ID: 917895991

View in Genome Browser
Species Human (GRCh38)
Location 1:179487749-179487771
Sequence CTTTGTAAGGCCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266902
Summary {0: 9, 1: 1202, 2: 25860, 3: 80100, 4: 159731}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917895985_917895991 10 Left 917895985 1:179487716-179487738 CCAGGCGTGATGGCTCATGCCTG 0: 206
1: 7388
2: 47444
3: 131710
4: 192178
Right 917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731
917895986_917895991 -9 Left 917895986 1:179487735-179487757 CCTGTAACTCGACACTTTGTAAG 0: 1
1: 0
2: 1
3: 5
4: 209
Right 917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731
917895983_917895991 22 Left 917895983 1:179487704-179487726 CCATCAATCAGGCCAGGCGTGAT 0: 1
1: 0
2: 4
3: 17
4: 143
Right 917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917895991 Original CRISPR CTTTGTAAGGCCAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr