ID: 917895986

View in Genome Browser
Species Human (GRCh38)
Location 1:179487735-179487757
Sequence CTTACAAAGTGTCGAGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917895986_917895993 8 Left 917895986 1:179487735-179487757 CCTGTAACTCGACACTTTGTAAG 0: 1
1: 0
2: 1
3: 5
4: 209
Right 917895993 1:179487766-179487788 GGGAGGATTGCTTTAAGCCCAGG 0: 3
1: 22
2: 168
3: 581
4: 2076
917895986_917895991 -9 Left 917895986 1:179487735-179487757 CCTGTAACTCGACACTTTGTAAG 0: 1
1: 0
2: 1
3: 5
4: 209
Right 917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731
917895986_917895996 26 Left 917895986 1:179487735-179487757 CCTGTAACTCGACACTTTGTAAG 0: 1
1: 0
2: 1
3: 5
4: 209
Right 917895996 1:179487784-179487806 CCAGGAATTTAAGACCAACCTGG 0: 2
1: 391
2: 7751
3: 60287
4: 183456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917895986 Original CRISPR CTTACAAAGTGTCGAGTTAC AGG (reversed) Intronic
901567402 1:10129908-10129930 CTCCCAAAGTGTTGGGTTACAGG + Intronic
902324778 1:15692693-15692715 CTCCCAAAGTGTGGGGTTACAGG + Intronic
904181077 1:28667098-28667120 CTCCCAAAGTGTTGAATTACAGG - Intergenic
904724127 1:32533815-32533837 CTCCCAAAGTGTGGAATTACAGG + Intronic
904760790 1:32803234-32803256 CTCCCAAAGTGCTGAGTTACAGG + Intronic
904969955 1:34411709-34411731 CTTATAAAGTGCTGAATTACAGG + Intergenic
906671442 1:47658066-47658088 CTTACACAGTAACGATTTACAGG - Intergenic
908206701 1:61858061-61858083 CTTACAAATTGTCCAGTCTCAGG - Intronic
908235701 1:62145696-62145718 CTCCCAAAGTGCTGAGTTACAGG - Intronic
908466975 1:64405921-64405943 CTTCCAAACTGTCCTGTTACAGG + Intergenic
908717415 1:67085010-67085032 CTCTCAAAGTGTGGAATTACAGG + Intergenic
910695391 1:90008331-90008353 CTTACAATATGTCCAGTTGCTGG + Intronic
913425999 1:118730435-118730457 CTCCCAAAGTGCTGAGTTACAGG - Intergenic
913707570 1:121442008-121442030 TTTACAAATTGTCCAGTTTCAGG + Intergenic
915200819 1:154227078-154227100 CTCCCAAAGTGTGGAATTACAGG + Intronic
915202793 1:154245180-154245202 CTCCCAAAGTGCCGAGTTACAGG + Intronic
915393946 1:155567775-155567797 CTCCCAAAGTGTGGGGTTACAGG - Intergenic
917895986 1:179487735-179487757 CTTACAAAGTGTCGAGTTACAGG - Intronic
923412588 1:233725017-233725039 CTTCCAAAGTGTGGGATTACAGG + Intergenic
1063766151 10:9142799-9142821 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1065352899 10:24811518-24811540 CTCCAAAAGTGTGGAGTTACAGG + Intergenic
1066092898 10:32043372-32043394 CTTACTAGCTGTGGAGTTACAGG - Intronic
1071546254 10:86532050-86532072 CTTCCAAAGTGTGGGATTACAGG - Intergenic
1071866881 10:89744874-89744896 CTTACAAAGTGATGAGATAGTGG + Intronic
1073412276 10:103351886-103351908 CTCCCAAAGTGTTGGGTTACAGG + Intergenic
1074112553 10:110432833-110432855 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1076149154 10:128149255-128149277 CTTCCAAAGTGCTGAATTACAGG + Intergenic
1078133426 11:8632716-8632738 CTTCCAAAGTGTGGGATTACAGG + Intronic
1081259338 11:40939581-40939603 TATACAAAGTGTCTAGTTTCTGG - Intronic
1082635791 11:55591645-55591667 CTTCCAAAGTGCTGGGTTACAGG + Intergenic
1082813866 11:57495566-57495588 CTTCCAAAGTGTCCGATTACAGG - Intronic
1086661430 11:89423794-89423816 CTTTCAAAGTGTTGGATTACAGG - Intronic
1087038648 11:93777563-93777585 CTCCCAAAGTGTCGGATTACAGG + Intronic
1095050487 12:37549830-37549852 CTTCCAAAGTGTGCGGTTACAGG - Intergenic
1096990898 12:55801873-55801895 CTCCCAAAGTGCTGAGTTACAGG + Intronic
1097413533 12:59284405-59284427 CTTACAAAGATACTAGTTACTGG + Intergenic
1097791527 12:63820855-63820877 CTCCCAAAGTGTTGGGTTACAGG - Intergenic
1098171684 12:67753359-67753381 CTCCCAAAGTGTCGGATTACAGG + Intergenic
1099825750 12:87775236-87775258 CTTCCAAAGTGTGGGATTACAGG + Intergenic
1102155511 12:110724301-110724323 CTTCCAAAGTGCTGGGTTACAGG - Intronic
1102334781 12:112069246-112069268 CTTCCAAAGTGTGGGATTACAGG - Intronic
1102990231 12:117310163-117310185 CTTCCAAAGTGTTGGATTACAGG + Intronic
1103946891 12:124531912-124531934 CTCACAGAGTTTCGAGTCACGGG + Intronic
1106672915 13:31926643-31926665 CTTCCAAAGTGCTGGGTTACAGG + Intergenic
1108437201 13:50412120-50412142 CTTCCAAAGAGTGGAATTACTGG - Intronic
1115159473 14:30377143-30377165 CTCCCAAAGTGTTGGGTTACAGG + Intergenic
1116720335 14:48487779-48487801 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1117713566 14:58557775-58557797 TATACAAAGTGTAGAGTTGCTGG + Intergenic
1117941186 14:60966769-60966791 CTTCCAAAGTGCTGGGTTACAGG + Intronic
1118276397 14:64389364-64389386 ATTACAAAGTTAGGAGTTACAGG - Intronic
1118635279 14:67743093-67743115 CTTCCAAAGTGTTGGGTTATAGG + Intronic
1118992117 14:70807231-70807253 CTTCCAAAGTGTTGGATTACAGG - Intronic
1119416203 14:74471337-74471359 CTCACAAAGTGTTGTATTACAGG - Intergenic
1120472973 14:84949962-84949984 CTTACAAAGTTTGGGGTTTCTGG + Intergenic
1121077958 14:91084962-91084984 CTTCCAAAGTGTGGGATTACAGG - Intronic
1121756760 14:96409312-96409334 CTCCCAAAGTGCCGGGTTACAGG - Intronic
1123406984 15:20026039-20026061 CTTCCAAAGTGCCGGGATACAGG + Intergenic
1123458109 15:20444169-20444191 CCTACAAACTGTCCAGTTGCTGG - Intergenic
1123516315 15:21032695-21032717 CTTCCAAAGTGCCGGGATACAGG + Intergenic
1123659959 15:22556240-22556262 CCTACAAACTGTCCAGTTGCTGG + Intergenic
1124313820 15:28650735-28650757 CCTACAAACTGTCCAGTTGCTGG + Intergenic
1124387563 15:29223242-29223264 CTTGAAAAGTTTCGAGTTCCAGG + Intronic
1125014585 15:34919637-34919659 CTCCCAAAGTGTTGGGTTACAGG - Intronic
1127098550 15:55537570-55537592 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1128572447 15:68744282-68744304 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1129040650 15:72683581-72683603 CTCCCAAAGTGTGGAATTACAGG - Intronic
1129049132 15:72763442-72763464 CTTCCAAAGTGCCGGATTACAGG + Intronic
1129630069 15:77249078-77249100 CTCCCAAAGTGTTGGGTTACAGG + Intronic
1130361581 15:83192240-83192262 CTTAGAAAGAGGTGAGTTACAGG - Intronic
1133261627 16:4554610-4554632 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1135266015 16:21026443-21026465 CTCCCAAAGTGTGGAATTACAGG - Intronic
1136750773 16:32633837-32633859 CTCCCAAAGTGTGGAATTACAGG - Intergenic
1137252871 16:46752614-46752636 CTCCCAAAGTGTGGGGTTACAGG - Intronic
1141517335 16:84554349-84554371 CTTATAAAGTGTCCAGTCTCAGG - Intergenic
1143507207 17:7373921-7373943 CTTCCAAAGTGCTGAGATACAGG - Intergenic
1145305536 17:21672586-21672608 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1145325203 17:21816842-21816864 CTCCCAAAGTGTTGAATTACAGG + Intergenic
1145371123 17:22306929-22306951 CTCCCAAAGTGTGGGGTTACAGG - Intergenic
1146396720 17:32473670-32473692 CTCCCAAAGTGTGGATTTACAGG + Intronic
1148207671 17:45789633-45789655 CTCCCAAAGTGTAGGGTTACAGG + Intronic
1148340575 17:46871163-46871185 CTCCCAAAGTGTGGAATTACAGG + Intronic
1150068649 17:62133192-62133214 CTCCCAAAGTGTTGGGTTACAGG + Intergenic
1152418370 17:80177800-80177822 CTTTCAAAGTGTGGGATTACAGG + Intronic
1153221984 18:2869981-2870003 CTCCCAAAGTGTCGTGTTACAGG - Intronic
1153668391 18:7386697-7386719 CTTACAAATTGTCCAGCTGCAGG + Intergenic
1154946351 18:21165766-21165788 CTCCCAAAGTGTTGGGTTACAGG - Intergenic
1155046302 18:22106344-22106366 CTTCCAAAGTGCTGGGTTACAGG + Intergenic
1155577351 18:27262793-27262815 CTTACAATGGGTTGTGTTACAGG - Intergenic
1156098771 18:33567642-33567664 CTTAGAATGTATCTAGTTACTGG + Intergenic
1156444823 18:37228559-37228581 CTCACAAAGTGTGGGATTACAGG - Intronic
1159027675 18:63200878-63200900 CTTCCAAAGTGCTGAGATACAGG + Intronic
1161449422 19:4336569-4336591 CTCCCAAAGTGTTGGGTTACAGG + Intronic
1161916937 19:7235589-7235611 CTTCCAAAGTGTTGGATTACAGG - Intronic
1162001966 19:7750610-7750632 CTTACAAATTGCCCAGTTTCAGG - Intergenic
1162206768 19:9062041-9062063 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1162863482 19:13525799-13525821 CTTAAAATGTTTCGAGTTATAGG + Intronic
1163087094 19:14989516-14989538 CTCCCAAAGTGTGGAATTACAGG + Intronic
1163562715 19:18029913-18029935 TTTACTAAGTATCGAGTGACAGG + Intergenic
1163758057 19:19118705-19118727 CTCCCAAAGTGTTGGGTTACAGG + Intergenic
1165455918 19:35910383-35910405 CTTCCAAAGTGTTGGATTACAGG - Intergenic
1165892652 19:39123611-39123633 CTTCCAAAGTGTTGGATTACAGG - Intergenic
1166181124 19:41109677-41109699 CTCCCAAAGTGCCGAATTACAGG + Intergenic
1166617246 19:44261180-44261202 CTTCCAAAGTGTGGGATTACAGG - Intronic
1167584149 19:50363820-50363842 CTTCCAAAGTGCTGGGTTACAGG + Intronic
1168190262 19:54733272-54733294 CTCCCAAAGTGTTGGGTTACAGG - Intronic
1168223369 19:54977068-54977090 CTCCCAAAGTGTTGGGTTACAGG + Intronic
1168552215 19:57305757-57305779 CTTCCAAAGTGTTGGATTACAGG + Intergenic
927959137 2:27229526-27229548 CTTCCAAAGTGTTGGATTACAGG + Intronic
929380856 2:41351654-41351676 CTCCCAAAGTGTTGAATTACAGG + Intergenic
930763006 2:55056466-55056488 CTCTCAAAGTGTGGAATTACAGG - Intronic
931419423 2:62112522-62112544 CTTATAAAGTGTCAAGGGACGGG + Intronic
932242598 2:70168970-70168992 CTCCCAAAGTGTCGGATTACAGG + Intronic
933575599 2:84063637-84063659 CTTCCAAAGTGTGGAATTATAGG - Intergenic
937992840 2:127673998-127674020 CTTACAAAGTGACAAGTTACAGG + Intronic
939034697 2:137116786-137116808 CTTACATAGTGTGGGGGTACGGG + Intronic
939833804 2:147103810-147103832 CTCCCAAAGTGTAGAATTACAGG - Intergenic
946274570 2:218621188-218621210 CTTCCAAAGTGTTGGGTTACAGG + Intronic
946976884 2:225163133-225163155 ATTACAAAGTGTCCAGTCAGGGG - Intergenic
947231128 2:227887665-227887687 CTTTCAAAGTGTTGAGTGCCTGG - Intronic
947292867 2:228596986-228597008 ATTAAAAACTGTCGAGGTACTGG - Intergenic
947684484 2:232070838-232070860 CTCCCAAAGTGTGGAATTACAGG + Intronic
948410013 2:237752146-237752168 CTCCCAAAGTGTGGAATTACAGG - Intronic
1168974768 20:1956045-1956067 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1169785071 20:9350814-9350836 CTCCCAAAGTGTTGGGTTACAGG + Intronic
1169873152 20:10269150-10269172 CTCCCAAAGTGCCGGGTTACAGG - Intronic
1171384319 20:24758115-24758137 CTCCCAAAGTGTTGGGTTACAGG - Intergenic
1171523051 20:25790075-25790097 CTCCCAAAGTGTGGAATTACAGG + Intronic
1171530789 20:25852052-25852074 CTCCCAAAGTGTGGAATTACAGG + Intronic
1171545001 20:25993347-25993369 CTCCCAAAGTGTGGGGTTACAGG - Intergenic
1171553776 20:26065808-26065830 CTCCCAAAGTGTGGAATTACAGG - Intergenic
1175079571 20:56407934-56407956 CTTCCAAAGTGTGGAATTCCAGG - Intergenic
1180861864 22:19087940-19087962 CTCCCAAAGTGTTGGGTTACAGG + Intronic
1182159846 22:28110675-28110697 CTTCCAAAGTGCCGGGTTATAGG - Intronic
1183863569 22:40686340-40686362 CTTCCAAAGTGTGGGATTACAGG + Intergenic
1185183216 22:49375629-49375651 CTTCCAAAGTGCTGGGTTACAGG + Intergenic
951206955 3:19935165-19935187 CTTCCAAAGTGTCGGATTACAGG + Intronic
951214403 3:20010351-20010373 CTCCCAAAGTGCCGATTTACAGG + Intronic
953122119 3:40054702-40054724 CCTACAAAGTGTGGACTTGCTGG + Intronic
954985424 3:54786515-54786537 CTTACAAAGTGAAGAGACACAGG - Intronic
956776486 3:72569647-72569669 CATACACAGTGTCCAGTAACGGG - Intergenic
958581644 3:96033069-96033091 CTCCCAAAGTGTTCAGTTACAGG + Intergenic
958831539 3:99096543-99096565 CATACAAAGTGTGGAATTGCTGG + Intergenic
960212162 3:114982758-114982780 TTTAAAAAATGACGAGTTACTGG - Intronic
961269526 3:125678689-125678711 CTTCCGAAGTGTGGAATTACAGG + Intergenic
962171944 3:133110548-133110570 CTGAGGAAGTGTCGAGTTGCTGG + Intronic
963178590 3:142329014-142329036 CTCCCAAAGTGCTGAGTTACAGG + Intronic
966641687 3:182198335-182198357 CTTGCAAAGTGTGGGATTACAGG - Intergenic
967048203 3:185756713-185756735 CTTCTAAAGTGTCGGATTACAGG - Intronic
968345120 3:197997389-197997411 CTCCCAAAGTGTGGGGTTACGGG + Intronic
969978243 4:11126952-11126974 CTTTCAAAGTGCTGGGTTACAGG - Intergenic
972145682 4:36021665-36021687 CTTAAAAATTGTCGAGTCTCAGG + Intronic
974652074 4:64767062-64767084 CTCCCAAAGTGTGGGGTTACAGG + Intergenic
979392573 4:120143901-120143923 GTTACAAAATGTCAAGTTAGAGG + Intergenic
981821065 4:148888062-148888084 CTCCCAAAGTGTGGATTTACAGG + Intergenic
982232200 4:153219608-153219630 CTCCTAAAGTGTTGAGTTACAGG - Intronic
983503220 4:168524383-168524405 CTTCCCAATTGTCCAGTTACTGG + Intronic
983921387 4:173349452-173349474 CTCCCAAAGTGTTGGGTTACAGG - Intergenic
988410402 5:30878455-30878477 CTCCCAAAGTGTTGAATTACAGG + Intergenic
989160750 5:38388484-38388506 CTTCCAAAGTGTAGGATTACAGG - Intronic
990542390 5:56787191-56787213 CTTACAAAGTGTGGGATTACAGG - Intergenic
991065577 5:62420837-62420859 CTTCCAAAGTGTTGGATTACAGG + Intronic
991197817 5:63956876-63956898 CTCAAAAAGTGTTGGGTTACAGG + Intergenic
992749464 5:79849128-79849150 CTTCCAAAGTGCCGGATTACAGG - Intergenic
995499999 5:112794336-112794358 CTTCCAAAGTGTGGGATTACAGG + Intronic
996193467 5:120574344-120574366 CTCCCAAAGTGCTGAGTTACAGG - Intronic
998336993 5:141382084-141382106 CTCACAAAGTGTGGGATTACAGG + Intronic
1004937024 6:20517906-20517928 CTCACAAAGTATGGAATTACAGG - Intergenic
1006689727 6:35871996-35872018 CTCCCAAAGTGTTGCGTTACAGG + Intronic
1006782323 6:36640370-36640392 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1007058386 6:38912203-38912225 CTCTCAAAGTGTGGAATTACAGG - Intronic
1009690599 6:67027375-67027397 CTTGCAAAGTGCTGGGTTACAGG + Intergenic
1010506161 6:76661908-76661930 CTCACAAAGTGTTGGATTACAGG + Intergenic
1013535284 6:111058145-111058167 CTTCCAAAGTGTTGGGATACAGG + Intergenic
1016108457 6:140191257-140191279 CTTGCAAAGTTTTGAGTTATTGG - Intergenic
1016126819 6:140413705-140413727 CTGACAAAGTGTCAATATACTGG - Intergenic
1019430029 7:994695-994717 CTCCCAAAGTGCTGAGTTACAGG + Intergenic
1021113554 7:16723534-16723556 CTCCCAAAGTGTGGAATTACAGG - Intergenic
1023020150 7:36004628-36004650 CTTCCAAAGTGTGGGATTACGGG - Intergenic
1023538713 7:41241457-41241479 CTCCCAAAGTGCTGAGTTACAGG + Intergenic
1023630474 7:42158746-42158768 CTCCCAAAGTGTGGAATTACAGG + Intronic
1023829663 7:44031440-44031462 CTCCCAAAGTGCTGAGTTACAGG + Intergenic
1024728195 7:52224529-52224551 CTCACAAAGTGTGGGATTACAGG - Intergenic
1025186909 7:56868163-56868185 CTTCCAAAGTGTTGGATTACAGG - Intergenic
1025283486 7:57644995-57645017 CTCCCAAAGTGTGGAATTACAGG + Intergenic
1025685011 7:63708748-63708770 CTTCCAAAGTGTTGGATTACAGG + Intergenic
1026035740 7:66829433-66829455 CTTCCAAAGTGGTGAATTACAGG + Intergenic
1026990384 7:74581747-74581769 CTTCCAAAGTGCTGAGATACAGG - Intronic
1028822422 7:95228114-95228136 TTTACAAAGTTTCATGTTACAGG + Intronic
1029596811 7:101542357-101542379 CCTCCAAAGTGTGGAATTACAGG + Intronic
1030643638 7:112034640-112034662 CTTCCAAAGTGTGGGATTACAGG - Intronic
1031467602 7:122132755-122132777 CTTACAGAGTGTCCTGCTACTGG - Intronic
1035948501 8:3992524-3992546 CTCCCAAAGTGTGGAATTACAGG - Intronic
1036009505 8:4705787-4705809 CTTACAGAGTGTCTAGTTCTGGG + Intronic
1036220452 8:6917212-6917234 CTCCCAAAGTGCCGAATTACAGG - Intergenic
1037106930 8:15120101-15120123 CTTCCGAAGTGTTGGGTTACAGG + Intronic
1037894614 8:22643564-22643586 CTTCCAAAGTGTTGGATTACAGG + Intronic
1038810333 8:30835009-30835031 CTTGCAAAGTGTGGGATTACAGG - Intronic
1041081938 8:54222402-54222424 CTTACAAAATGATGATTTACTGG - Intergenic
1046696710 8:117348969-117348991 CTCCCAAAGTGTGGAATTACCGG - Intergenic
1050252856 9:3763871-3763893 CTTACAAATTGTCCAGATATAGG + Intergenic
1051535505 9:18152812-18152834 CTAAGACAGTGTCGATTTACTGG - Intergenic
1056950614 9:91038000-91038022 CTTACAAAATGGCAAGTTAGAGG + Intergenic
1058044704 9:100344585-100344607 CTCCCAAAGTGTTGGGTTACAGG - Intronic
1058494245 9:105537849-105537871 CTTAATAAGTGTTGAGTAACTGG + Intronic
1059058437 9:111009032-111009054 CTTACAAAGTCTACAGATACTGG + Intronic
1059193005 9:112344873-112344895 CTCCCAAAGTGTGGAATTACAGG - Intergenic
1059207827 9:112483265-112483287 CTCCCAAAGTGTGGAATTACAGG - Intronic
1059347656 9:113640782-113640804 CCTACAATGTGTCAAGTTCCTGG - Intergenic
1059499673 9:114740458-114740480 CTTACACTGTGTCCATTTACTGG - Intergenic
1061556456 9:131372972-131372994 CTCCCAAAGTGTTGGGTTACAGG + Intergenic
1203441135 Un_GL000219v1:9637-9659 CTTTCAAAGTGTGAAATTACAGG - Intergenic
1203511944 Un_KI270741v1:128545-128567 CTTTCAAAGTGTGAAATTACAGG - Intergenic
1190220177 X:48507971-48507993 CTTCCAAAGTGCTGGGTTACAGG + Intergenic
1192469434 X:71384663-71384685 CTTCCAAAGTGCTGAGATACAGG + Intronic
1198812786 X:140552417-140552439 CTTCCAAAGTGTTGGATTACAGG + Intergenic
1201976651 Y:19856645-19856667 CTTCCAAAGTCTGGAGTTGCAGG + Intergenic