ID: 917910991

View in Genome Browser
Species Human (GRCh38)
Location 1:179645943-179645965
Sequence CTAAATATAAAGATAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 1, 1: 0, 2: 4, 3: 88, 4: 857}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917910991_917910993 21 Left 917910991 1:179645943-179645965 CCCTTCTCTATCTTTATATTTAG 0: 1
1: 0
2: 4
3: 88
4: 857
Right 917910993 1:179645987-179646009 TAGTTGTATTTTTTTAATCCAGG 0: 1
1: 0
2: 3
3: 32
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917910991 Original CRISPR CTAAATATAAAGATAGAGAA GGG (reversed) Intronic
900853775 1:5164486-5164508 CTATCTATAAAGACAGAGCAGGG - Intergenic
900926772 1:5710851-5710873 AAAGATAGAAAGATAGAGAAAGG + Intergenic
901039101 1:6353699-6353721 CTAAAAATAAAGAAAGACACAGG + Intronic
902237484 1:15066894-15066916 ATAAATAAATATATAGAGAAAGG - Intronic
903024747 1:20419333-20419355 CTAAATACAAAGAGAGAAAGAGG + Intergenic
903416489 1:23186889-23186911 CTTAAAAAAAAAATAGAGAAAGG + Intergenic
903919740 1:26791129-26791151 CCACATAGCAAGATAGAGAAGGG + Intronic
904073077 1:27816915-27816937 CAAAAAAAAAAGAAAGAGAAAGG + Intronic
904225807 1:29018158-29018180 CAAAATATAAAGAGAGAAAAAGG - Intronic
904316282 1:29667191-29667213 TTAAATATAAAGATAGAAACAGG + Intergenic
904894971 1:33810385-33810407 CTAAGTATAAAGAAAAACAAAGG + Intronic
905236115 1:36550208-36550230 TTAAATATAAAGACAGAAATAGG - Intergenic
905333268 1:37224141-37224163 AAAATTATAAAGACAGAGAATGG + Intergenic
905817462 1:40963102-40963124 AAAAATATAAAGATAGAGGCTGG + Intergenic
905988370 1:42309493-42309515 CTAAGGAGAAAAATAGAGAAGGG - Intronic
906364277 1:45192488-45192510 GTAGATAGAAAGACAGAGAAAGG + Intronic
906832031 1:49043211-49043233 GAAAATAAAAAGATATAGAAAGG - Intronic
906917587 1:50027663-50027685 ATAAATATAAAGATATATATGGG + Intergenic
907367968 1:53978360-53978382 CTCAATATATACATAGAGAGAGG - Intergenic
907396442 1:54193661-54193683 CTTTTTATAAAGATAGAGATGGG - Intronic
907419603 1:54337956-54337978 ATAAATTAAAAGATAGAGATGGG - Intronic
907547059 1:55271125-55271147 CTCAATTAAAAGATAGAGATTGG - Intergenic
907613087 1:55892717-55892739 ATAAAAAAAAAGACAGAGAAGGG - Intergenic
908161241 1:61410604-61410626 CTAAAAATAAATATAGGGACTGG + Intronic
908198461 1:61769293-61769315 TTGAATATATAGATATAGAACGG + Exonic
908201610 1:61801819-61801841 TTAACTATAAAGACAGAAAATGG - Intronic
908556549 1:65262446-65262468 CAAAAAATAAATAAAGAGAATGG - Intronic
908704737 1:66939831-66939853 TTAAATATAATGAAAGGGAAGGG + Intronic
908761532 1:67517205-67517227 CTAAATGGAAAGAAAGAGGAAGG + Intergenic
908800921 1:67879847-67879869 AAAAAAAAAAAGATAGAGAAAGG - Intergenic
908897799 1:68920098-68920120 CCAAATATAAAGATTGGGATGGG + Intergenic
909436609 1:75649359-75649381 CTTAAAATAAATATAGATAATGG + Intergenic
909821672 1:80070931-80070953 ATAAATATAAAGTTACATAATGG + Intergenic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910584827 1:88867933-88867955 TTAAATATAAAAAGAGGGAATGG - Intronic
911175940 1:94818893-94818915 AGAAATATAAAAACAGAGAAGGG - Intergenic
911429298 1:97763236-97763258 AGAAATATAATGATACAGAAAGG - Intronic
911464031 1:98228657-98228679 TTATATCTAAAGATATAGAAAGG + Intergenic
911491324 1:98571042-98571064 CAAACTATATAGATAGATAATGG + Intergenic
911709924 1:101059519-101059541 TTAAATATAGAGACAGAGATTGG - Intergenic
911710672 1:101068345-101068367 CAAAATACAAAGATATAGAAAGG + Intergenic
911795815 1:102074853-102074875 GTAAATATAAAAATAGAATATGG - Intergenic
912103953 1:106247149-106247171 GTAAAAATAAAGACAGACAAAGG + Intergenic
912622689 1:111179765-111179787 CTACATAGAAAGGAAGAGAAAGG + Intronic
912661132 1:111531932-111531954 CTAAAAATAAAGAAAAACAAAGG + Intronic
914217505 1:145645794-145645816 CTGAATATAATGTTAGAAAAGGG - Intronic
914219148 1:145662463-145662485 ATAAATATAAAGATACAAATAGG - Intronic
914248020 1:145900250-145900272 ATAAATAAAAAGAAAGAGCAAGG - Intronic
914335425 1:146710660-146710682 TTAAATATAAAGAGAGCTAAAGG - Intergenic
914470074 1:147968479-147968501 CTGAATATAATGTTAGAAAAGGG - Intronic
914471731 1:147985334-147985356 ATAAATATAAAGATACAAATAGG - Intronic
914565955 1:148866687-148866709 GAAAAAATAAAGAAAGAGAAAGG + Intronic
914746036 1:150501827-150501849 ATAAATAAAAAGATAGAGAAAGG + Intronic
914767724 1:150654140-150654162 ATCAATAAAGAGATAGAGAAAGG + Intronic
915186101 1:154106279-154106301 ATAAATAAAAAGATTGGGAAGGG + Intronic
915770188 1:158413243-158413265 CTATATAAAAAGGTAGAAAAAGG - Intergenic
916608583 1:166367338-166367360 GTAAAGACAAAGACAGAGAAAGG - Intergenic
917026132 1:170644510-170644532 CTGTATATAAAACTAGAGAAAGG - Intergenic
917414484 1:174794784-174794806 CCAAATACAAAGATAAAGTAGGG - Intronic
917894192 1:179471735-179471757 CTAAATGTAAAGAAAGTGAAAGG - Intronic
917910991 1:179645943-179645965 CTAAATATAAAGATAGAGAAGGG - Intronic
917913863 1:179680647-179680669 TTAAGTATAAAGATACAGACAGG - Intronic
918085727 1:181243663-181243685 ATAAATATAAATAGAGAGAAAGG + Intergenic
918322693 1:183379493-183379515 TTTAATATAAAGATATAGATAGG + Intronic
918616030 1:186545287-186545309 ATAAAAAAAAAGATAAAGAATGG - Intergenic
918688038 1:187444207-187444229 ATAACTAAAAAGATAAAGAAAGG - Intergenic
918802723 1:188993109-188993131 CTAAATATGAAATCAGAGAATGG + Intergenic
919014954 1:192020553-192020575 CTTACTATAACAATAGAGAATGG + Intergenic
919529304 1:198696290-198696312 ATAAAGAAAAGGATAGAGAAAGG - Intronic
919557529 1:199077676-199077698 TTTAATATAAACATATAGAAAGG + Intergenic
920165101 1:204030143-204030165 CTAATTATAAAAATAGCAAAAGG - Intergenic
920740409 1:208576610-208576632 CTAAATATAAAGCTAGAAGAGGG - Intergenic
920770307 1:208878448-208878470 TTAAATAGAAAGATAGATGATGG - Intergenic
921636499 1:217501138-217501160 AAAATTATAAAAATAGAGAATGG - Intronic
922231170 1:223687983-223688005 ATAAAGATACAGATATAGAAAGG - Intergenic
922815779 1:228447776-228447798 CTAACTTTAAAAATAGACAAAGG - Intergenic
923149996 1:231224415-231224437 CTACATTTAAAGTAAGAGAAAGG + Intronic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923222088 1:231904550-231904572 CTAAATACACAGATAGATACAGG + Intronic
923350891 1:233105546-233105568 TAAAATATAAGGAGAGAGAAAGG + Intronic
923934069 1:238741454-238741476 TTAAATATAAGGATATAGAGAGG + Intergenic
924287141 1:242499427-242499449 ATGAAGATATAGATAGAGAAAGG - Intronic
924355794 1:243174123-243174145 CTAAATACAAAGACAAACAATGG + Intronic
1063163629 10:3439757-3439779 CTAAATATATAGAGATAGATAGG - Intergenic
1063294379 10:4788992-4789014 CCAAATATAAATATACAGTATGG + Intronic
1063431506 10:5993803-5993825 ATAAATATAAAGACACAGATAGG + Intergenic
1063863406 10:10337663-10337685 CTGAAAATAAAGATATAGAAAGG - Intergenic
1064059131 10:12122627-12122649 ATAAATAGAAAGAGAGAGAGAGG + Exonic
1064101203 10:12465866-12465888 CTAAAGAGAAAGAGAGAGTATGG - Intronic
1064878474 10:20022355-20022377 TTAAATATGAAGAAAGAAAATGG + Intronic
1064889792 10:20157794-20157816 CTATATAACAAGATAGAGATAGG - Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1065751144 10:28888629-28888651 CCATATATAAAGAGAGAGACAGG + Intergenic
1065939952 10:30555521-30555543 GTAAATGTAAGGAAAGAGAATGG - Intergenic
1066069438 10:31791723-31791745 TTAAATATTAAAATACAGAAAGG - Intergenic
1066248424 10:33608458-33608480 ATAAATATAAAGACATAGAAAGG - Intergenic
1066488994 10:35875840-35875862 GTAAACTTTAAGATAGAGAAGGG + Intergenic
1066966623 10:42272769-42272791 ATAAAAATAAAAATAGAAAAAGG - Intergenic
1067956678 10:50798572-50798594 CCAAGTAGAAAGATAGAGAAAGG - Intronic
1068242140 10:54316776-54316798 CTTAAAGTAAAGATATAGAAAGG - Intronic
1068925518 10:62532394-62532416 TTAAATATAATGATATAGACAGG + Intronic
1069132334 10:64721785-64721807 CTAAATACAAAAATATAGATTGG + Intergenic
1069159431 10:65074474-65074496 ATAAATAAAAAAAAAGAGAAGGG - Intergenic
1069203155 10:65648373-65648395 TTAAATATAAATATGCAGAAAGG + Intergenic
1069255549 10:66327707-66327729 CTAAATATCAATATACACAATGG - Intronic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070403764 10:76076467-76076489 CTGAATGTGAAGATAGAGAGTGG + Intronic
1071245655 10:83759641-83759663 CTAAATGGATAGAAAGAGAAAGG - Intergenic
1072111545 10:92325343-92325365 TTAAATAAAAAGAGAGAGAGTGG + Intronic
1072194499 10:93105128-93105150 ATAAAAATAAAGATAGAATAAGG + Intergenic
1072864971 10:99049317-99049339 CTAAAAATAAGCAAAGAGAAAGG + Intronic
1072877406 10:99187559-99187581 CTCAATTTAAAGATAAAGAAAGG + Intronic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1072923096 10:99593243-99593265 CTGAAGATAAAGAGAAAGAAAGG + Intergenic
1073202482 10:101747084-101747106 CTAAATATATGGAAACAGAAAGG + Intergenic
1074230466 10:111529464-111529486 ATAAGGAAAAAGATAGAGAAAGG + Intergenic
1074343159 10:112654473-112654495 ATAAATAAAAAGAAAAAGAATGG - Intronic
1074460075 10:113628817-113628839 ATAAATCTGAGGATAGAGAAAGG + Intronic
1074473211 10:113745862-113745884 CTAAATACAAAAATAGACACTGG + Intergenic
1075432519 10:122400320-122400342 CTAAAAAGAAAAATAGAGACGGG - Intronic
1075455850 10:122584382-122584404 ATAATTATACAGAAAGAGAAGGG - Intronic
1075457973 10:122597085-122597107 ATAATTATACAGAAAGAGAAGGG - Intronic
1076022526 10:127085754-127085776 CTAAAAAAAAAGAAAAAGAAAGG + Intronic
1076663570 10:132071737-132071759 CTAAATATAAAGGCATAGACAGG - Intergenic
1077291265 11:1795453-1795475 ATAAAAATAAAAATAAAGAAGGG - Intergenic
1078376637 11:10800142-10800164 CTAAATTACAAGATCGAGAATGG - Exonic
1078971675 11:16420185-16420207 GTAAATATAAATTGAGAGAAAGG + Intronic
1079193209 11:18299695-18299717 CAAACTATAAAGATACAAAATGG + Intronic
1079214379 11:18494949-18494971 CTGAATATTTAGATAAAGAAAGG - Intronic
1079411778 11:20194369-20194391 CTAACTAGAAAGATAGAGTGGGG - Intergenic
1079599512 11:22293885-22293907 TTAAATATAAAGACACAGAAGGG + Intergenic
1079623913 11:22592533-22592555 GTAAAAATAAAAATAGAAAAGGG + Intergenic
1079787327 11:24689683-24689705 TTAAAAATAAAGTTAGATAAAGG - Intronic
1079928833 11:26532004-26532026 GTAAACATAAAGATAGGAAAAGG + Intronic
1080539579 11:33253633-33253655 CTAAAGAGAAAGATAAAGACAGG + Intergenic
1081291117 11:41327123-41327145 TAAAATATAAAGAGAGAGAATGG - Intronic
1082206958 11:49448579-49448601 TTAACTATAAAGAAAGTGAAAGG + Intergenic
1082576237 11:54807790-54807812 CTAAATATCAAGTTGCAGAATGG + Intergenic
1082667986 11:55998097-55998119 TTAAATATAAAGAAATATAATGG - Intergenic
1082923861 11:58524970-58524992 GTGAATATAAACATATAGAAAGG - Intergenic
1082971245 11:59023595-59023617 GTAAAAAAAAAAATAGAGAAGGG + Intronic
1083930065 11:65837324-65837346 TTAAATATAAGGACACAGAAGGG + Intronic
1085262839 11:75218122-75218144 CTACATATAGAGAAAGACAAGGG - Intergenic
1085268583 11:75254426-75254448 TTAAATATAAAGACATAGATAGG - Intergenic
1085325987 11:75606910-75606932 CTAAATCTAGAGATAGATGAGGG - Intronic
1085803668 11:79614631-79614653 ATAAATATAAGCATAGACAAAGG + Intergenic
1086188088 11:84043870-84043892 CAAAAAATAAAGGTAGAAAATGG - Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086538873 11:87884129-87884151 CTAAAGATAAGGATAGATGATGG - Intergenic
1086663406 11:89450269-89450291 CTAAATATAATTATGTAGAAAGG + Intronic
1087500689 11:98949559-98949581 TTAAATAAAAAGACAGAAAAGGG - Intergenic
1087646099 11:100810204-100810226 AAAAATATAAAGATAGTAAAGGG + Intronic
1087754515 11:102040767-102040789 ATAAATATAAAGACACAGAAAGG + Intergenic
1087802065 11:102515266-102515288 CTAACAAGAAACATAGAGAAAGG + Intergenic
1087968803 11:104453518-104453540 CTAAATATGAAGTTAAACAAGGG - Intergenic
1088029030 11:105223633-105223655 CCAAATAAAAGGAGAGAGAAGGG - Intergenic
1088429000 11:109736833-109736855 CTAAATGTAAACATACAGTAGGG + Intergenic
1088493807 11:110412921-110412943 AAAAATATAAAGACACAGAAAGG - Intergenic
1088565787 11:111171382-111171404 TTAAATATAGATATAGAAAAAGG + Intergenic
1089646350 11:119882376-119882398 CTAAATGAAAAGACAGGGAAGGG - Intergenic
1090203731 11:124873655-124873677 TTAAGTAGAAAGATAGGGAAAGG - Intronic
1090282830 11:125471383-125471405 TTAAATAAAAAGACAGAGATAGG + Intronic
1090549087 11:127799117-127799139 TTAAATGTAATGATAGAGACAGG - Intergenic
1090549088 11:127799174-127799196 TTAAATGTAATGATAGAGACAGG - Intergenic
1090992596 11:131832822-131832844 TTAAATATATATATAGACAAGGG + Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092225854 12:6748050-6748072 CAAAAAATAAAGGCAGAGAAGGG + Exonic
1092405016 12:8215132-8215154 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1092478815 12:8841798-8841820 CTATATATGAAGTTAGAGCAGGG + Intronic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1092805901 12:12222263-12222285 CTATATATAAAGAAAGATCACGG + Intronic
1094290640 12:28844740-28844762 ATATATATAGAGAGAGAGAAAGG + Intergenic
1094544763 12:31394147-31394169 CTAAAAGAAAAAATAGAGAAAGG - Intronic
1095343087 12:41115674-41115696 CAAAACAAAAAGATAGAAAATGG + Intergenic
1095525647 12:43122004-43122026 CTAAATATAAGGAAGGAGAAGGG + Intergenic
1095527384 12:43143511-43143533 CATAATATAAAAATAGAAAAAGG + Intergenic
1097266451 12:57748280-57748302 CCAAATATAAAGGTAGGGAAAGG + Exonic
1097579486 12:61436609-61436631 GCAAATATAAGGAAAGAGAAAGG + Intergenic
1098269041 12:68752567-68752589 AAAAATATAAAGAAAGTGAAGGG + Intronic
1098700412 12:73616810-73616832 CTAAATAACAAGATAGGGGAAGG - Intergenic
1098742128 12:74186059-74186081 GTAAATATTCAGATACAGAAAGG + Intergenic
1098808837 12:75057903-75057925 CAAAATAAAAATATAGAGGAAGG - Intronic
1099594352 12:84640012-84640034 TTAAATCTAAAGATATGGAAAGG - Intergenic
1100109457 12:91220888-91220910 CTAAATGGAAAGATAGAGATAGG + Intergenic
1100466006 12:94845951-94845973 CTTCATGTAAAGAAAGAGAATGG + Intergenic
1100885065 12:99060852-99060874 AAAAATAAAAAGAGAGAGAAAGG + Intronic
1100910743 12:99359306-99359328 CTAAATATAACAAGAGAGAAAGG - Intronic
1101264487 12:103068868-103068890 CTATATATATATATAGAGAGAGG - Intergenic
1101898618 12:108774433-108774455 CAAAAGAAAAAGAAAGAGAAAGG + Intergenic
1103000737 12:117383599-117383621 ATATATATATAGAGAGAGAAAGG - Intronic
1103046722 12:117741721-117741743 TTAAAAATAAAGAAGGAGAAGGG + Intronic
1103137902 12:118523558-118523580 CTAGATTTGAAGATGGAGAAAGG + Intergenic
1103605215 12:122080921-122080943 CTACATATACAGGGAGAGAATGG + Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104422006 12:128643917-128643939 CTAAATATAATATTAGAAAATGG + Intronic
1105385647 13:19926658-19926680 CTAAAAATAAAAATAGAGACTGG - Intergenic
1105523753 13:21155323-21155345 CTATATCAAAAGATAGAGACAGG + Intronic
1105582517 13:21712721-21712743 TTAAATATAAAGACACAGATAGG + Intergenic
1106001002 13:25723368-25723390 AAAAGTATAAAGTTAGAGAAAGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106491190 13:30223475-30223497 GTAAATATAAAGACAGGGTAGGG + Intronic
1106543122 13:30707616-30707638 ATAAAAATAAAAATAGATAAAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107201687 13:37727724-37727746 CTAATTCTAAAGAAAGAAAAAGG + Intronic
1107233514 13:38139735-38139757 CTAAATTAAAAGACACAGAATGG + Intergenic
1107238992 13:38209856-38209878 CTGAGTATAAAGGTAGAGGAGGG + Intergenic
1107564791 13:41590742-41590764 CTAAAGGTAAAGAAAGACAATGG - Exonic
1107642545 13:42458491-42458513 CCAAATAGAAACATACAGAAAGG + Intergenic
1107855700 13:44613594-44613616 CTAAATATAAGGATACGGAAAGG + Intergenic
1107866481 13:44708084-44708106 ATAAATATACAGATAGATCAGGG - Intergenic
1107944863 13:45409280-45409302 ATAAATAAAAAGATAAAGAAAGG - Intronic
1108315675 13:49235055-49235077 AAAAAAATAAAGAAAGAGAAAGG + Intergenic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108785979 13:53901839-53901861 ATAAAGATAAATATAGAGATAGG - Intergenic
1108945466 13:56018012-56018034 ATAAATATGAAGATACAGGAAGG - Intergenic
1109079686 13:57882893-57882915 CTAAATATAGAGTTGGGGAAGGG + Intergenic
1109107442 13:58273364-58273386 CTAAATATAAATATCTGGAATGG - Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109474942 13:62867948-62867970 TTAAATAAATAGATAGATAAGGG + Intergenic
1109568961 13:64160798-64160820 CTAAATTTAGAAAAAGAGAAAGG + Intergenic
1109838410 13:67889159-67889181 CTAAATACAAAGAGATAGCAGGG - Intergenic
1109938032 13:69319200-69319222 ATAAATACTAAGATAGAGTAAGG + Intergenic
1110484699 13:76024529-76024551 TTATATATAAAGAAAGAAAATGG + Intergenic
1110603249 13:77400919-77400941 GTAAATATTTAGATATAGAATGG + Intergenic
1111021018 13:82452355-82452377 CTAACTATATATATATAGAATGG + Intergenic
1111094208 13:83489831-83489853 TTAAATATAAAAATATAGAATGG - Intergenic
1111104914 13:83632277-83632299 CTAGAAATAAAGAAGGAGAATGG + Intergenic
1111503651 13:89158549-89158571 CTAAAAATAGAGAAAGAGAGAGG - Intergenic
1111569459 13:90063377-90063399 ATAAAAATAAAGATATATAATGG - Intergenic
1111752332 13:92349019-92349041 CTAAACACAAAGATAGGGGAAGG + Intronic
1112099966 13:96177803-96177825 AAAAATAAAAAGATACAGAAAGG + Intronic
1112514894 13:100044813-100044835 CTTAAAAAAAAGAGAGAGAAGGG + Intergenic
1112569051 13:100577445-100577467 ATAAATAAAAAGAAAAAGAAAGG + Intronic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113274264 13:108711064-108711086 CTATATATATATAGAGAGAAAGG + Intronic
1113310052 13:109122366-109122388 CTAAAGATAAAAATTAAGAATGG + Intronic
1113313258 13:109153393-109153415 ATAGATATATAGATATAGAAAGG + Intronic
1114181349 14:20370595-20370617 CTAAATATTAATAAATAGAAAGG - Intronic
1114594539 14:23899877-23899899 CAAAGTAGAAAGATTGAGAATGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114826569 14:26087787-26087809 ATAAAAATAGAGATAGACAATGG - Intergenic
1114983872 14:28200808-28200830 CTAAACATAAAGAGTGATAATGG - Intergenic
1115050247 14:29051482-29051504 CAAATTAGAAGGATAGAGAAGGG + Intergenic
1115594242 14:34893884-34893906 TTAAATAAAAATATAGAGATGGG - Intergenic
1116032751 14:39592277-39592299 CTAAAAGTAAAGAAACAGAAAGG + Intergenic
1116041316 14:39689554-39689576 TTAAATAAATAGAAAGAGAAAGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116676200 14:47908988-47909010 ATAAATATAAATTGAGAGAAAGG - Intergenic
1116758247 14:48976778-48976800 ATAAATATATAGAGAGAGAGAGG + Intergenic
1116913857 14:50501651-50501673 ATAAATATAAACAAAAAGAAAGG + Intronic
1116917989 14:50543971-50543993 CTAAATCAACAGTTAGAGAAGGG + Intronic
1117453182 14:55872158-55872180 AAAACTATAAAAATAGAGAATGG - Intergenic
1117744761 14:58858219-58858241 CTAAATAAAGGGATAGAAAAAGG - Intergenic
1118003606 14:61545683-61545705 CTAAGTATCAAGCTAGTGAAAGG + Intronic
1118049276 14:62009054-62009076 CTAAAGATAAAGCAAGGGAAGGG - Intronic
1118460883 14:65986002-65986024 AGAAATATGAAGATGGAGAAGGG + Intronic
1118900596 14:69982395-69982417 CTAAAAATAGAGATACAGACAGG - Intronic
1119460045 14:74794179-74794201 CAAAAAAAAAAGAGAGAGAAAGG - Intronic
1120087398 14:80289158-80289180 ATACAGATAAAGATAGAGATAGG + Intronic
1120226917 14:81800912-81800934 ATACATATAAAGAGAGAGTAAGG - Intergenic
1120375432 14:83699101-83699123 TTAAATATAAAGATTCAGATAGG + Intergenic
1120526856 14:85587050-85587072 CTAAATATCAAGTTAGATACTGG - Intronic
1120582106 14:86265282-86265304 CCAATTATAAAGACATAGAATGG - Intergenic
1120615853 14:86703695-86703717 TTAAATTTAAAATTAGAGAATGG - Intergenic
1120627254 14:86843663-86843685 ATAAATATCAAGATTGAAAAAGG - Intergenic
1120799394 14:88671584-88671606 CCAAATTAAAAGACAGAGAATGG + Intronic
1121426188 14:93853833-93853855 CTAAAACTAAAGAAAGAGAAGGG + Intergenic
1122057264 14:99110323-99110345 ATAAATATAAATATATGGAATGG + Intergenic
1122260242 14:100514251-100514273 TTAAATATAAAGATACAAATAGG - Intronic
1122395054 14:101420445-101420467 TTAAATATAAAGATACAGATAGG + Intergenic
1123808003 15:23895220-23895242 CTACATATAAAGATTAAAAATGG - Intergenic
1123878011 15:24643709-24643731 CTATATATATAGATATAGATAGG - Intergenic
1123900029 15:24867349-24867371 TTAAATATAAAGACAGATACAGG - Intronic
1124559937 15:30762343-30762365 CTTAATACAAAAAAAGAGAAAGG + Intronic
1124702713 15:31930634-31930656 CAAGATATAAAAATAGGGAAGGG - Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125008560 15:34845347-34845369 CTAAATACAAAGACACAGAAAGG + Intergenic
1125052595 15:35318156-35318178 TTAAATACAAGGATAGAGAAAGG + Intronic
1125917183 15:43498800-43498822 TAAAAAATAAAGAAAGAGAATGG + Intronic
1126055399 15:44725461-44725483 CTAAAGATAAAGATTTAGAGGGG - Intergenic
1126118938 15:45233960-45233982 CTAAACTTAGAGATAAAGAAGGG + Intergenic
1126509961 15:49459535-49459557 ATTAAGATAAAGATAGAGGATGG - Intronic
1127007614 15:54588071-54588093 CTAGATAAGATGATAGAGAATGG + Intronic
1127174761 15:56341606-56341628 CTAAAAAGAAAGAAAGGGAAGGG + Intronic
1127196990 15:56597961-56597983 CTCAATATAAATATTGAAAAAGG + Intergenic
1127571411 15:60245978-60246000 GTAAATATAAAGACACAGATAGG + Intergenic
1127738910 15:61877935-61877957 GAAAATATAATGACAGAGAAAGG - Intronic
1127861736 15:62999598-62999620 TTAAATATAAACAGAGAGGAGGG - Intergenic
1128052084 15:64673475-64673497 CTCACTATGAAGATATAGAAAGG - Intronic
1129071884 15:72958226-72958248 CTATATCAAAAGATAGTGAATGG + Intergenic
1129128743 15:73470704-73470726 ATAAAAATAAAGCTGGAGAAGGG + Intronic
1130385688 15:83409543-83409565 ATAAATATAGAGCTAGAGATAGG - Intergenic
1130449345 15:84035135-84035157 CTAAATACAAAGAATGAGAGGGG - Intronic
1130752888 15:86731638-86731660 CAAGATACAAAGATAGAGAGAGG + Intronic
1130852661 15:87811385-87811407 GAGAATATAAAGATATAGAAAGG - Intergenic
1131600278 15:93840766-93840788 TTAAATATAAAGATACAGATAGG - Intergenic
1132899993 16:2248406-2248428 AAAAAAATAAAGATAGAAAATGG - Intronic
1134426549 16:14154017-14154039 TTAAATATAAAGATGCAGATGGG - Intronic
1135608695 16:23845921-23845943 ATAAATAAAAAGAGAGAGCACGG + Intronic
1135862764 16:26072011-26072033 CAAAATCCAAAGATAGGGAAAGG - Intronic
1136732696 16:32432141-32432163 ATAAAAATAAAAATAGAAAAAGG - Intergenic
1136899990 16:34024841-34024863 CTAAAAAAAAAAGTAGAGAAAGG + Intergenic
1137517743 16:49163140-49163162 CTTATTATAAAGAAAGAAAAGGG - Intergenic
1137950282 16:52777011-52777033 CTTAATATAAATATTGAGGAGGG + Intergenic
1138430268 16:56963968-56963990 ATAAAGATTAAGATAGATAAAGG - Intronic
1138649906 16:58453994-58454016 CTGGATTTGAAGATAGAGAAAGG - Intergenic
1138966450 16:62090135-62090157 CTATATTTAAAAATACAGAAAGG - Intergenic
1138992536 16:62409184-62409206 ATAAATAAAGAGAGAGAGAACGG - Intergenic
1139878842 16:70167534-70167556 CTAAAAAAAAAGAAAAAGAAGGG + Intergenic
1139998199 16:71000568-71000590 TTAAATATAAAGAGAGCTAAAGG + Intronic
1140342666 16:74180458-74180480 AGAAATTTAAAGATAGAGGAAGG + Intergenic
1140343012 16:74184075-74184097 CAAAATATAAAGCTAGAGAAAGG + Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1141004028 16:80335461-80335483 TTAAATATAAAGATATAGATAGG + Intergenic
1141837018 16:86547656-86547678 ATATATATATAGAGAGAGAAAGG - Intronic
1203020386 16_KI270728v1_random:397461-397483 ATAAAAATAAAAATAGAAAAAGG + Intergenic
1203038721 16_KI270728v1_random:670619-670641 ATAAAAATAAAAATAGAAAAAGG + Intergenic
1142829099 17:2534184-2534206 TTAAATATAAGGATGCAGAAAGG - Intergenic
1143955172 17:10662441-10662463 CTACAGAGAAAGAAAGAGAAGGG - Intergenic
1143990056 17:10951072-10951094 TTAAATATAAAGATACAGATAGG - Intergenic
1144322230 17:14138671-14138693 CTAATTATAAGTTTAGAGAAAGG - Intronic
1144401951 17:14913254-14913276 CAAAATATAAAGATTGAGAGAGG + Intergenic
1144432027 17:15200940-15200962 ATAAAAATAAAGACAAAGAAGGG + Intergenic
1144537531 17:16105416-16105438 CTAAAAATAAATAAAAAGAATGG + Intronic
1146150857 17:30470162-30470184 ATATATATAGAGAGAGAGAAAGG - Intergenic
1146494655 17:33310807-33310829 CCAAATATATAGATAGATATAGG + Intronic
1147013720 17:37473306-37473328 CTAAATATAAGGGGTGAGAAAGG - Intronic
1147474037 17:40692942-40692964 TTAAAAATAAAAATAGAGACAGG - Intergenic
1148045895 17:44744098-44744120 AAAAATATAAAAATAGAGATGGG - Intronic
1148803269 17:50247002-50247024 CCAACTATAAAGATAGTAAACGG - Intergenic
1149574631 17:57702838-57702860 CAAAAAATAAAAATAAAGAAAGG + Intergenic
1149584396 17:57775745-57775767 ATATTTAAAAAGATAGAGAAGGG - Intergenic
1149953667 17:61021024-61021046 GTAAATATAAAGATGGGGAGGGG - Intronic
1150378675 17:64703513-64703535 CTAAATTAAAAAATACAGAATGG + Intergenic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150588750 17:66542225-66542247 CTAAGCATAAAGAAAGAAAAAGG - Intronic
1150762843 17:67978152-67978174 CTAAATAAAAAGATACATCATGG - Intronic
1151058519 17:71062100-71062122 TAAAATATTAATATAGAGAAGGG - Intergenic
1151992213 17:77582864-77582886 ATAAATAGAAAGATACAGAAGGG + Intergenic
1152976181 18:221553-221575 TTAAAAATAAAGATATGGAAAGG - Intronic
1153546264 18:6208583-6208605 CTACAAATAAAGATAAAGGAAGG - Intronic
1153716261 18:7852252-7852274 ATAAATATGAAGATATAGAAAGG + Intronic
1154389159 18:13921758-13921780 CTAAATACAAGGATAGAGGGTGG + Intergenic
1155038212 18:22043043-22043065 CCAAATAGAAAGATAGACAGGGG - Intergenic
1155288485 18:24316427-24316449 ATAAATATAAAGATACATATAGG + Intronic
1155645621 18:28073939-28073961 GTAAATAACAAGATAGTGAATGG - Intronic
1155714557 18:28925466-28925488 ATAAAGAAAAAGAAAGAGAAAGG + Intergenic
1155780612 18:29828861-29828883 TTAAATATAAAGATGTAGAAAGG + Intergenic
1155914249 18:31540342-31540364 CTACATATACAGATACATAACGG + Intronic
1156057303 18:33022850-33022872 CTAAATATAATGATATATAGGGG + Intronic
1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG + Intergenic
1156423657 18:36984611-36984633 CTAAATAAAAAGACTGAGAGTGG + Intronic
1156655651 18:39282851-39282873 TTAAATAGAAAGAAAGAAAAAGG - Intergenic
1156944995 18:42818458-42818480 CTAAATATTTACATATAGAAAGG - Intronic
1156995297 18:43458370-43458392 CTAAATTTTAGAATAGAGAAGGG + Intergenic
1157232567 18:45932554-45932576 CTAAATATAAAAAGTGAGGAAGG + Intronic
1157951068 18:52037843-52037865 TTAACTCTAAAGATAGAGAAAGG + Intergenic
1158063367 18:53375224-53375246 ATAAAGATAAAGATACAGAGAGG - Intronic
1158124864 18:54090094-54090116 TTAAATAGCAAGATAGAGATAGG + Intergenic
1158296687 18:56004261-56004283 TTAAATGAAAAAATAGAGAAAGG - Intergenic
1158332214 18:56375231-56375253 CTTCCTATAAAGGTAGAGAAAGG + Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1158954626 18:62526083-62526105 CAAAATTTAAAGAAAGAAAAGGG - Intronic
1159134281 18:64318749-64318771 CGAAAGAAAAAGAGAGAGAAAGG - Intergenic
1159428629 18:68322127-68322149 CTTATTATGAAGATAAAGAAAGG - Intergenic
1159464723 18:68766672-68766694 CAAAATGAAAAGATAAAGAAAGG - Intronic
1159778763 18:72636662-72636684 CTAAATATAAAGCCAGAGTTGGG - Intronic
1159868784 18:73736990-73737012 CTAAATAAAAAGTTAAAAAATGG - Intergenic
1162318355 19:9955200-9955222 ATAAATATAAATAAAAAGAAAGG + Intergenic
1162929150 19:13947844-13947866 ATAAAAATAAAGAAAGAAAATGG - Intronic
1164545307 19:29156419-29156441 CAAAATACAAATAAAGAGAAAGG - Intergenic
1164798642 19:31057349-31057371 TTAAAAAAAAAGAGAGAGAAAGG + Intergenic
1165018826 19:32906080-32906102 CCAAGCATAAGGATAGAGAAAGG - Intronic
1165054112 19:33162894-33162916 CTAAATAAATAAATATAGAATGG + Intronic
1165607981 19:37123252-37123274 GTAAATACAAAGATAGTTAATGG - Intronic
1165858800 19:38895770-38895792 CTATTTAAAAAGAGAGAGAAAGG + Intronic
1165971204 19:39631834-39631856 CTTAACATGAAGATAAAGAAAGG - Intergenic
1165987068 19:39778737-39778759 CTAAATAAACAGATATTGAATGG + Intronic
1166031134 19:40129750-40129772 ATACCTATAAAGATATAGAAAGG + Intergenic
1166502313 19:43351010-43351032 CTAAAAAAAAAGAGAGAGAGAGG + Intergenic
1166935081 19:46327168-46327190 ATATATATAAAAATAGAGACAGG + Intronic
1166994417 19:46713326-46713348 TTAAATATAAAGGTAAAAAATGG - Intronic
1167814229 19:51865586-51865608 GTCAATATAAAGAGAGAAAAAGG + Intronic
1167958661 19:53088499-53088521 TTAAATAAAAATATAGAGACAGG - Intronic
1168112571 19:54201877-54201899 CAGAATATAAAGATATAGACGGG - Intronic
924996127 2:363570-363592 CATGATATAAAGATAGAAAACGG - Intergenic
925176485 2:1788126-1788148 CAAAATATAAAATTTGAGAAAGG - Intergenic
925467770 2:4124715-4124737 GTTAAGATACAGATAGAGAAAGG + Intergenic
925479060 2:4250362-4250384 GGAAATATAAAGACAGACAATGG - Intergenic
925558696 2:5163312-5163334 CTAAATATAAAGTAAAAGATAGG + Intergenic
925625426 2:5838111-5838133 CTAATTATAAAGAAGGATAAAGG - Intergenic
926070720 2:9887604-9887626 TTAAATATAAAGACACAGATAGG - Intronic
926963269 2:18382344-18382366 TGAAATATAAGGACAGAGAAGGG + Intergenic
927395477 2:22645979-22646001 TTAAATATAAAGATACATATAGG + Intergenic
928524766 2:32128897-32128919 ATAAAGATAAAGACAGAGATAGG - Intronic
928710221 2:33996672-33996694 ATAAATATCCAGGTAGAGAAAGG - Intergenic
928831357 2:35488920-35488942 CTAAATCTAAAGAAGAAGAAAGG + Intergenic
929226886 2:39520408-39520430 CTAAAGCTAAATATAGAAAATGG - Intergenic
929530900 2:42751825-42751847 CTAAATACAAAAAGAGAGAGTGG + Intronic
929651758 2:43686963-43686985 ATAAATATATATAGAGAGAAGGG - Intronic
929875395 2:45792472-45792494 CCAAACACAAAGCTAGAGAAGGG + Intronic
930230503 2:48839471-48839493 CTAAAGATCAAGATAAAGAAAGG - Intergenic
930446383 2:51478510-51478532 TTTAATATAAAGATACAGGAAGG - Intergenic
930553536 2:52866813-52866835 ATAGATAGAAAGATAGAGATAGG - Intergenic
930909055 2:56608163-56608185 TTAAATATAAAGATTCAGATGGG - Intergenic
931156821 2:59642582-59642604 TTAAATATAAGGACACAGAAAGG - Intergenic
931269105 2:60686281-60686303 GTAAAAAGAAAGAAAGAGAAAGG - Intergenic
931527067 2:63168395-63168417 CTAAATAAAATGATTCAGAAAGG - Intronic
931567543 2:63630396-63630418 TCAAATATAATGATAGAGACAGG + Intronic
931920603 2:67011176-67011198 CTAAGTATTGAGATAGAGAGGGG - Intergenic
932107961 2:68965477-68965499 TTAAATATAAAGACACAGAGAGG + Intergenic
932530741 2:72529158-72529180 CTAAATATAAAGCTAGCTACGGG + Intronic
932543079 2:72677357-72677379 TTAAATATAAAAATAAAGATAGG - Intronic
933004894 2:76979562-76979584 CTATATATATATATAGAGAGAGG + Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933400247 2:81787221-81787243 CTCTATGTTAAGATAGAGAAAGG - Intergenic
933568975 2:83985794-83985816 TTAGATATAAAGATGGAGATAGG - Intergenic
934018253 2:87913790-87913812 CTAAATTAAAAGATAAAGAGTGG + Intergenic
934589417 2:95532613-95532635 ATAAATAAAAATAAAGAGAAAGG + Intergenic
935410004 2:102751680-102751702 CTAAAAAGAAAGAAAGAAAAAGG - Intronic
935533514 2:104264678-104264700 CTAAATCTAAAGTTAGCAAAGGG + Intergenic
935662579 2:105480696-105480718 TTAAATATAAAGACACAGATAGG + Intergenic
936690364 2:114880672-114880694 CTAAATACAAATATATAAAATGG + Intronic
936753613 2:115677459-115677481 CCCAATAAAAAGATACAGAATGG + Intronic
936846956 2:116847029-116847051 TTAAGTACAAAGAAAGAGAAAGG + Intergenic
936895072 2:117418388-117418410 CTCAATAGAAAATTAGAGAAGGG + Intergenic
937497550 2:122438112-122438134 TTAAATATGAAAATACAGAAAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937862976 2:126726586-126726608 CTCAATATAAAGAGATAAAAAGG + Intergenic
938641415 2:133284636-133284658 GTTAATATACAGATAGAGATTGG - Intronic
938660610 2:133483071-133483093 CTAGATAGATAGATAGATAAAGG - Intronic
939199860 2:139020011-139020033 TTAGATATAAAGATAAAGAGAGG - Intergenic
939229403 2:139407101-139407123 ATAAATATAAAGAAAAAGGAAGG + Intergenic
939294208 2:140237752-140237774 ATAGATATATAGATAGATAAAGG - Intronic
939682442 2:145155263-145155285 CTAACTATAGAGATAAAAAAAGG + Intergenic
939722748 2:145675467-145675489 CTATATATAAAGGTATATAAAGG + Intergenic
939994971 2:148911573-148911595 CTAAATAGTTTGATAGAGAAAGG + Intronic
940191823 2:151048885-151048907 CTAGAAAAAAAGATAGATAATGG + Intergenic
941054729 2:160774157-160774179 TTAAATATAAAGATATAAATAGG + Intergenic
941060948 2:160846334-160846356 CTATACCAAAAGATAGAGAAAGG + Intergenic
941339148 2:164284629-164284651 ATAACTACAAAGATAGTGAAAGG + Intergenic
941385728 2:164848965-164848987 CAAAATATAGAGATATAGAGAGG + Intergenic
941832951 2:169982383-169982405 ATAAATATAAAGGTTAAGAAAGG + Intronic
941947516 2:171116018-171116040 ATAAATATAAAAATACAAAAAGG + Intronic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942128534 2:172852380-172852402 CTAAATATAAAATCTGAGAAGGG - Intronic
942363081 2:175193332-175193354 AGAAATATAAAGATAGGTAAAGG - Intergenic
942475760 2:176318467-176318489 CTAAATTTATATATAAAGAATGG + Intronic
942877381 2:180817363-180817385 CTAAAGAAAAAGTTAGTGAATGG + Intergenic
943035126 2:182734927-182734949 ATAAATATAAGGATACAGTAAGG - Intronic
943800250 2:192048601-192048623 CTAAATTAAAAGATACAGCAGGG + Intronic
943825028 2:192379257-192379279 CAAAATGGAAAGAAAGAGAAAGG - Intergenic
943941966 2:194009814-194009836 ATAAATATAAAGGTACAGGAAGG + Intergenic
945009936 2:205450229-205450251 CTAAATATAACTATTGAGGAAGG + Intronic
945911177 2:215651417-215651439 CTAAATATATAAAGAAAGAAAGG + Intergenic
946521767 2:220473121-220473143 CATAATATTAAGATTGAGAAAGG - Intergenic
947453320 2:230228767-230228789 GTAAATATAAAAATACAGATAGG - Intronic
947458436 2:230280532-230280554 CGAAAGATACAAATAGAGAATGG - Intronic
947466496 2:230353160-230353182 AGAAATAGAAAGAAAGAGAAAGG - Intronic
1168916931 20:1497167-1497189 CTAAAGCTAAAGAGAGAGAAAGG - Intergenic
1169175660 20:3510506-3510528 CAAAAAATAAAGAAAAAGAAAGG - Intronic
1169604730 20:7304394-7304416 CTTAATATAAAGCTTCAGAAAGG + Intergenic
1169658932 20:7957061-7957083 CAAAATATAGAGAAAGAAAAAGG - Intergenic
1169763273 20:9120493-9120515 CTCACTATAAAGAGAGAGAAGGG - Intronic
1169818255 20:9681262-9681284 TTAAATATAATGATACAGAGAGG - Intronic
1169873508 20:10271933-10271955 CAAAATATAAAGATGGAGCGTGG + Intronic
1170165334 20:13356115-13356137 CTTAACAAAAAAATAGAGAAAGG + Intergenic
1170760599 20:19246784-19246806 ATAGAGATAGAGATAGAGAAAGG - Intronic
1171318124 20:24213863-24213885 ATATAGATATAGATAGAGAATGG + Intergenic
1171445538 20:25200845-25200867 CTAAACATAAAGCTAGAAAAAGG - Intronic
1171790740 20:29521516-29521538 TTAGATATAAAGATACATAAAGG + Intergenic
1172103897 20:32504004-32504026 CTAAATATAAAAAATGTGAATGG - Intronic
1174843280 20:53919555-53919577 CTAAATAAATAAATAAAGAAGGG + Intergenic
1175701893 20:61145202-61145224 GTAAATATTTAGATACAGAAAGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176526482 21:7922877-7922899 TGGAATCTAAAGATAGAGAATGG - Intergenic
1176875981 21:14129269-14129291 CTAAAAATAAATGTACAGAATGG + Intronic
1176912969 21:14590182-14590204 GAATATATAAAGATAGAAAAAGG - Intergenic
1176945051 21:14969827-14969849 CCAAAGAAAAAGATACAGAAAGG + Intronic
1177316956 21:19474803-19474825 CTAAATAGTAAGCAAGAGAAAGG + Intergenic
1177343296 21:19834157-19834179 TGGAATATAGAGATAGAGAAGGG + Intergenic
1177441843 21:21136098-21136120 CCAGATGTAAAGAAAGAGAAAGG - Intronic
1177704297 21:24680738-24680760 TTAAATATAAAGATTCAGATAGG + Intergenic
1177783800 21:25647876-25647898 CTAAATTTGAAAAGAGAGAATGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179075746 21:38120007-38120029 TTAAATATAAAGATATCGACAGG + Intronic
1179589110 21:42393988-42394010 ATAGATATATAGATAGAAAAAGG + Intronic
1180539752 22:16432976-16432998 ATAAAAATAAAAATAGAAAAAGG + Intergenic
1181123101 22:20685643-20685665 ATAAAAAGAAAGAAAGAGAAAGG + Intergenic
1181652352 22:24266855-24266877 ATAAAAAGAAAGAAAGAGAAAGG + Intergenic
1182645875 22:31808937-31808959 ATATATATAAAAATAGAGATGGG + Intronic
1182816640 22:33170381-33170403 ATAAATATAAAAATAAATAAAGG + Intronic
1183802460 22:40178588-40178610 AAAAATAAAAAGATAGAAAAAGG - Intronic
949103367 3:173587-173609 CTCTATATATAGAGAGAGAAAGG + Intergenic
949187099 3:1205119-1205141 CTGATTTTAAAGATAGAGAAAGG + Intronic
950167736 3:10814544-10814566 CTGAATTTAAGGAGAGAGAAAGG + Intergenic
950355073 3:12400781-12400803 CTAAATTTAGAGCTAGAGGAAGG + Intronic
950601087 3:14036230-14036252 CCTAATAAAAAGATACAGAATGG - Intronic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951379964 3:21970778-21970800 CTAAAGACAAACATAAAGAAAGG + Intronic
951482513 3:23176592-23176614 CTAAATGAAAAGAGAAAGAAAGG - Intergenic
951636150 3:24779805-24779827 TTAAATATAAAGATAAAGATAGG - Intergenic
951835190 3:26975643-26975665 CTAAAAATAAATGAAGAGAAAGG - Intergenic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
953029795 3:39171435-39171457 CTCAATAAAAAGAAAGAAAATGG + Intergenic
953068529 3:39497314-39497336 CAGAAGAGAAAGATAGAGAATGG - Intronic
953169651 3:40495711-40495733 ATATATATAGAGAGAGAGAACGG - Intergenic
955100073 3:55839951-55839973 GTAAATATAAAGACAGAAATAGG + Intronic
955611726 3:60764575-60764597 ATAAATAGAAAGTTACAGAAGGG - Intronic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956198632 3:66680899-66680921 CTAAACAGAAATATATAGAAGGG - Intergenic
956240496 3:67124714-67124736 TTAAATATAAAGACATAGATTGG - Intergenic
956570187 3:70685804-70685826 GTAAATATAAATGAAGAGAAAGG - Intergenic
957021734 3:75135857-75135879 ATATATATAAACATAGAGACAGG - Intergenic
957268642 3:78001294-78001316 ATAAAAATAAAGACAAAGAAGGG - Intergenic
957289954 3:78267103-78267125 CTAAAGTCAAAGATAAAGAAAGG - Intergenic
957731216 3:84139654-84139676 ATAGATATAGAGATAGAGATAGG + Intergenic
957836500 3:85598786-85598808 ATATAGATAAATATAGAGAATGG - Intronic
958009207 3:87854250-87854272 AAAAATATAAAAAAAGAGAAAGG - Intergenic
958061166 3:88483309-88483331 ATACATAGAAAGTTAGAGAAAGG + Intergenic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
958666691 3:97148748-97148770 TTAAATATAAAAATTGAAAATGG - Intronic
958791447 3:98655943-98655965 TTAACTATCAACATAGAGAAGGG - Intergenic
959565595 3:107829589-107829611 GGCAATAGAAAGATAGAGAAAGG + Intergenic
959717301 3:109446858-109446880 CTCAAAAAAAAGAAAGAGAAAGG - Intergenic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
959888942 3:111532608-111532630 CTATATATAAAGATGTAGTAGGG - Intronic
959999462 3:112715456-112715478 CTAAATAATACAATAGAGAAAGG + Intergenic
960332585 3:116380428-116380450 ACAAAAATAAAGATAAAGAAAGG - Intronic
960496927 3:118385634-118385656 CTAGAGATAAAGATATAAAATGG - Intergenic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961233460 3:125341692-125341714 CTCAATAAAAACATAGAGATGGG + Intronic
961580647 3:127878958-127878980 TTAAATATAAGGATACAGAAAGG - Intergenic
961703167 3:128763018-128763040 CTAAAGATAATGACAGAAAAAGG - Intronic
961709468 3:128816456-128816478 CTAAATAGGAATATAGAAAAAGG - Intergenic
962144409 3:132825033-132825055 ATAAAGATAAAGACACAGAAAGG - Intergenic
962228571 3:133638885-133638907 CTAAATTTAAAGTTCCAGAAAGG - Intronic
962706879 3:138052170-138052192 CAACATTTAAAGATAGAAAATGG - Intergenic
963013117 3:140794074-140794096 CAAATTATAAAGATGGAGAACGG + Intergenic
963345655 3:144094206-144094228 ATAAATAAATAAATAGAGAATGG - Intergenic
963597422 3:147346051-147346073 CTTAACATAAAGATGGAGATGGG + Intergenic
963783539 3:149510547-149510569 CTAAAGAAAAAGAAAAAGAAAGG - Intergenic
963815487 3:149825955-149825977 GTAAATATAAAGATACAAAGAGG - Intronic
964296956 3:155243991-155244013 ATAAATATATAGATAGATAAGGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
965019147 3:163203609-163203631 ATAAATATAAAAATAATGAATGG + Intergenic
965386513 3:168052761-168052783 ATAAATAGAAAAATAGAGATAGG - Intronic
965883667 3:173418024-173418046 ACAAATAAAAAGAAAGAGAATGG - Intronic
965975727 3:174619333-174619355 GTAAATATAAAGAGATAGAAAGG - Intronic
966112990 3:176426118-176426140 ATACATATAAATACAGAGAAAGG + Intergenic
966264897 3:178027988-178028010 CTGGATATAAGAATAGAGAAAGG + Intergenic
967160071 3:186728069-186728091 TTAAAGATAAAGGTAGGGAAGGG - Intronic
968136578 3:196224158-196224180 TTAAATAAAAACATAGAGAAAGG - Intronic
969078029 4:4595931-4595953 CCAAAGATAAAGCTGGAGAAGGG - Intergenic
969685205 4:8668251-8668273 CTAAAGAAAAAGTTAGTGAAAGG + Intergenic
970595457 4:17596308-17596330 CTAAATATAAATAAATAAAATGG - Intronic
970674460 4:18432754-18432776 CAAAATATAAAGGAAGAGAGGGG - Intergenic
970814110 4:20133450-20133472 TTAAATATAAAGATACAAATAGG + Intergenic
971058041 4:22935613-22935635 TTAAAAATAGAGATACAGAAAGG + Intergenic
971100629 4:23462881-23462903 ATAAATAGAAGGAGAGAGAATGG - Intergenic
971391731 4:26192307-26192329 CTATTTATAAAGTTAAAGAATGG - Intronic
971411496 4:26377746-26377768 CTTAAAATAAAAACAGAGAAAGG - Intronic
971569080 4:28186807-28186829 ATAAATATCCAGATAGAGGAAGG - Intergenic
971685730 4:29764278-29764300 CTAAATGTAATGAGAGAAAATGG + Intergenic
971932338 4:33101279-33101301 AAAAAGATAAAGAAAGAGAAAGG + Intergenic
971971120 4:33622464-33622486 AAAAATATAAAGATGGTGAAAGG - Intergenic
972156755 4:36172660-36172682 CTAAAAAGAAAAATAGGGAAGGG + Intronic
972384521 4:38551945-38551967 CTAAATACAAAGAAAGCAAAAGG - Intergenic
973181024 4:47267799-47267821 AAAAATAAAAAGAGAGAGAAAGG + Intronic
973222487 4:47744584-47744606 CTAAAAAAAAAAAAAGAGAAAGG + Intronic
973692925 4:53457773-53457795 CTAAACATAAAAAAAGAAAAAGG + Intronic
974120882 4:57637666-57637688 CTAAAGAAAAAGAGAGAGAAGGG - Intergenic
974183984 4:58422277-58422299 TTAAATATAAATATATAGAGAGG + Intergenic
974310067 4:60194287-60194309 ATAAATATAGAAATAGAGACAGG - Intergenic
974414707 4:61592529-61592551 TTAAATATAAAGGAAAAGAAAGG + Intronic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
974613782 4:64253527-64253549 ATAAAACTAAAGATACAGAAAGG - Intergenic
974706041 4:65517344-65517366 TTAAATATAAAGACACAGATGGG - Intronic
974840521 4:67294504-67294526 CTGGATTTAAAGATAAAGAAAGG - Intergenic
975145589 4:70963920-70963942 TTAAATATACAGATATAGAATGG + Intronic
975200971 4:71589189-71589211 CCAAATCTAAAGAGAGAAAATGG - Intergenic
975338346 4:73207537-73207559 TTAAATATAAAGACAGAGATAGG + Intronic
975452582 4:74546777-74546799 GTAAATGTAAATATAAAGAAGGG - Intergenic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
975795477 4:78002445-78002467 CTTAACATGAAGATAGAGAAAGG + Intergenic
976449590 4:85172667-85172689 TTAAATATAATGATATAGAGAGG + Intergenic
976495189 4:85721089-85721111 AGAAATTTAAAGATAGAGAAAGG + Intronic
976780097 4:88749193-88749215 CCAAATATAAAGAAGGATAATGG - Intronic
976796169 4:88935504-88935526 ATGAATATAAAGATAGGAAATGG - Intronic
977131953 4:93250795-93250817 ATACATAGAAAGAGAGAGAAAGG + Intronic
977349866 4:95869398-95869420 CTATATATAGAGAGAGAGAGAGG - Intergenic
977531112 4:98201277-98201299 CTATATATATATATAGACAATGG + Intergenic
977760188 4:100725234-100725256 CTAAATATAAAGGTAAAGGTAGG + Intronic
977940632 4:102854673-102854695 TTAAATATAAAGACATAGATAGG - Intronic
978092879 4:104739330-104739352 CTAAATATTAAAGTAGAGACTGG - Intergenic
978212402 4:106154018-106154040 CTTAATGAAAAGATATAGAATGG - Intronic
978488262 4:109281017-109281039 ATAAATATGTAGATAGACAAAGG + Intronic
978692158 4:111526715-111526737 CTATTTTTAAAAATAGAGAAGGG - Intergenic
979246018 4:118505508-118505530 CTAAATACAAAGACAAACAATGG - Intergenic
979472491 4:121116498-121116520 CGAAATAGAAAGGCAGAGAAAGG - Intergenic
979735801 4:124082032-124082054 CTAAATATCACAATAGACAAAGG + Intergenic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
980334432 4:131452324-131452346 ATACATATGCAGATAGAGAAAGG - Intergenic
980342821 4:131572546-131572568 CTTAATGTAAAGATAGCCAAAGG - Intergenic
980531966 4:134068661-134068683 CTAAATATAGAAATATGGAAAGG - Intergenic
980593912 4:134928119-134928141 CTAAAGATAAAGATAGAAAAGGG - Intergenic
980719099 4:136670031-136670053 TTAAATATAGAGAAAGAGAGAGG + Intergenic
980933859 4:139207666-139207688 CTAAATATATAAACAGAGAGAGG + Intergenic
981063960 4:140461297-140461319 CTAGAGAGAAAGTTAGAGAAAGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982113853 4:152080647-152080669 CTAAATAAAGAAAGAGAGAAAGG + Intergenic
982434173 4:155363411-155363433 CAAAATAAAAAAACAGAGAATGG + Intronic
982514284 4:156325493-156325515 CTATATATATAGAGAGAGATAGG + Intergenic
983364745 4:166770784-166770806 TTAGATATAAAGATACAGACTGG + Intronic
983387311 4:167081790-167081812 GAAAATATATAGATACAGAATGG + Intronic
983613948 4:169680176-169680198 AAAAATGTAAAGACAGAGAAAGG + Exonic
983705326 4:170651305-170651327 CTAAATATAAACTTATAGAGGGG - Intergenic
984161809 4:176261564-176261586 CTAAATATAAAGAAAAAAAGAGG - Intronic
984180633 4:176478608-176478630 CTCAAATTAAAGATAGACAATGG + Intergenic
984315451 4:178124283-178124305 TTAAATATAAAGACACAGATGGG + Intergenic
984590418 4:181611214-181611236 CCAAAGATAAACATAGATAACGG - Intergenic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
985213685 4:187625137-187625159 TTAAAAATAAAGAAATAGAAAGG + Intergenic
985287342 4:188349693-188349715 CTAAAGACAAAGCAAGAGAAGGG - Intergenic
985329525 4:188815356-188815378 TTAAATTAAAAGATACAGAAGGG + Intergenic
985713027 5:1440994-1441016 CCAATAATAAAGATAGATAATGG + Intronic
986781385 5:11069124-11069146 CAAAAAGTAAAAATAGAGAAAGG + Intronic
987581658 5:19801922-19801944 GTAAACATTTAGATAGAGAATGG - Intronic
987657699 5:20828502-20828524 GTAAATATAAAGATACAAAGAGG - Intergenic
988066698 5:26234145-26234167 CCAAATATAATGATAGAGATAGG + Intergenic
988229096 5:28450864-28450886 ATAAATATATATATAGAGAGAGG - Intergenic
988675083 5:33424899-33424921 CTAAAATTAAAGATAAAAAAAGG - Intergenic
988702254 5:33686790-33686812 CTATATATATAGAGAGAGAGAGG + Intronic
988765841 5:34375449-34375471 GTAAATATAAAGATACAAAGAGG + Intergenic
990073986 5:51819867-51819889 ATAAATATAAAAAAAGACAATGG - Intergenic
991014624 5:61917670-61917692 CTATATCTAAACATAGAGAGAGG + Intergenic
991231949 5:64344213-64344235 TTAAATATAAAGGCACAGAAAGG + Intronic
991471482 5:66973771-66973793 CTAAAAATGAAGGGAGAGAAAGG - Intronic
991914357 5:71591311-71591333 CAAAATTTAAAAATACAGAAGGG + Intronic
992234039 5:74690351-74690373 CTAAGTGTAAAGATAGAGGCTGG + Intronic
992277754 5:75138460-75138482 ATAAAAATAAAGAGAGAAAAAGG + Intronic
992280498 5:75170719-75170741 TTAAATATAAAGACACAGATAGG + Intronic
992777543 5:80101837-80101859 ATAAATAGAGAGATAGAAAATGG + Intergenic
992952361 5:81872873-81872895 CTAAAGAGAAAGATAGAGAGAGG - Intergenic
992973571 5:82088019-82088041 ATAAATAAAAAGAAAGAAAATGG + Intronic
993018224 5:82561460-82561482 CCAAACAGAAATATAGAGAAGGG - Intergenic
993365926 5:87034335-87034357 CTAAAGATAAACTTAGAGAAAGG - Intergenic
993802937 5:92366600-92366622 CAATATATAAAGGTAGAAAATGG - Intergenic
994313031 5:98298667-98298689 ATAAATATACAGAGATAGAAAGG - Intergenic
994639895 5:102394701-102394723 TTAAAAATCAAAATAGAGAATGG + Intronic
994819939 5:104636420-104636442 GAAAATAAAAATATAGAGAAAGG + Intergenic
994871726 5:105360227-105360249 CTATATATAAAGAGAGACAGTGG + Intergenic
994884101 5:105536684-105536706 CTAAATAAAAACCTAGGGAATGG - Intergenic
995062252 5:107823508-107823530 CTAAGTAAAGAGATAGGGAAAGG - Intergenic
995739792 5:115343673-115343695 TTAAATATAAAGAGCCAGAAAGG - Intergenic
995894477 5:116996512-116996534 CTAAAAATAAAGAACGAGTATGG - Intergenic
996185870 5:120474517-120474539 CTAAGCATAAAGAAAGAAAAAGG - Intronic
996632478 5:125651031-125651053 CTAAAAACAAAAATAGACAATGG + Intergenic
996805022 5:127445090-127445112 AAAAATATAAAGAAAGAGACAGG - Intronic
996987214 5:129582352-129582374 TTAAAAAAAAAGATAAAGAAGGG - Intronic
997133490 5:131300460-131300482 GAACATATCAAGATAGAGAATGG + Intronic
997243686 5:132328071-132328093 TTAGATAAAAAGATAAAGAATGG + Intronic
997348707 5:133213866-133213888 TTAAATATAATGACATAGAAAGG + Intronic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
997929951 5:138064414-138064436 GTATATATATAGAGAGAGAAAGG + Intergenic
997995066 5:138578523-138578545 CAAAAAAAAAAGAGAGAGAAAGG + Intergenic
998611051 5:143688782-143688804 TTAAATATAAAGACAGATATGGG - Intergenic
998696827 5:144650420-144650442 ACAAATATAGAAATAGAGAAGGG + Intergenic
998731201 5:145079553-145079575 ATAAATTTAAAGCCAGAGAATGG + Intergenic
998923659 5:147098767-147098789 CAAAACAAAAAGACAGAGAAAGG + Intergenic
998994800 5:147859858-147859880 CTAAAAGTAAAGATAGAGAGGGG + Intergenic
999087590 5:148906682-148906704 TTAAAGTTAAAGATAGAGAGGGG + Intergenic
999370203 5:151050434-151050456 CTAAATACAATGAAAGTGAAAGG - Intronic
999741500 5:154558139-154558161 TTAAATATAAATATAGAGACAGG - Intergenic
999842681 5:155446284-155446306 ATAAAGATAAAGGTAGAGATTGG + Intergenic
1000316134 5:160093591-160093613 CTAAATATGAAGATAAAAAACGG - Exonic
1000325808 5:160171149-160171171 ATAAAAAAAAAGAGAGAGAAGGG - Intergenic
1001478573 5:172069301-172069323 TTAAATATAAAGATTTAGACAGG + Intronic
1002331090 5:178441549-178441571 CAAATTATAAAGACAGAGATGGG + Intronic
1002334355 5:178467817-178467839 CTAAAAATAAATACAAAGAAGGG + Intronic
1002830115 6:812767-812789 CTAAATAAAAAGATAGACAGGGG - Intergenic
1002952302 6:1826018-1826040 AAAAATAAAAAGATAGAAAATGG + Intronic
1003151432 6:3554392-3554414 TTAAATATAATGATACAGATAGG - Intergenic
1004123307 6:12847271-12847293 ATAAATATACAGATATAGATAGG + Intronic
1004213238 6:13674280-13674302 CTAAATATAAAGACACAGATAGG + Intronic
1004710377 6:18164629-18164651 CTAAATACAAAGACTCAGAAAGG - Intronic
1005529965 6:26693391-26693413 TTCAATACAAAGATATAGAATGG + Intergenic
1005540831 6:26808256-26808278 TTCAATACAAAGATATAGAATGG - Intergenic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1008150581 6:47946562-47946584 CTAAACATAATGATAGACAAAGG - Intronic
1008185272 6:48382053-48382075 TTAAATATAAAGACAAAGATAGG + Intergenic
1008250181 6:49230506-49230528 CCAAAGATCAAGATAGAGAAAGG - Intergenic
1008826636 6:55702432-55702454 ATAGATAGATAGATAGAGAAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009011644 6:57850346-57850368 TTCAATATAAAGATATAGAGTGG - Intergenic
1009227069 6:61029779-61029801 CCTAATATAAAGGTAGAGAGAGG - Intergenic
1009330392 6:62412147-62412169 ATAAATATAAATATAGACACAGG + Intergenic
1009722507 6:67490754-67490776 TTAAATATAAAGATAGATACAGG + Intergenic
1009795417 6:68460380-68460402 TTAAATATAAAGGCAGAGATAGG - Intergenic
1010093934 6:72017199-72017221 GTAAATATTAAGATAGAGCAGGG - Intronic
1010358130 6:74959677-74959699 GTAAATATTGAGATAAAGAAGGG - Intergenic
1010796976 6:80128374-80128396 GTAAATTCAAACATAGAGAAGGG + Intronic
1010800269 6:80167262-80167284 CAAACTCTAAAGACAGAGAAAGG - Intronic
1010978639 6:82344582-82344604 CCAAAAATAAAGAAAGAAAAGGG - Intergenic
1011000732 6:82585176-82585198 CTGAAGACAAAAATAGAGAAAGG + Intergenic
1011404014 6:86997857-86997879 CTTAATATAAAGATATAAATAGG + Intronic
1011800458 6:91008469-91008491 CTAAAAATACTGAAAGAGAATGG - Intergenic
1012072264 6:94637913-94637935 CAAAAATTAAAGAAAGAGAAAGG + Intergenic
1012174621 6:96064711-96064733 TGAAAGATAAAGATAAAGAATGG - Intronic
1012221997 6:96659795-96659817 CAAAATAAAAGGATAGAAAAAGG + Intergenic
1012863932 6:104595402-104595424 CTAATCATAAAGATAGCCAAAGG + Intergenic
1012900802 6:105003926-105003948 ATAAATATATAGATATATAAAGG + Intronic
1014123706 6:117753752-117753774 CAAAATATAAACAGAAAGAAGGG + Intergenic
1014300233 6:119672789-119672811 CTTAATATAAAGCCAGAGGAGGG - Intergenic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014467749 6:121777704-121777726 ATAAAAATAAAAATAAAGAAAGG - Intergenic
1014475553 6:121868279-121868301 CTAAAAATAAAGATAAATGAAGG - Intergenic
1015029803 6:128580816-128580838 TCAAATATGAAGATACAGAAAGG - Intergenic
1015148661 6:130015862-130015884 ATAAATATAAAGAAAAATAAAGG + Intronic
1015672948 6:135711237-135711259 CTAAATAGAGAGAATGAGAAGGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017276305 6:152573066-152573088 TTAAAGGTAAAGAAAGAGAAAGG + Intronic
1017422580 6:154288118-154288140 CTACAGAAAAAGAAAGAGAAGGG + Intronic
1017573014 6:155768097-155768119 TTAAATATAAAGACAGAAACAGG - Intergenic
1017640912 6:156493106-156493128 CTAGATAAAAAGATAAGGAAGGG - Intergenic
1017928805 6:158934815-158934837 GTAAATGAAAAGAAAGAGAATGG + Intergenic
1018067108 6:160131925-160131947 CTAAATATGAAGATAAGGCAAGG + Intronic
1018252305 6:161883089-161883111 ATATAGATAAAGATAAAGAAAGG + Intronic
1018843379 6:167535160-167535182 TTAAAAATATGGATAGAGAAAGG + Intergenic
1019544798 7:1568946-1568968 CAAAATATATATATAGAGAGAGG - Intronic
1020235303 7:6350578-6350600 TTATATATAAAGAGAGAGATAGG + Intergenic
1020491879 7:8796158-8796180 TTAAATACAAAGTTAGAGAAAGG - Intergenic
1020597628 7:10228676-10228698 TTAAATATAAAAATAGATAGTGG + Intergenic
1020604066 7:10313193-10313215 CTAAATATGAAAGTAGAGTATGG - Intergenic
1020674378 7:11163021-11163043 TTAAATAGCAAGATAGAAAAAGG - Intronic
1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG + Intergenic
1022410911 7:30137551-30137573 ATAGATAGAAAGATAGAGGATGG + Intronic
1022647557 7:32245276-32245298 CTAAAGATAAACAAAGAGAAGGG - Intronic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1022992460 7:35721836-35721858 AGAAATGTAAAGAAAGAGAAAGG - Intergenic
1023045098 7:36203717-36203739 CTAACTAAAAAGTGAGAGAATGG - Intronic
1023531371 7:41158623-41158645 CTAAATAAAAAGACATTGAAAGG + Intergenic
1023687073 7:42747425-42747447 AGAAATATAATGATAGCGAATGG + Intergenic
1023809112 7:43897742-43897764 CTGAATATAAGGCTAGATAATGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024712647 7:52034496-52034518 CTAAATATAAAGATACAAATGGG + Intergenic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1025715368 7:63950978-63951000 ATAAAGATAAAAATAGGGAAAGG - Intergenic
1025987494 7:66466657-66466679 CTAAGTATAAAAAGAGAGCAAGG + Intergenic
1026003826 7:66584573-66584595 CTAAGTATAAAAAGAGAGCAAGG + Intergenic
1026027502 7:66758766-66758788 CTAAGTATAAAAAGAGAGCAAGG - Intronic
1026369767 7:69687686-69687708 TTAAAAAGAAAGAGAGAGAAAGG - Intronic
1026410171 7:70112716-70112738 CTAAATTTAAAAAAAGAGAGAGG - Intronic
1027003980 7:74676033-74676055 CCAAATAAAAAGACAGAGAATGG + Intronic
1027341749 7:77216050-77216072 CTATTTATAAATATAAAGAAAGG - Intronic
1027881289 7:83841288-83841310 ATAAATATTAACATATAGAATGG - Intergenic
1028055645 7:86238902-86238924 CTATATATATAGAAAGAAAAAGG + Intergenic
1028183748 7:87755904-87755926 CTAAATAGGAAGATAGGGTATGG + Intronic
1028365831 7:90030515-90030537 TTAAATATAAAAATAGGCAAAGG + Intergenic
1028560573 7:92170365-92170387 CTAAATATCCAGATACAGGAAGG + Intronic
1028641710 7:93049684-93049706 TTAAATATAAAGATACAGATAGG + Intergenic
1028855529 7:95588146-95588168 CGTAATAGAAAGATAGAAAAGGG - Intronic
1029565070 7:101331357-101331379 ATAAAAATAAAAATAGAGACTGG + Intergenic
1029678164 7:102087017-102087039 TTAAACATAAAGATACAGACAGG - Intronic
1030627193 7:111857280-111857302 ATTAATGGAAAGATAGAGAAAGG - Intronic
1030859141 7:114602354-114602376 TTAAATATAAAGACACAGAAAGG - Intronic
1030892273 7:115013515-115013537 TTAAATATCAAGATTGAGAGAGG - Intronic
1031099379 7:117460637-117460659 CTAAATAAAAAGAAAGACAAAGG - Intergenic
1031265081 7:119571096-119571118 ATAAATATAACTATAGAGAGAGG - Intergenic
1031319102 7:120299158-120299180 CTAAAAAAAAAAATTGAGAATGG + Intronic
1031427237 7:121620737-121620759 TAAAAAATAAAGAGAGAGAAAGG + Intergenic
1031910030 7:127506214-127506236 CTAAATACACAGCTAGAGCAAGG - Intergenic
1032009450 7:128333734-128333756 ATAAAAATAAAAATAGACAAAGG + Intronic
1032034030 7:128508471-128508493 CAAAAAAAAAAGAGAGAGAAAGG + Intergenic
1032211507 7:129918755-129918777 TTAAACATATACATAGAGAAAGG - Intronic
1032819914 7:135514562-135514584 ATAAATATAAAGAAAGGCAAGGG + Intergenic
1032949604 7:136892576-136892598 CTAAGTACAAAGACAAAGAAAGG + Intronic
1033066094 7:138155635-138155657 CCAAATATAAACATAATGAAAGG + Intergenic
1033143585 7:138851057-138851079 AAAAATGTAAAGATACAGAAAGG - Intronic
1033197993 7:139343624-139343646 CTAGATATTCAAATAGAGAAAGG + Intronic
1033353142 7:140578568-140578590 CTAAATATATATACAGAGAAAGG + Intronic
1033722221 7:144073791-144073813 CTATATATAAGGATAGAAAGAGG - Intergenic
1033792319 7:144805560-144805582 AAAATTATAAAGATAGAGAACGG + Intronic
1034322013 7:150194444-150194466 TTAAATATAAAGATTTAGATAGG - Intergenic
1034770737 7:153772729-153772751 TTAAATATAAAGATTTAGATAGG + Intergenic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1035587484 8:787004-787026 CAAAAGAAAAAGAAAGAGAAAGG - Intergenic
1036012699 8:4745587-4745609 CTAGAAATAAAGAGAGAGAGAGG + Intronic
1036094759 8:5711543-5711565 CCAAAAACAAAGGTAGAGAAAGG - Intergenic
1036095028 8:5714277-5714299 CAAAATATAAAAATTGAAAATGG - Intergenic
1036271211 8:7304694-7304716 CTGAATTTAAAGAAAGAAAAAGG - Intergenic
1036293505 8:7516904-7516926 TTAAATATAAAGATGGATAAAGG + Intergenic
1036329054 8:7804091-7804113 TTAAATATAAAGATGGATAAAGG - Intergenic
1036350138 8:8005649-8005671 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1037844030 8:22266543-22266565 TAAAATATAATGACAGAGAAAGG - Intergenic
1038095438 8:24304429-24304451 CTAAATTTATACAGAGAGAATGG - Intronic
1038910445 8:31957392-31957414 AAAAATAGAAAGAAAGAGAATGG - Intronic
1038936191 8:32254954-32254976 ATAAAGATAAAGACAAAGAAGGG - Intronic
1039628761 8:39085126-39085148 CTTAATTGAAAGACAGAGAATGG - Intronic
1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG + Intergenic
1040343614 8:46462304-46462326 CTAAAAAAAAAAAAAGAGAAAGG + Intergenic
1040815768 8:51507238-51507260 TTAGATTTAAAGATAAAGAAAGG + Intronic
1041544515 8:59026879-59026901 TTAAAGAGAAAGAGAGAGAAAGG + Intronic
1041677823 8:60553585-60553607 TTAAATATATAGATACAAAAGGG - Intronic
1041866458 8:62580634-62580656 TTAAAAATCAAAATAGAGAATGG - Intronic
1042323014 8:67497954-67497976 TTAAATTTAAAAATAGAGGATGG - Intronic
1042620799 8:70701528-70701550 CTAAAAATATACAAAGAGAAAGG - Intronic
1042697770 8:71576158-71576180 CTATATATAAAGACACAAAAAGG - Intronic
1043198210 8:77328185-77328207 CCAAATGAAAAGATACAGAATGG - Intergenic
1043635631 8:82378356-82378378 CTAAATATCAAGAAAGGGAGAGG + Intergenic
1043736915 8:83760017-83760039 ATACATATAAAGATAAATAATGG + Intergenic
1043948491 8:86281419-86281441 GAAAATATAGAAATAGAGAACGG + Intronic
1043966867 8:86488073-86488095 CTAATAATAAAAATAGAAAAAGG + Intronic
1044098250 8:88096772-88096794 CTAAATATATAGCTATAGGAGGG + Intronic
1044193764 8:89351026-89351048 CTACATATAAGGATAGAAAGGGG + Intergenic
1044360966 8:91283233-91283255 TTAAAAATACAGAAAGAGAAGGG + Intronic
1044403905 8:91804618-91804640 CTAAAAACAAAAATAAAGAAAGG + Intergenic
1044433621 8:92136597-92136619 ACAAATAAAAAGAGAGAGAAAGG + Intergenic
1044459088 8:92424158-92424180 CTAAATATACCAAGAGAGAATGG + Intergenic
1044479604 8:92670016-92670038 TAAAATATAAAGATAGTAAAAGG - Intergenic
1044724993 8:95187436-95187458 ATAAAAATAAAAATAGAAAAGGG - Intergenic
1044804360 8:95989859-95989881 ATATATATAGAGAGAGAGAAAGG + Intergenic
1045598855 8:103691280-103691302 TTAAATATATAGACAGAGATGGG - Intronic
1045707271 8:104940130-104940152 TTAAATATAAAGATTCAGATGGG - Intronic
1045970430 8:108073826-108073848 TTAAATATAAACATAGCAAATGG + Intronic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1046536848 8:115525561-115525583 CTAAATAATCAGATTGAGAATGG - Intronic
1046854315 8:119012847-119012869 CTAACTATGAAGAATGAGAAAGG - Intronic
1046924466 8:119771071-119771093 TTAAAAAAAAAGATATAGAATGG + Intronic
1046987878 8:120410777-120410799 CAAAAAAAAAAGAGAGAGAAAGG - Intronic
1047037820 8:120958457-120958479 ATAAATATAAAAATATTGAAGGG + Intergenic
1047101481 8:121680890-121680912 CTAAAAATAAAAATAAAAAAAGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1050074847 9:1852845-1852867 CTAAAGCTAAGGCTAGAGAAGGG - Intergenic
1050468518 9:5959582-5959604 CAAAATATAAAGAGAGTGAAAGG - Intronic
1050538056 9:6646919-6646941 CTAAAAATAAAAATAAAAAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051037289 9:12763746-12763768 TTAAATATAAGAATAAAGAAAGG + Intergenic
1051198805 9:14594324-14594346 CTTAATATAAAGCTACAGAGTGG + Intergenic
1051240298 9:15047908-15047930 AAAAATGTAAAGACAGAGAAAGG - Intergenic
1051749240 9:20324307-20324329 TTAAATATAAATATCAAGAATGG - Intergenic
1051778259 9:20659402-20659424 CTAAAAAAAAAGAGAAAGAAAGG + Intronic
1051922426 9:22283643-22283665 TTAACTATAAAGACAGAGAGTGG - Intergenic
1052887243 9:33661857-33661879 CTAATTAAAAAGATTGGGAAAGG - Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1054734943 9:68741663-68741685 CTAAGCAAAGAGATAGAGAAGGG + Intronic
1054736171 9:68752567-68752589 GTAAATCTAAAAAAAGAGAAAGG - Intronic
1054772155 9:69093193-69093215 TTAAATATAAAGCTAAAAAAAGG - Intronic
1054890899 9:70250705-70250727 CTAAATACAATGGTAGAGAGAGG + Intergenic
1055193823 9:73562108-73562130 TTAAATATAAAGATATAGATAGG - Intergenic
1056008437 9:82299836-82299858 TTAGATATAAAGAGAGAGACAGG - Intergenic
1056080485 9:83088267-83088289 CTATATATAAATATAGACATAGG + Intergenic
1056347012 9:85706906-85706928 CTCAATTAAAAGACAGAGAAGGG + Intronic
1056347014 9:85706990-85707012 TTAAATATAAAGATAGAAATAGG + Intronic
1057356475 9:94335940-94335962 CTAAAAAAAAAAATAGAGATGGG + Intergenic
1057534762 9:95889937-95889959 ATAAATTAAAAGAAAGAGAACGG - Intronic
1057571589 9:96207982-96208004 CTAACTCTAAAGAGAGAGAGAGG + Intergenic
1057651275 9:96921687-96921709 CTAAAAAAAAAAATAGAGATGGG - Intronic
1058031184 9:100199246-100199268 TTAAATATAAAGACACAGATAGG - Intronic
1058360791 9:104143916-104143938 CTAGATATAAAGATACACACAGG - Intergenic
1058393328 9:104521504-104521526 GTATATATAAAGAGAAAGAAAGG + Intergenic
1058536951 9:105971273-105971295 CTGATGATGAAGATAGAGAAGGG + Intergenic
1058728363 9:107825575-107825597 CTAAATTTATAGATACACAATGG + Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1058915838 9:109564677-109564699 TTAAATATAAAGATACAGGTAGG - Intergenic
1059884513 9:118730584-118730606 CTAAAATTCAACATAGAGAAAGG - Intergenic
1060911622 9:127355793-127355815 CTAAAATTAAACATAGAGGAGGG + Intronic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1061789950 9:133053972-133053994 TGAAAGATAAAGAGAGAGAAAGG - Intronic
1062074661 9:134579240-134579262 GTAAATATAAGGATTTAGAAAGG + Intergenic
1062480888 9:136750838-136750860 ATAAATATAGACATATAGAAAGG + Intergenic
1203734814 Un_GL000216v2:126658-126680 TTAAATTCAAAGATAGAAAAAGG - Intergenic
1185754815 X:2644787-2644809 CTACATATAAAGAGAAAGATAGG + Intergenic
1185778462 X:2825233-2825255 ATAAATAAATAGATAGATAATGG - Intergenic
1186318205 X:8394034-8394056 CTAAAGATGAAAATAGATAATGG + Intergenic
1186366541 X:8900544-8900566 CTAAAAAGACAAATAGAGAAAGG + Intergenic
1186539571 X:10386741-10386763 TGAAATTTAAAGATAGATAAGGG + Intergenic
1186605600 X:11087065-11087087 TTAAATATAAAGATGGAAATAGG - Intergenic
1186713549 X:12226482-12226504 CTAAATATAAAAATCAAGATCGG + Intronic
1187590990 X:20717297-20717319 CAAAATATAAAAATAGAGGAAGG - Intergenic
1187837479 X:23448801-23448823 CTAAACCAAAAGATAGAAAAAGG - Intergenic
1187863720 X:23705177-23705199 CGAAGAATAAAGTTAGAGAAGGG + Intronic
1188103989 X:26125842-26125864 ATAAATAGATAGATAGATAATGG - Intergenic
1188399436 X:29726823-29726845 ATAAAAATAAAAAAAGAGAAGGG + Intronic
1188614688 X:32143171-32143193 CTCAATATAAATATATTGAATGG + Intronic
1188770756 X:34150623-34150645 ATGAATATATAGGTAGAGAAAGG - Intergenic
1188890527 X:35606388-35606410 ATAAAGATAAACATAGAGAGAGG - Intergenic
1190526167 X:51331872-51331894 TCAAAGAGAAAGATAGAGAAGGG + Intergenic
1190798322 X:53764612-53764634 GTGAAGATAAAGAAAGAGAATGG - Intergenic
1191097641 X:56690460-56690482 CTAAAAATAAAGATAATAAAAGG - Intergenic
1191686230 X:63894053-63894075 CCAAATTTAAAGATACAGACTGG + Intergenic
1191817445 X:65262577-65262599 GTCAATATCATGATAGAGAATGG + Intergenic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1192019557 X:67371263-67371285 GAGAATATAAAGATACAGAAAGG + Intergenic
1192990314 X:76446414-76446436 TTAAATATAAAAATAGAGATAGG - Intergenic
1193147194 X:78089538-78089560 TTAGAGATAAAGAGAGAGAAAGG - Intronic
1193259275 X:79386404-79386426 CTAATGATAAACATATAGAAAGG - Intergenic
1193428058 X:81364739-81364761 CTATATATCAAGATTGAGTATGG + Intergenic
1193488155 X:82113837-82113859 CTAAATTCAAGGATAAAGAAAGG - Intergenic
1193504790 X:82328894-82328916 CTATATATAGAGAGAGAGATAGG - Intergenic
1193576229 X:83200502-83200524 CTAAATAGAAAGACAGATCAGGG + Intergenic
1193677279 X:84470425-84470447 CTCAATATAAAAATAGGTAAAGG - Intronic
1193754625 X:85393021-85393043 TTAAACATGAGGATAGAGAAAGG + Intergenic
1194791321 X:98154324-98154346 CTCAATCCAAAGATATAGAATGG - Intergenic
1194841403 X:98748694-98748716 CTAGAGATAAAGAGAGAGATAGG - Intergenic
1194845728 X:98806358-98806380 CTAAATTTAAAGAATGAGAAAGG + Intergenic
1194980301 X:100433499-100433521 CTAAATATAATGGTAGAAAAAGG - Intergenic
1195026513 X:100882990-100883012 CTGACTTTGAAGATAGAGAAAGG + Intergenic
1195152384 X:102085112-102085134 CAAAATAAAAAGAAAGAGAGAGG + Intergenic
1195558536 X:106255849-106255871 TTAGATATAAAGAAAGAGATAGG - Intergenic
1196000143 X:110774249-110774271 TTAAATATAAAGACACAGATGGG - Intronic
1196311060 X:114166425-114166447 TTAAGTATAAAGACAGAGATAGG - Intergenic
1196741989 X:119033190-119033212 GTAAGCATAAAGACAGAGAAAGG - Intergenic
1196986223 X:121275116-121275138 CTAAATATAAAGAGAGAGATAGG - Intergenic
1197198489 X:123727615-123727637 TTAAAAATAAAAATAGAGATAGG + Intronic
1197480150 X:126973775-126973797 CCCAATAAAAAGATATAGAATGG + Intergenic
1197878662 X:131140447-131140469 ATAGATATAGAGAGAGAGAAGGG + Intergenic
1197956297 X:131952084-131952106 CTATATATATATATAGAGAGAGG + Intergenic
1198033237 X:132775736-132775758 CTAAAAATTAAGGTAGAAAATGG - Intronic
1198130677 X:133691618-133691640 ATACAGATGAAGATAGAGAAAGG - Intronic
1198522584 X:137468172-137468194 ATAAATATAAATATAGATGAAGG + Intergenic
1198732120 X:139742905-139742927 ATATATATAAAAATAGAGACAGG + Intronic
1198996041 X:142575682-142575704 CAAAATTTAAAGATAAAGAAAGG - Intergenic
1199126274 X:144125216-144125238 CTAAATTAAAAGATAAAGAGTGG - Intergenic
1199667416 X:150109883-150109905 TTTAATATAAAAATAGAGATTGG - Intergenic
1200297515 X:154936349-154936371 GTAAATATAAGGATAGAGATAGG + Intronic
1200331813 X:155305902-155305924 CAAAATATAAAAATAAAGTAAGG - Intronic
1200629502 Y:5563069-5563091 CAAAAAATAATGATAGAGCATGG + Intronic
1200987739 Y:9321971-9321993 CGAAATACAAACATAGAAAAAGG + Intergenic
1201262546 Y:12174323-12174345 CTAAAAAAAAAGAAAGAAAAGGG + Intergenic
1201384492 Y:13424105-13424127 TTAAAAATATAGAGAGAGAATGG + Intronic
1201452831 Y:14134945-14134967 CTCAATATAAAGAGTTAGAAGGG + Intergenic
1201693394 Y:16794846-16794868 ATTAAAATAAAAATAGAGAAAGG - Intergenic
1201765434 Y:17569989-17570011 AGAAATATAAAGAAAGAGAGAGG + Intergenic
1201836118 Y:18336000-18336022 AGAAATATAAAGAAAGAGAGAGG - Intergenic
1202106260 Y:21370200-21370222 ATATTTTTAAAGATAGAGAAGGG + Intergenic
1202120288 Y:21514229-21514251 CGAAATACAAACATAGAAAAAGG - Intronic
1202122739 Y:21537770-21537792 CGAAATACAAACATAGAAAAAGG - Intronic
1202156266 Y:21891611-21891633 CGAAATACAAACATAGAAAAAGG + Intronic
1202158714 Y:21915152-21915174 CGAAATACAAACATAGAAAAAGG + Intronic
1202185166 Y:22180077-22180099 CGAAATACAAACATAGAAAAAGG + Intronic
1202206194 Y:22406320-22406342 CGAAATACAAACATAGAAAAAGG - Intronic
1202270107 Y:23063291-23063313 AAACATATAAAGATAAAGAAAGG + Intergenic
1202295920 Y:23357391-23357413 AAACATATAAAGATAAAGAAAGG - Intergenic
1202423101 Y:24697036-24697058 AAACATATAAAGATAAAGAAAGG + Intergenic
1202447688 Y:24973050-24973072 AAACATATAAAGATAAAGAAAGG - Intergenic