ID: 917894765

View in Genome Browser
Species Human (GRCh38)
Location 1:179477383-179477405
Sequence GTCTCACAGTTCCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21477
Summary {0: 4, 1: 629, 2: 4728, 3: 7886, 4: 8230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917894762_917894765 15 Left 917894762 1:179477345-179477367 CCAAGACTGGGCAATTTACAAAA 0: 1023
1: 1194
2: 1169
3: 4779
4: 5078
Right 917894765 1:179477383-179477405 GTCTCACAGTTCCACGTGGCTGG 0: 4
1: 629
2: 4728
3: 7886
4: 8230
917894761_917894765 16 Left 917894761 1:179477344-179477366 CCCAAGACTGGGCAATTTACAAA 0: 669
1: 2285
2: 5340
3: 12814
4: 14384
Right 917894765 1:179477383-179477405 GTCTCACAGTTCCACGTGGCTGG 0: 4
1: 629
2: 4728
3: 7886
4: 8230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917894765 Original CRISPR GTCTCACAGTTCCACGTGGC TGG Intronic
Too many off-targets to display for this crispr