ID: 917912574

View in Genome Browser
Species Human (GRCh38)
Location 1:179665829-179665851
Sequence GCAACCTGTACTTACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917912572_917912574 0 Left 917912572 1:179665806-179665828 CCTTTTTCTATTCCTATTCTAAA 0: 1
1: 0
2: 4
3: 74
4: 742
Right 917912574 1:179665829-179665851 GCAACCTGTACTTACCATGCAGG 0: 1
1: 0
2: 0
3: 4
4: 74
917912570_917912574 2 Left 917912570 1:179665804-179665826 CCCCTTTTTCTATTCCTATTCTA 0: 1
1: 0
2: 6
3: 81
4: 1028
Right 917912574 1:179665829-179665851 GCAACCTGTACTTACCATGCAGG 0: 1
1: 0
2: 0
3: 4
4: 74
917912571_917912574 1 Left 917912571 1:179665805-179665827 CCCTTTTTCTATTCCTATTCTAA 0: 1
1: 0
2: 6
3: 80
4: 841
Right 917912574 1:179665829-179665851 GCAACCTGTACTTACCATGCAGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917912574 Original CRISPR GCAACCTGTACTTACCATGC AGG Intronic
900807819 1:4779298-4779320 GCCTCCTGCACTTCCCATGCTGG - Intronic
904384649 1:30133322-30133344 GCTGCCTGTACTGGCCATGCTGG - Intergenic
904666845 1:32129240-32129262 GCAACCTCTACCTACCTTCCAGG + Intronic
905371666 1:37485751-37485773 GCATCCTGTGCTTTCCAGGCAGG + Intergenic
905927829 1:41764503-41764525 ACAACCTGAACTTTCCTTGCAGG - Intronic
912156164 1:106923079-106923101 GCATCCAGCACTTACCATGAAGG - Intergenic
914970034 1:152300618-152300640 GAAACCTGTAGTTATCTTGCAGG + Intergenic
916519928 1:165554521-165554543 GCAGCCTTGACTTACCAGGCTGG + Intronic
917912574 1:179665829-179665851 GCAACCTGTACTTACCATGCAGG + Intronic
920332086 1:205216746-205216768 GCAACCTCTACCTCCCAGGCTGG + Intergenic
922137059 1:222839477-222839499 GCAACTTGTACCTCCCAGGCAGG - Intergenic
922722427 1:227905739-227905761 GGATCCTGTACTTCCAATGCTGG - Intergenic
923911457 1:238449820-238449842 TCTACCTGTTCTTACCAAGCTGG + Intergenic
1063276029 10:4568729-4568751 CCAACCTGTTCATACCATGGGGG + Intergenic
1088292171 11:108251065-108251087 GCATGCTGAACTTACCATGAAGG - Exonic
1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG + Intergenic
1094624791 12:32113459-32113481 GCAACCTTAACTAACCATCCTGG + Intronic
1099055616 12:77836147-77836169 GGAACCTTTACTTAACATTCTGG + Intronic
1099657147 12:85508244-85508266 GCAACATGGGCTTACCATGCTGG + Intergenic
1105726118 13:23164003-23164025 GCAACCAGAACTTAATATGCAGG - Intergenic
1107736161 13:43400385-43400407 GCATTCTGGACTTCCCATGCAGG + Intronic
1108466156 13:50717475-50717497 GCAAAATGTACTTACCATTTTGG - Intronic
1111598321 13:90439022-90439044 GCAACATGTACTTACCAAACTGG - Intergenic
1124994920 15:34714102-34714124 GCAACCAGTGCTCACCTTGCTGG + Intergenic
1128800748 15:70495332-70495354 GAAACCTATACTTAACATACAGG - Intergenic
1138315104 16:56063010-56063032 GCAACCTTTGTTTACCATCCAGG - Intergenic
1138598102 16:58040175-58040197 GCCAGCTGTCCTCACCATGCAGG - Exonic
1147905589 17:43820727-43820749 GCAACTGGTACTTACCTTGGGGG + Intronic
1157785856 18:50481949-50481971 GCAACCTGTGGGTACCTTGCAGG + Intergenic
1165831232 19:38731349-38731371 TCAGCCTGTACTCACCCTGCCGG - Exonic
1168578624 19:57534928-57534950 GAAACCTGTGCTTACCATCTTGG - Intronic
928972989 2:37051449-37051471 TCTAGCTGTACTTACCATCCTGG + Intronic
930326799 2:49929938-49929960 GAAAACTGTAGGTACCATGCAGG + Intronic
930386236 2:50699087-50699109 GCAGCCTGTATGTACCATGCAGG + Intronic
938322738 2:130375857-130375879 GGAAACTGTGCTTGCCATGCTGG - Intergenic
943367496 2:186980133-186980155 GTAACCTGGACTTACCCTACTGG + Intergenic
947748337 2:232520688-232520710 CCAGCCTGGACTTACCTTGCAGG - Exonic
947842698 2:233218594-233218616 GCCACCTGGGCTTACCCTGCAGG + Intronic
948292241 2:236834424-236834446 GCAGCATGCACTTACCAGGCAGG + Intergenic
948413236 2:237781075-237781097 GGACCCTGTGCTGACCATGCTGG + Intronic
1170220976 20:13941198-13941220 TCAACCTGTTCTTACGAGGCCGG - Intronic
1184122578 22:42462097-42462119 GAACCCTGTGCTTACCATTCTGG - Intergenic
1184178223 22:42801869-42801891 GCAACCCGTATTTACCCTGGGGG - Intronic
950063468 3:10091904-10091926 GCAACATATACTGACCATGTTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
973770915 4:54205642-54205664 GCAACCTGAACTGACCAGCCTGG - Intronic
975609138 4:76186540-76186562 GCAACCTGTAGATACAAAGCAGG + Intronic
977821183 4:101473959-101473981 GAAACCAGTCCTTACCATTCAGG - Intronic
977993624 4:103476075-103476097 GGTCCCTGTACTTACCATGATGG - Intergenic
981593426 4:146390802-146390824 GCAAGAAGTACTTACAATGCAGG - Intronic
982791742 4:159600214-159600236 TCAACCTGAACCAACCATGCTGG - Intergenic
984812873 4:183810374-183810396 GCTTCCTGTACCTACCATGGTGG - Intergenic
984820383 4:183876551-183876573 GCAACCTCTCCTTGCCATCCCGG - Intronic
984870293 4:184319085-184319107 GCAGCCTGCACTTAACCTGCCGG - Intergenic
986966093 5:13273334-13273356 GCATCCTGTTATTACCATGTTGG + Intergenic
996661313 5:126006673-126006695 GAAAGCTGTACTTACCTTACTGG - Intergenic
997662924 5:135603407-135603429 GCCTCCTGCAATTACCATGCTGG + Intergenic
1000064024 5:157679959-157679981 GCAACCGGTACTTAACCTTCGGG + Exonic
1002810221 6:621188-621210 GCCACCTCTACTGTCCATGCAGG + Intronic
1004970110 6:20900484-20900506 GCAATATCTACTTACGATGCTGG - Intronic
1006625081 6:35392159-35392181 GCAGCCTGTACTTCCCAGTCTGG + Intronic
1006625130 6:35392429-35392451 GCAGCCTGTACTTCCCAGTCTGG - Intronic
1011265023 6:85507967-85507989 GCAACCAGTACTCAACAAGCAGG - Exonic
1012503717 6:99920229-99920251 ACAACCTTTACTTATCATACTGG - Exonic
1017990429 6:159483228-159483250 GCCAGCTGCACTCACCATGCTGG - Intergenic
1033770710 7:144548587-144548609 GCAACCTGTGCTTTCCCTGAAGG + Exonic
1034008250 7:147498967-147498989 GCAAACTGTAATTGTCATGCTGG + Intronic
1034330807 7:150280581-150280603 CCTAACTGTACTCACCATGCTGG - Intronic
1034667236 7:152829268-152829290 CCTAACTGTACTCACCATGCTGG + Intronic
1037838786 8:22229883-22229905 TCACCCTGTACTTGCCATCCAGG - Intronic
1040110627 8:43565752-43565774 GCAACCTGTTCTTGTCATCCAGG + Intergenic
1041581747 8:59468483-59468505 CCAACATGTGCTCACCATGCAGG + Intergenic
1044474523 8:92610645-92610667 GCAACTTGGACTCACCCTGCCGG - Intergenic
1046336689 8:112798981-112799003 GCAACTTGTATTTTACATGCAGG - Intronic
1048805084 8:138232558-138232580 GCAACTTGTATTTATCTTGCAGG + Intronic
1061236215 9:129344099-129344121 GCAACCTCTCCTTCCCCTGCTGG - Intergenic
1062664904 9:137664958-137664980 GCAAGCTGTGCTTACCAGCCAGG - Intronic
1190156990 X:48002289-48002311 GCAACCTTGACTTCCCATGAAGG + Intronic
1195537779 X:106028584-106028606 GCAACCTGTCCCTACAATTCTGG + Intergenic