ID: 917904477

View in Genome Browser
Species Human (GRCh38)
Location 1:179575664-179575686
Sequence CACGTCCACCACCGTGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917904469_917904477 5 Left 917904469 1:179575636-179575658 CCTCCTCGCCGGAGCCTCGGACC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904464_917904477 17 Left 917904464 1:179575624-179575646 CCACCTCGGTGCCCTCCTCGCCG 0: 1
1: 0
2: 6
3: 27
4: 204
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904463_917904477 20 Left 917904463 1:179575621-179575643 CCACCACCTCGGTGCCCTCCTCG 0: 1
1: 0
2: 3
3: 32
4: 288
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904470_917904477 2 Left 917904470 1:179575639-179575661 CCTCGCCGGAGCCTCGGACCTCA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904466_917904477 14 Left 917904466 1:179575627-179575649 CCTCGGTGCCCTCCTCGCCGGAG 0: 1
1: 0
2: 2
3: 11
4: 123
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904471_917904477 -3 Left 917904471 1:179575644-179575666 CCGGAGCCTCGGACCTCATCCAC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904468_917904477 6 Left 917904468 1:179575635-179575657 CCCTCCTCGCCGGAGCCTCGGAC 0: 1
1: 0
2: 1
3: 2
4: 66
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904462_917904477 29 Left 917904462 1:179575612-179575634 CCAACAGCGCCACCACCTCGGTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904472_917904477 -9 Left 917904472 1:179575650-179575672 CCTCGGACCTCATCCACGTCCAC 0: 1
1: 0
2: 1
3: 4
4: 122
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917904477 Original CRISPR CACGTCCACCACCGTGGCGG CGG Exonic