ID: 917908206

View in Genome Browser
Species Human (GRCh38)
Location 1:179611201-179611223
Sequence CCACCATACTTGGCTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2417
Summary {0: 2, 1: 23, 2: 387, 3: 785, 4: 1220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917908198_917908206 13 Left 917908198 1:179611165-179611187 CCTCAGCCATCCAAGTAGCTGGA 0: 5
1: 372
2: 10845
3: 114927
4: 224547
Right 917908206 1:179611201-179611223 CCACCATACTTGGCTAATTTTGG 0: 2
1: 23
2: 387
3: 785
4: 1220
917908199_917908206 7 Left 917908199 1:179611171-179611193 CCATCCAAGTAGCTGGAATTACA 0: 111
1: 5418
2: 64216
3: 162909
4: 278199
Right 917908206 1:179611201-179611223 CCACCATACTTGGCTAATTTTGG 0: 2
1: 23
2: 387
3: 785
4: 1220
917908202_917908206 3 Left 917908202 1:179611175-179611197 CCAAGTAGCTGGAATTACAGGGG 0: 52
1: 3833
2: 59740
3: 183680
4: 172629
Right 917908206 1:179611201-179611223 CCACCATACTTGGCTAATTTTGG 0: 2
1: 23
2: 387
3: 785
4: 1220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917908206 Original CRISPR CCACCATACTTGGCTAATTT TGG Intronic
Too many off-targets to display for this crispr