Intronic
979651018 4:123131719-123131741 TCATCTGTAGATGGACAGTTAGG + Intronic
979758577 4:124372759-124372781 TCAGCTCTATCAGCTCAGTTTGG + Intergenic
980560390 4:134465288-134465310 TTATCTCTAGAAGTTCCATTTGG - Intergenic
980694617 4:136338547-136338569 TCAGCTCTATCAGCTCAGTTAGG - Intergenic
981280093 4:142947112-142947134 TCAATTCCAGAAGTTCAGTTTGG - Intergenic
981466353 4:145076762-145076784 TCAGCTCTACCAGGTCAGTTTGG - Intronic
982931154 4:161408731-161408753 TTAGCTCAAGAAGCTCAGTTTGG - Intronic
983109571 4:163732219-163732241 TCATCTTTAGAAGTTTGGTTAGG - Intronic
983110842 4:163747637-163747659 TTAGCTCTAGAAGTTCAATTTGG - Intronic
983336012 4:166393472-166393494 TCATCTCTAGAAGTGTAATTTGG + Intergenic
983695454 4:170523509-170523531 CCATCTCGAGCATGTCAGTTGGG + Intergenic
983711768 4:170725947-170725969 TCATCTATTGATGGGCAGTTAGG - Intergenic
983942951 4:173555463-173555485 TCATCTGTTGATGGACAGTTAGG - Intergenic
984236150 4:177160823-177160845 TCAGCTCTATCAGATCAGTTTGG - Intergenic
985365880 4:189232299-189232321 TTAGTTCCAGAAGGTCAGTTTGG + Intergenic
985397837 4:189563596-189563618 TCTTCCCTAAAAGTTCAGTTTGG - Intergenic
986560585 5:9056872-9056894 TCATCTCTTGATGGACATTTAGG - Intronic
986565490 5:9109530-9109552 TATTCTCTAGAAGGTAAATTTGG - Intronic
986620516 5:9668074-9668096 TCAACTCTATCAGATCAGTTTGG - Intronic
986846124 5:11755770-11755792 TCAGCTCTACCAGGTCAGTTTGG + Intronic
987633630 5:20509785-20509807 TCATCTATGGAAGGACACTTAGG + Intronic
987649154 5:20718450-20718472 TGAGCTCTAGAAGTTCAGTGTGG + Intergenic
987773785 5:22338165-22338187 TCATCTGTAGATGGACACTTAGG - Intronic
988034365 5:25807048-25807070 TCTGCTCTAGAAGATCAGTTTGG + Intergenic
988068338 5:26252113-26252135 TACTCTCAAGAATGTCAGTTGGG - Intergenic
988165893 5:27589730-27589752 TCAGGTCTAGAAATTCAGTTTGG + Intergenic
988238503 5:28576679-28576701 TCAGCTCAAGAATTTCAGTTTGG - Intergenic
988573878 5:32400310-32400332 TCATCTGTTGTATGTCAGTTAGG - Intronic
988645575 5:33092081-33092103 TCATCTCTATCAGGTCAGTTTGG + Intergenic
988675285 5:33427177-33427199 TCAGCTCTATCAGATCAGTTTGG + Intergenic
988746404 5:34143089-34143111 TGAGCTCTAGAAGTTCAGTGTGG - Intergenic
990365388 5:55065367-55065389 TCATCTGTTGAAGGACATTTGGG + Intergenic
990607660 5:57426813-57426835 TCATTTTTATAAGGTTAGTTAGG + Intergenic
991244137 5:64490801-64490823 TCAGCTCTATCAGATCAGTTTGG - Intergenic
991281733 5:64922466-64922488 TCATATCCAGAAGTTCAGTTTGG + Intronic
991938066 5:71822302-71822324 TCATCTGTTGATGGACAGTTAGG + Intergenic
991972761 5:72156891-72156913 TCATCTGTAAAAGGGCAGTGGGG - Intronic
992029423 5:72706756-72706778 TAATCTCTAGAAGTTCAATTTGG + Intergenic
992244672 5:74808218-74808240 TCATCTATTGATGGACAGTTAGG - Intronic
992305688 5:75435270-75435292 TCATTTCCAGAAGTTCTGTTTGG + Intronic
992314162 5:75535789-75535811 TCATCTCTATCAGATGAGTTTGG + Intronic
993150053 5:84149775-84149797 TCATCTCTGGAAGTTCAATTAGG - Intronic
993366810 5:87043719-87043741 TCATCTCTAGAAGTTCTATTTGG + Intergenic
993428939 5:87806240-87806262 TTATCTCTACAAGTTCAATTTGG - Intergenic
993944594 5:94102330-94102352 TCATCTCTATCAGATCAGTTTGG - Intronic
994060820 5:95474944-95474966 TCAGCTCTGGAAGTTCAGTTTGG + Intronic
994151263 5:96450152-96450174 TCATCTCTTGATGGGCACTTAGG - Intergenic
994226694 5:97260301-97260323 TCATCTGTTGATGGACAGTTAGG - Intergenic
994493100 5:100473829-100473851 TCATTTCTAGAGGTTCTGTTTGG - Intergenic
994603791 5:101941961-101941983 TCAGCTCAAGAAGCTCAGTTTGG + Intergenic
994907720 5:105862350-105862372 TCAGCTCTATCAGATCAGTTTGG - Intergenic
995978092 5:118066751-118066773 TCAGCTCTAGAAGTTCAATATGG + Intergenic
995995273 5:118291084-118291106 TCAGCTCTATCAGATCAGTTTGG + Intergenic
996776646 5:127139913-127139935 TCATCTCTGGAGGTTCAATTTGG + Intergenic
996898040 5:128509411-128509433 TCATCTGTAGAAGTTCAATTTGG + Intronic
997021617 5:130008767-130008789 TCACCTCTATTAGATCAGTTTGG - Intronic
998518197 5:142774975-142774997 TCATCTATTGAAGGACATTTTGG + Intronic
1000455312 5:161441699-161441721 TCATCTGTTGATGGACAGTTAGG - Intronic
1001267529 5:170285216-170285238 ACATTTCTAGAAGTTCTGTTTGG + Intronic
1001679127 5:173543472-173543494 TGATCTAGTGAAGGTCAGTTAGG + Intergenic
1001843097 5:174896983-174897005 TCATCTTTAGAATTTCAATTTGG + Intergenic
1002611847 5:180424726-180424748 TTATCTCAAGAAGGCAAGTTTGG - Intergenic
1004115740 6:12765857-12765879 TCATGTCTAGGAAGTCACTTGGG - Intronic
1004417101 6:15434954-15434976 TGATTTCTAGAAGCTCTGTTTGG + Intronic
1004793273 6:19052198-19052220 TCAGCTCTAGAAGTTTAGTTTGG - Intergenic
1004793718 6:19057713-19057735 TCATCTGTTGAAGGACACTTAGG - Intergenic
1004973917 6:20943610-20943632 TCATCTCTAGAAGTTCCACTAGG + Intronic
1005800016 6:29411081-29411103 TCAGCTCTATCAGGTCAGTTAGG - Intronic
1006045673 6:31294934-31294956 TCATCTGCAGAAGGTAAGTAAGG - Intronic
1006834405 6:36988368-36988390 TCATTTCTAGATGTTCTGTTTGG - Intergenic
1006867809 6:37222942-37222964 TCATCTCTAGAAATTCTATTTGG - Intronic
1006963134 6:37954495-37954517 CCATCTCTAGAAGGCCAGTTGGG + Intronic
1007501136 6:42298023-42298045 TCATTTCTAGAAGTTCTGCTTGG - Intronic
1007528353 6:42517062-42517084 TCATCTCTAGGGGTTCAATTTGG - Intergenic
1007561506 6:42812584-42812606 TCATCTCCAGAAGTTCAATTTGG - Intronic
1007847693 6:44773862-44773884 TCATCTCTTGATGGACACTTAGG + Intergenic
1008020976 6:46576646-46576668 TCATTTCCAGAAATTCAGTTTGG - Intronic
1008315289 6:50031592-50031614 TCAGCTGAAGAAGTTCAGTTTGG - Intergenic
1008336952 6:50318071-50318093 TCATCGCTAGGAGTTCAGTTTGG - Intergenic
1008427837 6:51380105-51380127 TTATTTCTAGAAGTTCTGTTTGG - Intergenic
1008562898 6:52739369-52739391 TCATGCCTAGAATGTCACTTTGG - Intergenic
1008706979 6:54174131-54174153 TCATCTATTGAAGGACACTTAGG + Intronic
1008716320 6:54294438-54294460 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1008725728 6:54416230-54416252 TCATCTCCAGAAGTTCCATTTGG - Intergenic
1009221602 6:60990836-60990858 TCAGCTCAAGAAGTTCATTTTGG + Intergenic
1009446453 6:63748260-63748282 TCATCTGTTGATGGACAGTTAGG + Intronic
1009998289 6:70921440-70921462 TCAGCTCTATCAGTTCAGTTTGG + Intronic
1010495623 6:76531548-76531570 TCAGATCTATCAGGTCAGTTTGG + Intergenic
1011320541 6:86087596-86087618 TCAGCTCCAGAAGATCAGTCTGG + Intergenic
1011589842 6:88961896-88961918 TCATCTATTGATGGTCATTTGGG - Intronic
1011878642 6:91994725-91994747 TCATCTCTTGATGGACACTTGGG - Intergenic
1011915790 6:92504839-92504861 TCATCTTTAAATGTTCAGTTTGG - Intergenic
1012004944 6:93701906-93701928 CCATATATAGAAGGGCAGTTTGG - Intergenic
1012059412 6:94459591-94459613 TCATCTCTTGGCGGTCACTTAGG + Intergenic
1012890612 6:104893020-104893042 TCATCTCTAGAAATTCTATTTGG + Intergenic
1012924341 6:105252492-105252514 TCATCTCTCAAAGGGCACTTGGG - Intergenic
1013185528 6:107754454-107754476 TCATTCCTAGAAAGGCAGTTAGG - Intronic
1013393928 6:109714544-109714566 TTATCTATAAAAGGTCATTTGGG + Intronic
1013641894 6:112091896-112091918 TCATCTCTAGAAGTCTAATTGGG - Intronic
1013642808 6:112103436-112103458 TCATCTCTAAAAGTTCTATTTGG - Intergenic
1013930532 6:115526006-115526028 TCATCCCTAGATGGTAAATTTGG - Intergenic
1014045741 6:116883857-116883879 TCAACTTTAAAAGGTCAGTTTGG - Intronic
1014520651 6:122438593-122438615 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1014566382 6:122954380-122954402 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1014748238 6:125225242-125225264 TCATCTCTTGATGGACATTTGGG + Intronic
1014834000 6:126137715-126137737 TCATCTGTAGATGGACACTTAGG - Intergenic
1015186202 6:130419313-130419335 TCATCTGTGGATGGACAGTTAGG + Intronic
1015488501 6:133799311-133799333 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1016075189 6:139787699-139787721 TCAGCTCTGTAAGATCAGTTTGG + Intergenic
1016110346 6:140215803-140215825 TCATCTCTTGATGGACACTTTGG + Intergenic
1016139240 6:140587146-140587168 TCATTTCTACAAGTTCAGTTTGG - Intergenic
1016161407 6:140885130-140885152 TCATCTTTTGAAAGTCATTTGGG + Intergenic
1016542028 6:145177326-145177348 TCATCTGTTGATGGTCACTTAGG - Intergenic
1017311731 6:152983466-152983488 TCATCTCTCGAACGGGAGTTCGG + Intronic
1017568845 6:155719761-155719783 TCATCTATAGATGGGCACTTAGG - Intergenic
1018069572 6:160151572-160151594 TTATCTCTAGAAGTTTAATTTGG - Intronic
1018072779 6:160180336-160180358 TCATCTGTCAATGGTCAGTTGGG - Intronic
1018145079 6:160878181-160878203 TCAGCTCAAGAAGTTCAGTTTGG - Intergenic
1019106752 6:169674394-169674416 TCATCTCCAGAAGTTAGGTTTGG - Intronic
1019295812 7:273771-273793 TCATCTCTAAAAATTCTGTTTGG + Intergenic
1019590634 7:1828897-1828919 TCATCCTTAGAAGGTCAATTTGG - Intronic
1020549791 7:9588810-9588832 TCACTTCTATAAGGTCAGTTTGG - Intergenic
1020577214 7:9948254-9948276 TCATCTGTAGATGGACACTTAGG - Intergenic
1020853066 7:13381619-13381641 TCATCTGTTGATGGACAGTTAGG + Intergenic
1021232292 7:18100588-18100610 TCATCTCTTGAAGTTCAATGGGG + Intronic
1021326081 7:19270757-19270779 TTATCTCTAGAAATTCACTTGGG - Intergenic
1021834682 7:24658250-24658272 TCATTTCTAGAAGTTCAGATTGG + Intronic
1021996376 7:26181805-26181827 TCATATCTAGAATTTCATTTGGG - Intronic
1022555202 7:31287280-31287302 TCATCTCTAAAAGTTCTATTTGG + Intergenic
1022588562 7:31639413-31639435 TCATCTCTAGACATTCAATTTGG + Intronic
1023075837 7:36482188-36482210 TCAGCTCTATCAGTTCAGTTTGG + Intergenic
1023665968 7:42523784-42523806 TCATCTCTTCTAGGTCAGCTGGG - Intergenic
1023785552 7:43704649-43704671 TCATTTCTGGAAGTTCAGTTTGG + Intronic
1024041089 7:45555325-45555347 TCTTCTCTTGATGGACAGTTAGG - Intergenic
1024310085 7:47961181-47961203 TCATCTCTTGATGGTCACTTAGG - Intronic
1024853251 7:53745367-53745389 TCATTTCCAGAAATTCAGTTTGG - Intergenic
1024941770 7:54770141-54770163 TCAGCTCTAGAAGTTCTGTTTGG - Intergenic
1025970854 7:66323987-66324009 TCATCTGTAGATGGACATTTAGG - Intronic
1026063924 7:67052481-67052503 TCATTTCTAGAAGTTCAGTTTGG + Intronic
1026714429 7:72774978-72775000 TCATTTCTAGAAGTTCAGTTTGG - Intronic
1026800578 7:73397654-73397676 TCTTCTCCAGCAGCTCAGTTTGG + Intergenic
1027026448 7:74855403-74855425 TTATCTATAGAAGTTCAATTTGG - Intergenic
1027061307 7:75088711-75088733 TTATCTATAGAAGTTCAATTTGG + Intergenic
1027808598 7:82862601-82862623 TCATCTGTTGATGGACAGTTAGG - Intronic
1027956616 7:84887018-84887040 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1028347144 7:89797468-89797490 TCATTTCTATCAGATCAGTTTGG + Intergenic
1028354083 7:89885584-89885606 TCATCTGTTGATGGTCACTTAGG + Intergenic
1028760246 7:94487893-94487915 TCATCTCTTGATGGACACTTAGG + Intergenic
1028785777 7:94791689-94791711 TCATTTCTAGAAGTTCACTCTGG + Intergenic
1028938929 7:96497960-96497982 TCATCTCTAAAAGTTCTATTTGG - Intronic
1029828527 7:103228086-103228108 TCATATCTAAAAGTTCATTTTGG - Intergenic
1030061622 7:105626134-105626156 TCATCTGTTGATGGACAGTTGGG - Intronic
1030129590 7:106187135-106187157 TCATCTCTGGAAGTTCAATTTGG + Intergenic
1030172190 7:106614512-106614534 TCATCTCTAGAAGTTTATTTTGG + Intergenic
1030374842 7:108743653-108743675 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1030625115 7:111836695-111836717 TCATCTCTAGAAGTTTAATTTGG - Intronic
1031013436 7:116547574-116547596 TCATCTCTAGCAAGTCAATGAGG - Intronic
1031053167 7:116966040-116966062 TTATTTCTAGAAAGTTAGTTGGG - Exonic
1032886841 7:136149696-136149718 TCATCTCTAGAAGTTTCATTTGG + Intergenic
1033410698 7:141115001-141115023 TGATCCCAAGAAGGTCAGTTAGG + Intronic
1033528006 7:142235387-142235409 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1033561073 7:142531493-142531515 TTATCTCTAGAAGCTTTGTTTGG - Intergenic
1033831654 7:145261947-145261969 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1035241080 7:157529646-157529668 TCATTTCTAGAAGTTTTGTTTGG + Intergenic
1037085610 8:14845651-14845673 TCATCTCTGAAAGTTCAATTTGG - Intronic
1037133328 8:15432852-15432874 TCCTCTCTCCCAGGTCAGTTAGG + Intronic
1037461356 8:19113268-19113290 TCATCTGTCGATGGTCACTTAGG + Intergenic
1037731548 8:21529003-21529025 TTATCTCTAGAACTTCAATTTGG + Intergenic
1038170519 8:25127597-25127619 TCAGCTCTAGAATATCTGTTTGG - Intergenic
1038690532 8:29758418-29758440 TCATCTGTAGATGGACACTTAGG + Intergenic
1038790655 8:30665386-30665408 TCATCTGTTGAAGGACACTTAGG + Intergenic
1039889917 8:41678663-41678685 TCATCTCTAGAAGATTGGCTTGG + Intronic
1040462688 8:47664064-47664086 TAGTCTCTAGAAAGTGAGTTTGG - Intronic
1040881758 8:52212777-52212799 TCATTTCTAGAAGAACATTTTGG + Intronic
1040931720 8:52742209-52742231 TAATCTCTAGAAGTTTAATTTGG - Intronic
1041023823 8:53664308-53664330 TCATCTGTAGAAGGACACTTAGG - Intergenic
1042163213 8:65919516-65919538 TCATCTCTTGATGGACATTTAGG - Intergenic
1043585303 8:81761542-81761564 TCATCTCCAGAACTTCAATTTGG - Intergenic
1043594226 8:81865038-81865060 TCAGCTCTAGAAGTTCAGTTTGG - Intergenic
1044185987 8:89252970-89252992 TCAGCTCTAGAAGTTCAATTTGG + Intergenic
1044394671 8:91696764-91696786 TCATCTCTTGATGGACAATTAGG + Intergenic
1045053263 8:98345821-98345843 TCATCTCTAGAAATTCAATTTGG - Intergenic
1045599916 8:103701827-103701849 TCATCTGTTGATGGTCATTTAGG + Intronic
1045661312 8:104440930-104440952 TCTTCTGTAAAAGGTCAGTGTGG + Intronic
1045676441 8:104613523-104613545 TCAGCTCTATCAGATCAGTTTGG + Intronic
1045760643 8:105602467-105602489 TCTTCTAGAGAAGGTCAGGTAGG - Intronic
1046216241 8:111151684-111151706 TCATTTCCAGAAGTTCATTTTGG + Intergenic
1046276196 8:111963938-111963960 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
1046694218 8:117320470-117320492 TCATCTCTAGAAGTTTACATTGG - Intergenic
1046795186 8:118364084-118364106 TCAGCTCTAAAAGGTCGGTTCGG - Intronic
1047159450 8:122361164-122361186 TCATCTCTCTCAGATCAGTTTGG + Intergenic
1047714182 8:127580490-127580512 TCATCTGTTGATGGACAGTTGGG - Intergenic
1047899887 8:129408647-129408669 TCATCCCTTGATGGACAGTTAGG + Intergenic
1048614756 8:136060572-136060594 TTAGCTCTAGAAGTTCAGTTTGG - Intergenic
1048907895 8:139105860-139105882 TCATCTCTAGCTGGTCACTCGGG - Intergenic
1049314681 8:141957749-141957771 CCATTTCTAGAAGTTCAATTTGG - Intergenic
1049318592 8:141983350-141983372 TGATCTATAGAGGGTCAGTGTGG - Intergenic
1049318736 8:141984209-141984231 TCATCTATGGATGGTCAGTTTGG - Intergenic
1050247801 9:3709348-3709370 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1050499257 9:6277873-6277895 TCATCTATTGAAGGGCATTTTGG - Intergenic
1051321486 9:15910220-15910242 TCATCTGTTGACGGACAGTTAGG + Intronic
1051646166 9:19270591-19270613 TCATCTCTTGATGGTTACTTGGG + Intronic
1051726388 9:20091007-20091029 TCATCTCTGTCAGATCAGTTAGG - Intergenic
1051932837 9:22407203-22407225 TCAGCTCTAGAATTTCAGTTTGG - Intergenic
1051946884 9:22580283-22580305 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1052895117 9:33740214-33740236 TCATTTCTAGAAGTTTAGTTAGG - Intergenic
1052954723 9:34244770-34244792 TCATCTCTTGATGGACACTTAGG + Intronic
1052958561 9:34274408-34274430 TCATCTCTTGATGGACACTTAGG - Intronic
1053180823 9:35968199-35968221 TCATCTCTTGATGGACACTTAGG + Intergenic
1053454108 9:38218588-38218610 TCATCTGTTGACGGACAGTTAGG + Intergenic
1055388225 9:75787972-75787994 TCAGCTCTGGAAGATCAGTTTGG + Intergenic
1055682399 9:78730141-78730163 TCATCTGTAGATGGCCATTTAGG - Intergenic
1055870180 9:80867776-80867798 TCATCCCTTGATGGACAGTTAGG + Intergenic
1056183460 9:84108158-84108180 TCTTCTCTAGAAGGGCCTTTGGG + Intergenic
1056422481 9:86442727-86442749 TCATTTCTAGAAGTTCTATTTGG + Intergenic
1056618551 9:88190390-88190412 TCATCTCTAGAAGTTTGATTTGG + Intergenic
1057029595 9:91765279-91765301 TCTTTTCTAGAAGGTCTGTTTGG + Intronic
1057191566 9:93091010-93091032 TCATCTCTTGATGGACACTTGGG + Intergenic
1057278755 9:93695301-93695323 TCACTTGTTGAAGGTCAGTTGGG - Intergenic
1057492607 9:95533313-95533335 TCATCTCTGGATGGACACTTAGG - Intergenic
1058198584 9:102009618-102009640 TCAGCTCTATCAGGTCAGTTTGG - Intergenic
1058768265 9:108204778-108204800 TCATCTGTTGATGGACAGTTAGG - Intergenic
1059100551 9:111467871-111467893 TGACCTCTGGCAGGTCAGTTAGG - Intronic
1059166758 9:112084242-112084264 TTATCTATAGAAGGTTATTTGGG - Intronic
1059378394 9:113904250-113904272 TCATCTCTAGAAGTTTGGTTTGG + Intronic
1059484183 9:114614311-114614333 TCAGCTCTGGAAGATCACTTAGG - Intronic
1059631167 9:116124304-116124326 TCTTCTGTAGAAAGTCACTTGGG + Intergenic
1059997016 9:119920934-119920956 TCATCTCTTGATGGACACTTAGG + Intergenic
1060609771 9:124952869-124952891 TCATCTCCAGAAGCACATTTTGG - Exonic
1061535112 9:131243003-131243025 TCATCTCTACAAGTTCAGCTGGG - Intergenic
1061892164 9:133628340-133628362 TCATCAGTAGATGGACAGTTGGG - Intergenic
1062742229 9:138182374-138182396 TCATCTGTAGATGGACATTTGGG + Intergenic
1203366770 Un_KI270442v1:265462-265484 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1186247831 X:7632664-7632686 TCAGCTTTAGAAGTTCAGTTTGG - Intergenic
1186696709 X:12041958-12041980 TCTCCTCTAGAATTTCAGTTTGG + Intergenic
1186777206 X:12877153-12877175 TCTTCTCTAGATGGTCTTTTGGG + Intronic
1187239556 X:17500243-17500265 TCATCTCTAGAAGCCCAGACTGG - Intronic
1187325193 X:18279668-18279690 TCAGTTCTAGAAGTTCAGTTTGG - Intronic
1187607673 X:20904625-20904647 TCAGCTCTAGTACATCAGTTTGG + Intergenic
1189532412 X:41900574-41900596 TCAGCTCTAGAATTTCTGTTTGG + Intronic
1190615824 X:52229873-52229895 TCATCTCTTGATGGACACTTAGG - Intergenic
1190865201 X:54378560-54378582 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1190891695 X:54573677-54573699 TCATCTCTAGAAATTAAATTTGG + Intergenic
1190957937 X:55214744-55214766 TCATCTGTCGAAGGACACTTAGG + Intronic
1191072657 X:56418584-56418606 TCATTTCCAGAAGTTCAGTTTGG - Intergenic
1191654236 X:63578269-63578291 TCAGCTCTATTAGCTCAGTTTGG - Intergenic
1191821624 X:65315975-65315997 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1191909493 X:66133171-66133193 TCATCTGTAGATGGACACTTAGG + Intergenic
1192633505 X:72795130-72795152 TCATCTGTAGATGGGCATTTAGG + Intronic
1192648204 X:72925671-72925693 TCATCTGTAGATGGGCATTTAGG - Intronic
1192711382 X:73593748-73593770 TCAATTCCAGAAGTTCAGTTTGG + Intronic
1192919853 X:75695157-75695179 TCAGCTCTAGAAGATTAGTCTGG - Intergenic
1192941277 X:75914031-75914053 TTATCTCTAGAAGTTCAGTATGG + Intergenic
1193165746 X:78278079-78278101 TCAGCTCTAGAAGATCAGTTTGG - Intronic
1193282101 X:79664625-79664647 TCAGCTCAAGAAGTTTAGTTTGG - Intergenic
1193341526 X:80354525-80354547 TCTTTTCCAGAAGTTCAGTTTGG + Intronic
1193354778 X:80505957-80505979 TCATCTCTTGATGGGCACTTAGG - Intergenic
1193479421 X:82009559-82009581 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1193499563 X:82258617-82258639 TCAGCTCTACCAGCTCAGTTTGG + Intergenic
1193575514 X:83190993-83191015 TTAGCTCTAGAAGATCAGTTTGG + Intergenic
1193673012 X:84412985-84413007 TCAGCTCTATCAGGTCAGTTTGG + Intronic
1193752614 X:85365091-85365113 TCAGCTCTATCAGATCAGTTAGG + Intronic
1194072880 X:89349749-89349771 TCAGCTCTAGAAGTTCAATTAGG + Intergenic
1194078356 X:89426263-89426285 TCAGCTGTAGAAAATCAGTTTGG - Intergenic
1194197463 X:90912978-90913000 TCAGTTCTAGAAGATCAGCTTGG - Intergenic
1194243418 X:91479828-91479850 TTAGCTCTAGAAGTTTAGTTTGG + Intergenic
1194245132 X:91501170-91501192 TCAGCTCTAGCAGTTTAGTTTGG - Intergenic
1194366593 X:93020617-93020639 TCAGCTCTAAAAGTTTAGTTTGG - Intergenic
1194468609 X:94264048-94264070 TCAGCTCTATAAGATCAGTTTGG - Intergenic
1194521759 X:94927911-94927933 TCATCTGTTGAGGGTCACTTAGG + Intergenic
1194589457 X:95780585-95780607 TTATCTCTCGAAAGTTAGTTTGG - Intergenic
1194750179 X:97675352-97675374 TCATCTCTTGATGGACATTTAGG + Intergenic
1194774528 X:97945548-97945570 TCAGCTCTATCAGCTCAGTTTGG - Intergenic
1194851470 X:98875217-98875239 TCATCTCTATCAGATTAGTTTGG + Intergenic
1195142546 X:101977434-101977456 TCATTTCCAGAAGTTCAGTTTGG + Intergenic
1195172780 X:102285424-102285446 TTAGCTCAAGCAGGTCAGTTTGG + Intergenic
1195186086 X:102401671-102401693 TTAGCTCAAGCAGGTCAGTTTGG - Intronic
1195804851 X:108752836-108752858 TCATCTGTTGAAGGACACTTAGG + Intergenic
1196394885 X:115248670-115248692 TCATGTCTAGATGTTCAGTTGGG - Intergenic
1196515156 X:116602144-116602166 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1196586939 X:117440702-117440724 TCAGCTCTATAAGATTAGTTTGG - Intergenic
1196595061 X:117536430-117536452 TCATTTCTAGAAGTTCAATTTGG + Intergenic
1197107580 X:122733878-122733900 TCATCTCTGGGATGTAAGTTTGG + Intergenic
1197518320 X:127464911-127464933 TCATCTGTTGATGGTCACTTAGG - Intergenic
1197781540 X:130165350-130165372 AAATCTCTTGAAGGTCAGGTCGG + Intronic
1197986783 X:132274604-132274626 TCATCTGTTGAAGGACACTTAGG + Intergenic
1197989080 X:132297671-132297693 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1198078344 X:133215319-133215341 TCATCTCTTGATGGCCAGTTGGG - Intergenic
1198277649 X:135111817-135111839 TCAGCTCAAGGAGTTCAGTTTGG + Intergenic
1199240184 X:145538133-145538155 TCACCTCTATAAGTTCATTTTGG - Intergenic
1199259138 X:145750386-145750408 TCATCTGTTGATGGACAGTTAGG - Intergenic
1199308345 X:146293264-146293286 TCATCTCTTGATGGACATTTAGG + Intergenic
1199400306 X:147390762-147390784 TCAGCTCTATTAGCTCAGTTTGG - Intergenic
1199407909 X:147484690-147484712 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1199521107 X:148736899-148736921 TGCTCTGTAGAAGATCAGTTGGG + Intronic
1199550333 X:149055033-149055055 TCATCTCCATAAGATCATTTGGG + Intergenic
1199620237 X:149693960-149693982 TCATCTCTTGATGGACATTTAGG + Intronic
1199674829 X:150179581-150179603 TCATTTTTAGAAGTTCAATTTGG + Intergenic
1199786815 X:151113322-151113344 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1200316136 X:155135157-155135179 TCATCTCTAGAAGTTCCATTTGG - Intronic
1200430997 Y:3081795-3081817 TCAGCTGTAGAAAATCAGTTTGG - Intergenic
1200544262 Y:4499819-4499841 TCAGTTCTAGAAGATCAGCTTGG + Intergenic
1200545152 Y:4510449-4510471 TTAGCTCCAGAAGTTCAGTTTGG + Intergenic
1200562401 Y:4721203-4721225 TTAGCTCTAGAAGTTTAGTTTGG + Intergenic
1200564105 Y:4742480-4742502 TCAGCTCTAGCAGTTTAGTTTGG - Intergenic
1200674822 Y:6136878-6136900 TCAGCTCTAAAAGTTTAGTTTGG - Intergenic
1200727120 Y:6685489-6685511 TCAGGTCTAGAAGTTCAATTAGG + Intergenic
1200728272 Y:6701264-6701286 TCAGGTCTAGAAGTTCAATTAGG + Intergenic
1201012144 Y:9557541-9557563 TCAGCTGAAGAAGCTCAGTTAGG + Intergenic
1202021674 Y:20471476-20471498 TTATCTCAAGAAGCTCAGCTTGG + Intergenic