ID: 917918244

View in Genome Browser
Species Human (GRCh38)
Location 1:179726263-179726285
Sequence CTCTGCAAAATATACAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917918238_917918244 25 Left 917918238 1:179726215-179726237 CCACTACAAATTAATGATTCCAT No data
Right 917918244 1:179726263-179726285 CTCTGCAAAATATACAGGGAAGG No data
917918239_917918244 6 Left 917918239 1:179726234-179726256 CCATTGCTTTCAAGAGTAAGTCC No data
Right 917918244 1:179726263-179726285 CTCTGCAAAATATACAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917918244 Original CRISPR CTCTGCAAAATATACAGGGA AGG Intergenic
No off target data available for this crispr