ID: 917895983

View in Genome Browser
Species Human (GRCh38)
Location 1:179487704-179487726
Sequence ATCACGCCTGGCCTGATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917895983_917895990 19 Left 917895983 1:179487704-179487726 CCATCAATCAGGCCAGGCGTGAT 0: 1
1: 0
2: 4
3: 17
4: 143
Right 917895990 1:179487746-179487768 ACACTTTGTAAGGCCAAGGTGGG 0: 2
1: 185
2: 4980
3: 49505
4: 161322
917895983_917895991 22 Left 917895983 1:179487704-179487726 CCATCAATCAGGCCAGGCGTGAT 0: 1
1: 0
2: 4
3: 17
4: 143
Right 917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731
917895983_917895989 18 Left 917895983 1:179487704-179487726 CCATCAATCAGGCCAGGCGTGAT 0: 1
1: 0
2: 4
3: 17
4: 143
Right 917895989 1:179487745-179487767 GACACTTTGTAAGGCCAAGGTGG 0: 1
1: 7
2: 470
3: 9398
4: 80352
917895983_917895988 15 Left 917895983 1:179487704-179487726 CCATCAATCAGGCCAGGCGTGAT 0: 1
1: 0
2: 4
3: 17
4: 143
Right 917895988 1:179487742-179487764 CTCGACACTTTGTAAGGCCAAGG 0: 1
1: 1
2: 74
3: 2802
4: 21850
917895983_917895987 9 Left 917895983 1:179487704-179487726 CCATCAATCAGGCCAGGCGTGAT 0: 1
1: 0
2: 4
3: 17
4: 143
Right 917895987 1:179487736-179487758 CTGTAACTCGACACTTTGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917895983 Original CRISPR ATCACGCCTGGCCTGATTGA TGG (reversed) Intronic
900979410 1:6037848-6037870 ATCGTGCCTGGCCTGAATGAGGG + Intronic
901287382 1:8091647-8091669 ACCACGCCTGGCTTCATTGGAGG + Intergenic
902863545 1:19262510-19262532 ATCACGCCTGGCCAAATGCAAGG - Intergenic
903064744 1:20693059-20693081 ATCACGCCTGGCCTGTTTGTGGG + Intronic
904146986 1:28400867-28400889 ACCACGCCCGGCCTGAGTGAAGG + Intronic
904726264 1:32550667-32550689 AACACGCCTGGCCTAATTTGTGG - Intronic
905228886 1:36499471-36499493 ATCACGCCTGGCCTGATTTTGGG + Intergenic
907365279 1:53953646-53953668 ACCACGCCTGGCCTACTTGTAGG + Intronic
908557668 1:65273307-65273329 ACCACGCCTGGCCGGCTTAAAGG - Intronic
909109462 1:71456395-71456417 ATCACACCTGGCCTCAGTAAGGG + Intronic
917011857 1:170483513-170483535 AGAACCCCTGGCCTGAGTGAAGG - Intergenic
917895983 1:179487704-179487726 ATCACGCCTGGCCTGATTGATGG - Intronic
918179544 1:182074511-182074533 ATCCTGCCTGGCATGTTTGATGG + Intergenic
920169635 1:204063473-204063495 ATCAGGCCTGGCCTCATGGGTGG - Intergenic
922967016 1:229698918-229698940 ACCACGCCTGGCCTGTTTTTTGG - Intergenic
1062968591 10:1629049-1629071 TTCACGCCTGTCCTCACTGAGGG - Intronic
1064081802 10:12314027-12314049 AACAAGCCTGTGCTGATTGATGG + Intergenic
1064448249 10:15416728-15416750 ACCACGCCTGGCCTGTTGGAAGG - Intergenic
1065851574 10:29794479-29794501 ACCACGCCTGGCCTATTTTATGG - Intergenic
1071453767 10:85826035-85826057 AACGCGCCTAGCCTGATTGCGGG - Intronic
1072134262 10:92528785-92528807 ATCACGCCTGGTCTCATCAAGGG - Intronic
1072789896 10:98310314-98310336 ACCATGCCTGGCCTGCTTGGTGG - Intergenic
1073728863 10:106267776-106267798 CTCACGCCTGGCCTGGCTGTGGG + Intergenic
1074843543 10:117376722-117376744 ACCACGCCCGGCCGGCTTGAAGG - Intergenic
1077582510 11:3425621-3425643 ACCACGCCTGGCCTCACTGAAGG + Intergenic
1078992361 11:16662846-16662868 ATCACGCCTGGCTTTTTTGGGGG + Intronic
1086114035 11:83228516-83228538 ACCATGCCTGGCCTGATGGCAGG + Intronic
1089212728 11:116816906-116816928 ATCACGCCTGGCCTCAATCAAGG + Intergenic
1090100115 11:123785901-123785923 ACCACGCCTGGCCTGGTGGGAGG + Intergenic
1090400221 11:126444090-126444112 ATCACACCAGGCCTGAATGATGG - Intronic
1096500898 12:52063315-52063337 GCCACGCCAGGCCTGATTTATGG - Intergenic
1099929303 12:89055160-89055182 CTCATGCCTGGCCTGAGTGTTGG - Intergenic
1101959581 12:109238852-109238874 ACCACGCCTGGCCCTATTGATGG + Intronic
1104524442 12:129505530-129505552 ACCACGCCTGGCCTGTTCCAAGG + Intronic
1106897929 13:34325113-34325135 TTCAAGCCAGGCCTGATTGTGGG + Intergenic
1108543188 13:51463438-51463460 ACCACGCCTGGCCAGTTTTATGG + Intergenic
1110531518 13:76603698-76603720 ATCACCTCTGGAGTGATTGATGG - Intergenic
1113103372 13:106745672-106745694 AACATTCCTGGCCTTATTGAAGG + Intergenic
1115233483 14:31186396-31186418 ACCATGCCTGGCCTAATTGGTGG - Intronic
1116004540 14:39278251-39278273 ACCACGCCTGGCCTAATTTTGGG + Intronic
1116175996 14:41471067-41471089 TTGATGCCTGGACTGATTGATGG - Intergenic
1117287641 14:54302357-54302379 ATCTAGCCTATCCTGATTGATGG - Intergenic
1117333447 14:54736684-54736706 GTCAAGCCTTGCCTGATTTACGG + Intronic
1117398724 14:55338617-55338639 ACCACGCCTGGCCTGTTTTTAGG - Intronic
1117897988 14:60507654-60507676 ATCACGCCACGCCTGAGTGCAGG - Intronic
1118229899 14:63938165-63938187 ATCACACCTGGCCTTATTCTTGG - Intronic
1118887512 14:69879341-69879363 AGCACGGCGGGCCTGATTGACGG - Intronic
1124920734 15:34023694-34023716 TTTAAGCCTGGCGTGATTGAAGG - Intronic
1131126735 15:89865041-89865063 ACCAAGCCTGTCCTGACTGATGG - Intronic
1132435857 15:101801969-101801991 ATAACGCCAGGCCAGATTGAAGG - Intergenic
1135190091 16:20347839-20347861 ATCAGGCCTGAGCTGATTGGTGG + Intronic
1137953076 16:52802035-52802057 ACCACGCCTGGCCTGGGTCAAGG - Intergenic
1140126135 16:72120362-72120384 GTCAGGCCTGGCCTGACTGATGG + Intronic
1141959503 16:87395032-87395054 ACCACGCCTGGCCTGGGGGAGGG + Intronic
1146330954 17:31926807-31926829 ACCACGCCTGGCCTGACTTGAGG + Intergenic
1146443426 17:32916867-32916889 ACCACGCCTGGCCCGGTTCATGG - Intergenic
1146512899 17:33465661-33465683 ACCACGCCTGGCCTGAGTGTGGG + Intronic
1148534236 17:48424968-48424990 ACCCCGCCTGGCCTTACTGAGGG - Intronic
1148895869 17:50838766-50838788 GTCACGCCTGCCCTGACTGTTGG + Intronic
1150133751 17:62682928-62682950 ACCGCGCCCGGCCTGATTGCCGG + Intronic
1150709068 17:67514485-67514507 ATCATGCCTGGCCAAATTCACGG + Intronic
1150718777 17:67596663-67596685 ACCACGCCTGGCTTGAGAGATGG + Intronic
1151113611 17:71707202-71707224 ACCATTCCTGGCCTGATTGTGGG - Intergenic
1151534642 17:74731716-74731738 ACCACGCCTGGCCTGAGTGAAGG - Intronic
1152344789 17:79744613-79744635 ACCATGCCTGGCCTAATTTAAGG + Intergenic
1153860260 18:9195847-9195869 ATCACACTTGGCATGATAGATGG - Intronic
1154087985 18:11326008-11326030 ATCACGCCTGGCCGTAGAGATGG + Intergenic
1157295740 18:46441597-46441619 ACCGCGCCTGGCCTGATCAAAGG - Intronic
1160978189 19:1804202-1804224 ACCACACCCGGCCTGCTTGACGG - Intronic
1162314767 19:9931856-9931878 ATCACACCTGGCCTGAAGAATGG + Intronic
1163628712 19:18405369-18405391 ATCACGCCTGGCGTGGGGGAGGG - Intergenic
925195279 2:1918452-1918474 ATCATGATTGGCCTGATTAATGG - Intronic
925933774 2:8733475-8733497 AACACGCTTGGCCTGGATGAAGG - Exonic
928073036 2:28236653-28236675 ACCATGCCTGGCCTGAAAGAAGG + Intronic
928340061 2:30435218-30435240 ACCACACCTGGCCTGGTTTATGG - Intergenic
928574401 2:32640067-32640089 ATCCAGCCTGCCCTGATGGATGG - Intronic
930491101 2:52073394-52073416 GTCAAGCCTCACCTGATTGAAGG + Intergenic
933755269 2:85633410-85633432 ACCATGCCCGGCCTCATTGAAGG + Intronic
936723831 2:115288426-115288448 ACCACGCCTGACCAGGTTGAGGG - Intronic
938067668 2:128290680-128290702 ACCACGCCTGGCCAAATTAAGGG - Intronic
940867342 2:158830471-158830493 ATCACACGTGTCCTGATAGAAGG - Intronic
941328425 2:164145418-164145440 TTCTCCCCAGGCCTGATTGAGGG - Intergenic
944825283 2:203477112-203477134 ATGACGCTTGGCCTGCTTGCTGG + Intronic
1173300023 20:41794240-41794262 ACCGCGCCTGGCCTGAGGGAAGG + Intergenic
1174879720 20:54265942-54265964 ACCACGCCCGGCCTGTTTGCAGG - Intergenic
1175344890 20:58265725-58265747 ATCACACCTGGCTTCAGTGAGGG + Intergenic
1177792051 21:25732674-25732696 ATCACGCCCGGCCTGATTGTAGG - Intronic
1180225691 21:46390878-46390900 AGCAGGCCTGGCCTCACTGAGGG + Intronic
1180747628 22:18101853-18101875 ACAACGCCTGGCATGATTGAGGG + Exonic
1181172727 22:21018908-21018930 ACCACGCCCGGCCTGATTTCTGG + Intronic
1182027526 22:27132192-27132214 ATCACACCTGGCCTGCCTGCAGG - Intergenic
1183555860 22:38526495-38526517 ACCACGCCTGGCCAAATTTATGG + Intronic
950117058 3:10457924-10457946 CTCACGCCTGGCCTGAGGAAGGG + Intronic
952380324 3:32799467-32799489 ACCACACCTGGCCTGTTTGTGGG - Intergenic
952702549 3:36342022-36342044 ATGACCACTTGCCTGATTGAGGG - Intergenic
953639465 3:44692873-44692895 ATCATGCCTGGCCTTGCTGAGGG - Intergenic
953945822 3:47146645-47146667 ATCATGCCTGGCCTATATGAAGG - Intronic
955501510 3:59588951-59588973 ATCACGTCTGGCCTGTTACATGG - Intergenic
960014921 3:112876232-112876254 ACTACGCCTGGCCTAATTTAGGG + Intergenic
960958271 3:123050563-123050585 ATCACCACTGGCCTCCTTGAAGG - Intergenic
961058530 3:123809233-123809255 ACCACGCCTGGCCTGCTTAGAGG - Intronic
961889015 3:130114578-130114600 ACCATGCCTGGCCTCACTGAAGG + Intergenic
963105859 3:141646548-141646570 ATCGCGCCTGGCCTAATTTGGGG + Intergenic
963794435 3:149617508-149617530 ACTGCGCCTGGCCTGATTTATGG - Intronic
966513134 3:180786414-180786436 ATCACGCCCACCCAGATTGAGGG - Intronic
968227258 3:196981081-196981103 ACCACGCCTGGCCTCATATAAGG - Intergenic
972487041 4:39551791-39551813 ATAATTTCTGGCCTGATTGAAGG - Exonic
973727128 4:53787970-53787992 TTAAAGGCTGGCCTGATTGATGG - Intronic
973818359 4:54639876-54639898 ATCAGGCCAGGCCTGGTTAAAGG - Intergenic
974124987 4:57685223-57685245 ATCCAGCCTGGCCTGAGAGAAGG + Intergenic
974410729 4:61538729-61538751 ACCATGCCTGGCCTGATAGCAGG + Intronic
978329236 4:107594451-107594473 ACCACTCCTGGCCTGATGGATGG - Intronic
980766702 4:137315544-137315566 ACCACACCTGGCCTGTTTGTTGG + Intergenic
985001502 4:185488365-185488387 ACCACGCCTGGCCTGTTGGGTGG + Intergenic
986921134 5:12683418-12683440 ATCACGCCCGCCCACATTGAGGG - Intergenic
988454575 5:31375787-31375809 ACCACGCCTGGCCTGAGGCAGGG + Intergenic
992629730 5:78668552-78668574 ACCGCGCCTGGCCTCATTGATGG + Intronic
998600591 5:143581173-143581195 AACATGCCTGGTCTGCTTGAGGG + Intergenic
999472083 5:151864005-151864027 TTCAGGCCTGGCCTGAGTGTTGG + Intronic
1000071204 5:157742672-157742694 ACCGCGCCCGGCCTGCTTGATGG + Intergenic
1000139674 5:158389953-158389975 ATTATGCCTAGCCAGATTGATGG + Intergenic
1000965908 5:167656361-167656383 AGCACGCATGGCCTGTTTGCAGG + Intronic
1001277019 5:170358481-170358503 CTCCAGCCTGGCCTGCTTGAAGG - Intronic
1001690510 5:173629400-173629422 AACAAGCCTGGCCTGACCGAGGG + Intergenic
1004142145 6:13027964-13027986 AACGCGCCTGGCCTGATATATGG + Intronic
1004262863 6:14123386-14123408 ACCACGCCCGGCCTCACTGAAGG + Intronic
1004814329 6:19296344-19296366 ATCACGCCCGGCCTAAATAACGG - Intergenic
1005951660 6:30636293-30636315 ACCACGCCTGGCCTGAAAGGTGG - Intronic
1011513940 6:88131775-88131797 ACCACGCCTGGCCTAATGAAAGG - Intergenic
1016838855 6:148506056-148506078 ACCACGCCCGGCCTGGTTGTTGG + Intronic
1018312507 6:162525446-162525468 ATCAAGCCTGGCCTCTCTGAGGG - Intronic
1018622204 6:165740620-165740642 ACCACTCCTGGCCTGTGTGATGG + Intronic
1019843953 7:3477801-3477823 ACCACACCTGGCCTGCTTTATGG + Intronic
1022611031 7:31873355-31873377 ATCCCCACTGGCCTCATTGAGGG + Exonic
1024042746 7:45567871-45567893 ATCAGGCCAGGCCTGAGTGCTGG - Intergenic
1025055518 7:55761692-55761714 ACCACGCCTGGCCTGATGCCAGG - Intergenic
1025223455 7:57136092-57136114 ACCATGCCTGGCCTGTTTCAGGG - Intronic
1025634263 7:63307718-63307740 ACCATGCCTGGCCTGTTTCAGGG - Intergenic
1025648435 7:63440448-63440470 ACCATGCCTGGCCTGTTTCAGGG + Intergenic
1025910438 7:65824461-65824483 ACCACGCCTGGCCTGATGCCAGG + Intergenic
1026124300 7:67565967-67565989 ATCATGCCTGGCCTCATCCATGG + Intergenic
1027135579 7:75621679-75621701 ATCAATTCTGTCCTGATTGAAGG - Intronic
1028527568 7:91802317-91802339 AGCACGCCTGGCCTATTCGATGG - Intronic
1029377331 7:100187310-100187332 ATCGCGCCTGGCCTGTTTTTTGG + Intronic
1032663991 7:134016662-134016684 ATCATTCCTGGCCTTAGTGAAGG - Intronic
1033171804 7:139091208-139091230 ACCGCGCCTGGCCTGCTGGAGGG - Intronic
1036379087 8:8225461-8225483 ACCACGCCCGGCCTCACTGAAGG - Intergenic
1036850475 8:12197150-12197172 ACCACGCCCGGCCTCACTGAAGG + Intergenic
1036871840 8:12439423-12439445 ACCACGCCCGGCCTCACTGAAGG + Intergenic
1036931747 8:12962778-12962800 ACTGCGCCTGGCCAGATTGATGG + Intronic
1044108597 8:88243278-88243300 ATCCTGCCTGGCATGATTTAGGG + Intronic
1046748372 8:117900200-117900222 ATGACGCCTGAGCTGACTGATGG + Intronic
1049792997 8:144481176-144481198 ACCGCGCCCGGCCTGTTTGATGG + Intronic
1053120529 9:35543756-35543778 ACCACGCCTGGCCTGATTTCAGG + Intronic
1058025528 9:100138993-100139015 ACCGCGCCCGGCCTTATTGATGG + Intronic
1059960982 9:119564328-119564350 ACCACGCCTGGCCCCACTGATGG - Intergenic
1060646216 9:125282424-125282446 ACCACTCCTGGCCTGATAGTCGG + Intronic
1061092970 9:128437075-128437097 ACCCTGCCTGGCCTGATTCAGGG + Exonic
1062167602 9:135115699-135115721 ATCACCACTGGCCAGATTGGTGG + Intronic
1185545933 X:944215-944237 ATGATGCCTGCCCAGATTGAAGG - Intergenic
1188696023 X:33191711-33191733 ACCATGCCTGGCCTGCTTTATGG + Intronic
1190396264 X:49988242-49988264 ATCACCCCTGGCCTGGGTGATGG - Intronic
1190567057 X:51741885-51741907 ACCACGCCTGGCCTCATAGTTGG - Intergenic
1195896827 X:109753871-109753893 ATCACACCTGGCCTAATTGCTGG - Intergenic
1199837630 X:151607883-151607905 AACATCCCTGGCTTGATTGAGGG + Intronic