ID: 917895985

View in Genome Browser
Species Human (GRCh38)
Location 1:179487716-179487738
Sequence CAGGCATGAGCCATCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378926
Summary {0: 206, 1: 7388, 2: 47444, 3: 131710, 4: 192178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917895985_917895991 10 Left 917895985 1:179487716-179487738 CCAGGCGTGATGGCTCATGCCTG 0: 206
1: 7388
2: 47444
3: 131710
4: 192178
Right 917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731
917895985_917895993 27 Left 917895985 1:179487716-179487738 CCAGGCGTGATGGCTCATGCCTG 0: 206
1: 7388
2: 47444
3: 131710
4: 192178
Right 917895993 1:179487766-179487788 GGGAGGATTGCTTTAAGCCCAGG 0: 3
1: 22
2: 168
3: 581
4: 2076
917895985_917895987 -3 Left 917895985 1:179487716-179487738 CCAGGCGTGATGGCTCATGCCTG 0: 206
1: 7388
2: 47444
3: 131710
4: 192178
Right 917895987 1:179487736-179487758 CTGTAACTCGACACTTTGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 189
917895985_917895989 6 Left 917895985 1:179487716-179487738 CCAGGCGTGATGGCTCATGCCTG 0: 206
1: 7388
2: 47444
3: 131710
4: 192178
Right 917895989 1:179487745-179487767 GACACTTTGTAAGGCCAAGGTGG 0: 1
1: 7
2: 470
3: 9398
4: 80352
917895985_917895990 7 Left 917895985 1:179487716-179487738 CCAGGCGTGATGGCTCATGCCTG 0: 206
1: 7388
2: 47444
3: 131710
4: 192178
Right 917895990 1:179487746-179487768 ACACTTTGTAAGGCCAAGGTGGG 0: 2
1: 185
2: 4980
3: 49505
4: 161322
917895985_917895988 3 Left 917895985 1:179487716-179487738 CCAGGCGTGATGGCTCATGCCTG 0: 206
1: 7388
2: 47444
3: 131710
4: 192178
Right 917895988 1:179487742-179487764 CTCGACACTTTGTAAGGCCAAGG 0: 1
1: 1
2: 74
3: 2802
4: 21850

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917895985 Original CRISPR CAGGCATGAGCCATCACGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr