ID: 917906762

View in Genome Browser
Species Human (GRCh38)
Location 1:179592443-179592465
Sequence CCCGGCCACGCGCAAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917906756_917906762 21 Left 917906756 1:179592399-179592421 CCTGTAGCTTAATCAACGCAGGT 0: 1
1: 0
2: 0
3: 1
4: 46
Right 917906762 1:179592443-179592465 CCCGGCCACGCGCAAGCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917906762 Original CRISPR CCCGGCCACGCGCAAGCCGC AGG Intronic
900207819 1:1439123-1439145 CCAGGCCAGGCGGAAGCCGCTGG - Exonic
900562200 1:3312652-3312674 CCCGGCCTCGGCCAAGCTGCAGG + Intronic
902044205 1:13513210-13513232 CCCGGCCGAGCGGAAGGCGCCGG + Exonic
906731833 1:48089550-48089572 GCAGGCCACGCTCAAGCCACTGG + Intergenic
908544014 1:65147517-65147539 ACCGGCTCCGCGCGAGCCGCTGG - Intergenic
917906762 1:179592443-179592465 CCCGGCCACGCGCAAGCCGCAGG + Intronic
922756942 1:228102102-228102124 CTCGGCCAGGAGGAAGCCGCGGG - Exonic
1064167865 10:13001790-13001812 CCCGCCCACGCCCCAGCCGCAGG - Intronic
1068955218 10:62815137-62815159 CCCGGCCTCGAGGAAGGCGCGGG + Intronic
1069651537 10:70053236-70053258 CCCGGCCCCTCGCTGGCCGCAGG - Intronic
1070129752 10:73648054-73648076 CCCAGCCACGCGCCAGTCTCTGG - Exonic
1072916559 10:99540624-99540646 CCCGGGCCCGCGCGCGCCGCCGG + Intergenic
1076180304 10:128401907-128401929 CCTGGCCATGAGCAAGCCTCTGG - Intergenic
1076707019 10:132307751-132307773 CCCGGCCGCGCGCGCCCCGCCGG - Exonic
1076851735 10:133096614-133096636 CCTGGCCACCCGCAGGCCACGGG + Intronic
1081637781 11:44732168-44732190 CCTGGCCCCTCCCAAGCCGCTGG - Intronic
1083961487 11:66017167-66017189 CCCGCCCACCCGCAGGCAGCAGG - Exonic
1092155381 12:6278751-6278773 CCCGGCCGCGCCCTGGCCGCCGG - Intergenic
1100844503 12:98644982-98645004 CCCGGGCGCGCGCAGGCCGACGG + Exonic
1103828677 12:123762058-123762080 CCCGGCAGCGCGCACGCCCCTGG - Intergenic
1105459040 13:20566934-20566956 CCCGGCTTCCCGCAAGCCGCTGG + Intergenic
1106038753 13:26069678-26069700 CACGGCCACGGGCAGGCCACGGG - Intergenic
1107806606 13:44159251-44159273 CCCAGCCACGCGGAGGCTGCAGG + Intronic
1108618627 13:52159584-52159606 GCCCGCCCCGCGGAAGCCGCCGG - Exonic
1117690133 14:58298167-58298189 CCCGCCCCCGTGCAAGCCCCTGG + Intergenic
1121569547 14:94937014-94937036 CCGGGCCAGGCGCAGGCCACTGG + Intergenic
1121671213 14:95711992-95712014 CCCAGCCACCAGCTAGCCGCAGG - Intronic
1202853762 14_GL000225v1_random:37371-37393 CCCTGCCACGCGGAGGCCTCCGG - Intergenic
1126087537 15:45023568-45023590 ACCGGCCACGTGCCAGCCACGGG - Intronic
1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG + Intronic
1141830864 16:86509576-86509598 CCCGCCCGCTCGCAAGCTGCTGG + Intergenic
1145884195 17:28371484-28371506 CCCAGCCACGCCCACGCCCCTGG - Intronic
1152579364 17:81159332-81159354 GCCGGTCACTCGCAGGCCGCCGG - Intronic
1155392618 18:25351828-25351850 CCCGGTCCAGCGCCAGCCGCCGG - Intronic
1160373213 18:78391184-78391206 CCCGGGCACCCGCAGGCCGTGGG - Intergenic
1160864585 19:1251135-1251157 CCCGGCCCGGCGCAACCCCCAGG + Intronic
1160873014 19:1285675-1285697 CCGGGCCACGCGGATGCCGGCGG + Intergenic
1161531491 19:4792569-4792591 CCCGGCCAGGAGCAGGTCGCAGG + Exonic
1162554098 19:11375704-11375726 CCCGGCCAGGCCCAAGCCGGTGG - Exonic
1163364798 19:16869840-16869862 CCCAGCCCCGCACAAGCCCCTGG + Exonic
1165067559 19:33237857-33237879 CCCGGCCTCGCTCAAGCTGAGGG + Intergenic
1165892989 19:39125938-39125960 CCCGGCCCACCGCAAGCCCCTGG - Intronic
1166290505 19:41860409-41860431 CGCGGCCACGTGCGAGCGGCAGG + Intronic
1167313927 19:48753039-48753061 CCTGGCCACGCCCCAGCGGCTGG + Exonic
1167792199 19:51689556-51689578 CCCTGCGACGCGGGAGCCGCGGG + Intergenic
1168721965 19:58559095-58559117 CCCGGCCCCGCGAAAGTCGCCGG - Intergenic
926901398 2:17754577-17754599 TTCGGCCAAGCGCAAGCGGCCGG - Intronic
927678778 2:25126124-25126146 CCTGCCCATGCGCAAGCCGCAGG - Intronic
928126447 2:28619953-28619975 CCCTGCCACGGGCAATACGCTGG - Intronic
934978673 2:98823105-98823127 CCCGGCCACGGACAAGGCGGAGG - Exonic
938018552 2:127886727-127886749 CCCGGCCAGGGGCGAGCGGCTGG - Intergenic
938143857 2:128818031-128818053 CCCGGCCACGTGCCAGACACTGG - Intergenic
938434239 2:131272917-131272939 CCCGGACACGCACAGGCCCCAGG - Intronic
938434561 2:131274907-131274929 CCCGGACACGCACAGGCCCCAGG - Intronic
942268145 2:174248365-174248387 CCGGGCCCCGCGCCAGCCTCAGG + Intronic
945033497 2:205685575-205685597 CCCAGCCACGCGCCAGCCCAAGG - Intronic
947742332 2:232490396-232490418 CCCACCCACGTGCAGGCCGCAGG - Intergenic
1172359650 20:34303176-34303198 CCCCGCCACGAACAAGCCCCGGG + Intronic
1176113924 20:63422876-63422898 CCCTGCCACGCGGAAGCCGTCGG + Intronic
1180414179 22:12693662-12693684 CCCTGCCACGCGGAGGCCTCCGG + Intergenic
1180622569 22:17171765-17171787 CGCAGCCATCCGCAAGCCGCGGG + Intergenic
1180699711 22:17774540-17774562 CCCGGGTCCCCGCAAGCCGCCGG - Intronic
1183093646 22:35540169-35540191 CCTGGCCGGGCGCAAGCCGCTGG + Intergenic
1185092490 22:48783863-48783885 GCCGGCCACGCCCCAGCCCCAGG - Intronic
950616003 3:14158622-14158644 CCCGGCCATGCGGACGTCGCTGG + Exonic
953058464 3:39406903-39406925 CCTGGCCACGTGCGGGCCGCAGG - Intronic
960281253 3:115784040-115784062 CCCAGCCACGCGGAGGCTGCCGG + Intergenic
961365188 3:126395064-126395086 CCCGGCCACGCGCGCCCCTCGGG - Intronic
963605747 3:147410506-147410528 CACGGCCACACGGACGCCGCGGG + Exonic
967684894 3:192408265-192408287 CCCGGCGGAGCGCAAGCCGGAGG - Exonic
968471431 4:784428-784450 CCCGCCCACACTCAATCCGCTGG - Intergenic
968622102 4:1608438-1608460 CCCGCCCAGGCGCCAGCCACGGG + Intergenic
975485829 4:74933416-74933438 CCCGACCACGCGCTAGCTACTGG - Intronic
984973401 4:185209863-185209885 CCCAGCCCCGCGCGGGCCGCAGG + Intronic
990699517 5:58460186-58460208 CCCGGCCACGCGCGCTCGGCCGG - Exonic
994072842 5:95620891-95620913 CCCGGCCAGGCGCGGGCGGCCGG - Exonic
994647764 5:102491608-102491630 CCGGGCCACCCGCAGGCCCCAGG - Intronic
1002966372 6:1970515-1970537 CCCGACCAGGAGCAGGCCGCAGG + Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1007927855 6:45664058-45664080 CCACGCCACGCGGAAGTCGCAGG - Intronic
1008520950 6:52362158-52362180 CCCGGCCACGAGCTTCCCGCGGG - Exonic
1012551143 6:100465390-100465412 ACCGGCCTCGCGCACGCCGTCGG - Intergenic
1019388667 7:773268-773290 CCCTGCCAGGAGCAAGCCGGTGG + Intronic
1019624829 7:2010822-2010844 CCCGGCCCTGCGCATGCCCCTGG - Intronic
1019725089 7:2597484-2597506 CCGGGCCAGGCGCCAGGCGCAGG - Intronic
1025211130 7:57020083-57020105 CACGGCCGCGCGACAGCCGCCGG - Intergenic
1025660825 7:63556764-63556786 CACGGCCGCGCGACAGCCGCCGG + Intergenic
1029481928 7:100818580-100818602 CCAGGCCAGGCTCAAGCTGCTGG + Exonic
1033361311 7:140640659-140640681 CCCGGCCGCCCGCAAGCCCCTGG + Exonic
1036775928 8:11613229-11613251 CCTGGCCAAGCCGAAGCCGCCGG - Intergenic
1037886830 8:22599851-22599873 CCCAGCCCCGCGCACCCCGCGGG + Intronic
1040537144 8:48320317-48320339 CTCGGCCTGGCGCAAGCTGCTGG + Intergenic
1194977228 X:100408147-100408169 CCCTGGCACGCGCATCCCGCTGG - Exonic