ID: 917904477

View in Genome Browser
Species Human (GRCh38)
Location 1:179575664-179575686
Sequence CACGTCCACCACCGTGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917904464_917904477 17 Left 917904464 1:179575624-179575646 CCACCTCGGTGCCCTCCTCGCCG 0: 1
1: 0
2: 6
3: 27
4: 204
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904470_917904477 2 Left 917904470 1:179575639-179575661 CCTCGCCGGAGCCTCGGACCTCA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904463_917904477 20 Left 917904463 1:179575621-179575643 CCACCACCTCGGTGCCCTCCTCG 0: 1
1: 0
2: 3
3: 32
4: 288
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904472_917904477 -9 Left 917904472 1:179575650-179575672 CCTCGGACCTCATCCACGTCCAC 0: 1
1: 0
2: 1
3: 4
4: 122
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904466_917904477 14 Left 917904466 1:179575627-179575649 CCTCGGTGCCCTCCTCGCCGGAG 0: 1
1: 0
2: 2
3: 11
4: 123
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904468_917904477 6 Left 917904468 1:179575635-179575657 CCCTCCTCGCCGGAGCCTCGGAC 0: 1
1: 0
2: 1
3: 2
4: 66
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904469_917904477 5 Left 917904469 1:179575636-179575658 CCTCCTCGCCGGAGCCTCGGACC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904462_917904477 29 Left 917904462 1:179575612-179575634 CCAACAGCGCCACCACCTCGGTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71
917904471_917904477 -3 Left 917904471 1:179575644-179575666 CCGGAGCCTCGGACCTCATCCAC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917904477 Original CRISPR CACGTCCACCACCGTGGCGG CGG Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG + Exonic
922753734 1:228082863-228082885 CACGTCGACCCCCGCGGCGGCGG + Intronic
1069865979 10:71503135-71503157 CACATCCTCCACCGTGGCCTCGG - Intronic
1076821723 10:132943044-132943066 CACTTCCAGCACCGTGGCAGGGG - Intergenic
1083712211 11:64556371-64556393 CACCTCCACCATCGTGGCCAAGG + Exonic
1083828080 11:65214232-65214254 CCCGTCCACCATCGTGATGGAGG + Intergenic
1083970398 11:66070705-66070727 CACCTCCATGGCCGTGGCGGTGG + Exonic
1084146227 11:67266689-67266711 CAGGTCCGCCATCTTGGCGGCGG - Exonic
1085760446 11:79236856-79236878 CACCTCCACCACTGTGTGGGTGG - Intronic
1087597690 11:100273697-100273719 GACATTCACCACAGTGGCGGAGG - Intronic
1091206570 11:133825330-133825352 CAGGTCCACCGCGGTGGGGGTGG - Intergenic
1103375984 12:120456353-120456375 CACATCCACCAAAGTGGCTGTGG + Intronic
1118448746 14:65877356-65877378 GGCGTTCACCACAGTGGCGGAGG + Intergenic
1122998961 14:105281612-105281634 CTCGTGCACCACAGTGGAGGGGG + Intronic
1123048430 14:105529502-105529524 CACGGCCACCACATTGACGGTGG - Exonic
1132747658 16:1443683-1443705 CAGCTCCACCACCCTGGCCGGGG + Exonic
1134624988 16:15717186-15717208 CAAGTCCACCATCGCGGCGCTGG - Exonic
1135035793 16:19075755-19075777 CATGGCCTGCACCGTGGCGGTGG + Exonic
1139956056 16:70693561-70693583 CCCTGCCACCACCCTGGCGGGGG + Intronic
1143517517 17:7427196-7427218 CTCGTCCAACACCGTGAGGGAGG - Exonic
1152686215 17:81695048-81695070 CACCTCCACCACGTTGGTGGGGG - Exonic
1159777282 18:72618446-72618468 CACATGCACCACTGTGGAGGAGG + Intronic
1160232396 18:77058213-77058235 GACGTCCACCTCAGGGGCGGTGG + Intronic
1160925546 19:1543262-1543284 CACTTTCACCACGGAGGCGGAGG + Intergenic
1161291581 19:3496584-3496606 CACGTCCACCAGCATGGGGATGG + Exonic
1161522089 19:4730300-4730322 CATGTCCACCACCTAGGCTGAGG + Intergenic
926310245 2:11669752-11669774 CACGCTCAGCACCGTGGCGTAGG + Exonic
927606578 2:24491540-24491562 CTCGTCCGCGACCGTGGCGGCGG - Intergenic
928437144 2:31261923-31261945 CACCTGCACCACTGGGGCGGTGG - Intronic
936277505 2:111113083-111113105 CACGTCTGCCACAGTGGTGGAGG + Intronic
1170606891 20:17881619-17881641 GGCCTCCACCACCATGGCGGGGG - Intergenic
1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG + Intronic
1172998530 20:39089168-39089190 CACTTCCACCACCCTGCCTGTGG + Intergenic
1173800147 20:45890296-45890318 CACGTCCACCACCGCGTAGAGGG + Exonic
1175624875 20:60481874-60481896 CACCTCCACCACAATGGCAGGGG + Intergenic
1175625453 20:60485191-60485213 CACCTCCACCACCGTCGCCAGGG + Intergenic
1178980416 21:37258703-37258725 AAAGCCCACCACCGTGGCCGAGG + Intronic
1182056530 22:27359907-27359929 CACGTGTACCACAGTGGTGGGGG - Intergenic
1183268968 22:36849030-36849052 CACGGCCACCAGCATAGCGGAGG + Intergenic
1184184801 22:42857331-42857353 CCCGTCCACCGCCGGGGCGCAGG + Exonic
1184732033 22:46375988-46376010 CACGTTCACCACTGTGGTGCAGG - Intronic
954107342 3:48416391-48416413 CACCTCCACCGCTGTGGCGCCGG + Exonic
963332019 3:143925192-143925214 CACATCCAGCACCGTTGCAGTGG + Intergenic
965619971 3:170633580-170633602 CAGGTCCAGCACCGAGGAGGTGG + Intronic
965812349 3:172604148-172604170 CACGACCACCACCGAAGCCGAGG + Intergenic
970332827 4:15003028-15003050 CCCGACCACCACCCCGGCGGCGG + Exonic
971177031 4:24292133-24292155 CAGGACAACCTCCGTGGCGGAGG - Intergenic
985498573 5:225543-225565 CACCTCGACCACGGCGGCGGGGG - Exonic
985622711 5:963839-963861 CCCTTGCACCACCGTGGGGGTGG + Intergenic
990285438 5:54296885-54296907 CACCACCACCACTGTGGCAGAGG + Intronic
995571692 5:113488303-113488325 CACGTCCAGCACCGGCGAGGAGG - Exonic
997740164 5:136246082-136246104 CACATCCCCCACCGTGGAAGTGG - Intronic
999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG + Exonic
1001568809 5:172717123-172717145 CAGGTCCACCACTGGGGCTGCGG + Intergenic
1001953132 5:175830045-175830067 CTCATCCACCAGCGTGGCTGCGG + Intronic
1003639169 6:7862306-7862328 CACGTCCACCCCCGAGCCGCAGG + Exonic
1005582948 6:27251073-27251095 CACGGCCCGCACCGGGGCGGAGG - Exonic
1009396985 6:63211549-63211571 CACGTGCACTCCCATGGCGGCGG - Exonic
1015665078 6:135619443-135619465 CACGACCAACACCTTGGCAGTGG + Intergenic
1019408221 7:895069-895091 CACGTCCACCAACGGGGCCATGG - Intronic
1022103809 7:27184607-27184629 CACGGCGACCTCCGCGGCGGCGG - Exonic
1022736703 7:33082841-33082863 CACTTTCACCACCGTGGCCTGGG + Intergenic
1029611847 7:101630745-101630767 CACGCCCAGGACCGTGGCAGGGG + Intergenic
1035297710 7:157876616-157876638 CACGTCCACCAGGGTGGCCTTGG + Intronic
1043126250 8:76399333-76399355 CACCTCCACCACCCTGTCCGTGG + Intergenic
1047168618 8:122467296-122467318 GACGTTCACCACAGTGGCAGAGG - Intergenic
1049248444 8:141575419-141575441 CCCCACCACCACCATGGCGGTGG + Intergenic
1057212718 9:93209479-93209501 CACGTCCAAGACCCTGGCTGAGG + Intronic
1057569096 9:96190253-96190275 CACGTCCAGCACCTTGGCAGGGG + Intergenic
1058836571 9:108862957-108862979 CACCTCCACCACCAGGCCGGAGG - Exonic
1062228139 9:135465462-135465484 CACCACCACCACCGTGGCCTTGG - Intergenic
1203782116 EBV:106385-106407 CTCATCCTCCACCCTGGCGGCGG + Intergenic
1203782596 EBV:108930-108952 TACGTCCGCCACAGTGGGGGTGG - Intergenic
1203783844 EBV:116212-116234 CACATCCACCACCTTCTCGGAGG + Intergenic
1200239388 X:154486008-154486030 CTCCTCCACCGCCGTGGGGGTGG + Intronic