ID: 917922252

View in Genome Browser
Species Human (GRCh38)
Location 1:179760294-179760316
Sequence TTACACATTGGGCATACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917922252_917922258 -10 Left 917922252 1:179760294-179760316 CCCATTGTATGCCCAATGTGTAA 0: 1
1: 0
2: 0
3: 8
4: 122
Right 917922258 1:179760307-179760329 CAATGTGTAAGGCTGACCCAGGG 0: 1
1: 0
2: 3
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917922252 Original CRISPR TTACACATTGGGCATACAAT GGG (reversed) Intronic
900714436 1:4135044-4135066 TTCCACATTGAGGACACAATTGG - Intergenic
902171562 1:14615692-14615714 CTACACGTTGGCCATACGATTGG - Intronic
905757043 1:40519373-40519395 TTACACATTCAGCATAAAGTTGG + Intergenic
909852650 1:80487771-80487793 TTACACATTGGGAGGTCAATGGG - Intergenic
910576900 1:88775325-88775347 TTCCACAATGGTCATACAGTTGG + Intronic
913970294 1:143409919-143409941 TTACTCACTGGTTATACAATGGG - Intergenic
914064669 1:144235533-144235555 TTACTCACTGGTTATACAATGGG - Intergenic
914114481 1:144730821-144730843 TTACTCACTGGTTATACAATGGG + Intergenic
915179807 1:154048464-154048486 TTACACTTCGGGCATACACCTGG - Intronic
917922252 1:179760294-179760316 TTACACATTGGGCATACAATGGG - Intronic
923081736 1:230663606-230663628 CTACACATTGGGGATATAAGTGG - Intronic
1062782103 10:222359-222381 TTACTCATTAGGCATACAACAGG + Intronic
1063813842 10:9747327-9747349 TTACAGATTTTGAATACAATTGG + Intergenic
1064524626 10:16241766-16241788 TTACATATTGGAGATAAAATTGG - Intergenic
1065853476 10:29811037-29811059 TTACACATTTGGAATGCAAGAGG - Intergenic
1065862018 10:29879775-29879797 TTACACATTTGGGATGCAAGAGG - Intergenic
1067420468 10:46141063-46141085 TAACATTTTGGGCAGACAATAGG + Intergenic
1067425553 10:46208470-46208492 TAACATTTTGGGCAGACAATAGG - Intergenic
1067505812 10:46847544-46847566 TAACATTTTGGGCAGACAATAGG + Intergenic
1071729996 10:88238380-88238402 TTACACTTTGGGCTTTCAAATGG - Intergenic
1074333003 10:112538445-112538467 TTACATATTGGGGAGACAATTGG + Intronic
1077920070 11:6635363-6635385 TTATACATTGGGTACACATTAGG + Intronic
1079600691 11:22309866-22309888 ATATACAATGGGCAAACAATTGG + Intergenic
1080931643 11:36817531-36817553 TTACACAAGTGGCAGACAATAGG - Intergenic
1081383509 11:42444563-42444585 GTACACATGGGGCATGCAAATGG - Intergenic
1082202267 11:49386350-49386372 TTAAAAATTAAGCATACAATTGG + Intergenic
1086448766 11:86895370-86895392 ATAGACATTGTGTATACAATAGG - Intronic
1086653404 11:89319792-89319814 TTAAAAATTAAGCATACAATTGG - Intergenic
1087633033 11:100672868-100672890 TTACACATCGGGGACAGAATTGG + Intergenic
1088279545 11:108122112-108122134 ATAATCATTGGGCATACAAGGGG + Intronic
1090112673 11:123931631-123931653 TTATACATTGGTAATACAATTGG + Intergenic
1090710906 11:129384170-129384192 TTTCACAATGTGCATAGAATAGG + Intronic
1095806844 12:46329123-46329145 TTACACAGTGGCCAAACATTTGG + Intergenic
1102171521 12:110846336-110846358 ATACACATTTTTCATACAATCGG - Intergenic
1102669063 12:114601702-114601724 TAACACATGGGGATTACAATTGG - Intergenic
1107180977 13:37458750-37458772 TTACACATTTGACATACCCTTGG + Intergenic
1109674062 13:65650257-65650279 CTACACATTGGGGAAATAATAGG - Intergenic
1109933807 13:69252478-69252500 TTACTCATTTGGCATGCAAAGGG - Intergenic
1111777433 13:92682029-92682051 CTACACACTGGGGATACAAATGG - Intronic
1115439510 14:33416101-33416123 GTACACATCAAGCATACAATAGG + Intronic
1120374143 14:83678656-83678678 TGACACATGGGGATTACAATTGG + Intergenic
1122851322 14:104533376-104533398 TTACACATTTGTAATACAGTTGG + Intronic
1125912502 15:43453894-43453916 TTAGACAATGGGTATAAAATGGG + Intronic
1130637829 15:85642044-85642066 TTACATATGGGTCATAAAATGGG + Intronic
1131712952 15:95075494-95075516 TTACAGATGGGGCCTTCAATAGG + Intergenic
1131983639 15:98019277-98019299 TTACACACTGAGCATACATCTGG + Intergenic
1133516991 16:6519078-6519100 TTCCACTTTGTGCATACGATGGG - Intronic
1134781814 16:16905065-16905087 TGACACATGGGGACTACAATTGG - Intergenic
1138617578 16:58182602-58182624 TTACACATGTAGCAGACAATTGG + Intronic
1148898733 17:50858374-50858396 TTTCAAACTGGGCATGCAATTGG + Intergenic
1156558263 18:38091920-38091942 ATACACATTGAGAATGCAATGGG + Intergenic
1167035885 19:46994741-46994763 TTACACACTGGGGATGCAGTAGG - Intronic
928761816 2:34592985-34593007 CTACACATTGGGCATGCTTTTGG + Intergenic
929981730 2:46687623-46687645 ATCCATATTGGGCATACAAAAGG - Intergenic
931672449 2:64659767-64659789 TGACACAGTAGGCATTCAATAGG + Intronic
931936750 2:67206710-67206732 TGACACATGGGTCATATAATTGG - Intergenic
933105377 2:78318088-78318110 TTACACATTTGGCATTTAACTGG - Intergenic
934285304 2:91645197-91645219 TTACTCACTGGTTATACAATGGG - Intergenic
935554123 2:104488919-104488941 TTCCACATTGCTCATGCAATGGG + Intergenic
935575669 2:104707870-104707892 TTACCCAGTTGGAATACAATTGG + Intergenic
935915739 2:107947522-107947544 TTACACTTTGGGCATAGACCTGG + Intergenic
940269066 2:151871716-151871738 TTCCAAATTGGTAATACAATTGG + Intronic
945541691 2:211095680-211095702 ATACAAATTGGGCATATTATTGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946662856 2:222019620-222019642 TGAAACATTTGGCATACAGTGGG + Intergenic
1169885998 20:10398544-10398566 GTCCACATTGGGCACACAGTTGG + Intergenic
1176976149 21:15324839-15324861 TTATAAATTTGGAATACAATGGG - Intergenic
1179286654 21:39983532-39983554 TGAAACATTGGGCATACATTGGG - Intergenic
1183967652 22:41452278-41452300 TTCCACGCAGGGCATACAATAGG - Intergenic
954239136 3:49279854-49279876 GTCCACATTGGGCCTACAGTTGG - Intronic
954963068 3:54583097-54583119 TTACACAATGGCCAAACAACGGG - Intronic
955588171 3:60504799-60504821 TTCCACATTGGGCTTACTACCGG - Intronic
955833116 3:63025896-63025918 TTACACATGGGGATTACAATTGG + Intergenic
956770018 3:72517417-72517439 TTACACCTTGGTCATAAATTGGG - Intergenic
957600711 3:82332382-82332404 TTAAAAATTGGGAATACAAATGG + Intergenic
960506989 3:118505790-118505812 TTAAGCATTGGACATATAATAGG - Intergenic
961425774 3:126846332-126846354 TAACAATTTGGGCAAACAATAGG + Intronic
961724928 3:128921666-128921688 TTACACTGGGGGCATACACTGGG - Intronic
964967274 3:162511499-162511521 GTACATGTTTGGCATACAATAGG + Intergenic
967273615 3:187751727-187751749 TTACACTGGGGGAATACAATTGG - Intergenic
969828852 4:9779772-9779794 TTACCCACTGGTTATACAATGGG - Intronic
970365294 4:15352201-15352223 TGACATATTGGACACACAATGGG - Intronic
970559161 4:17266092-17266114 TAAGACATTGGGCATTCAGTTGG - Intergenic
970656066 4:18231039-18231061 CTAGAGATTGGGTATACAATGGG - Intergenic
976706830 4:88027698-88027720 TGACACATGGGGATTACAATTGG - Intronic
978086133 4:104657588-104657610 TGACACATGGGGATTACAATTGG - Intergenic
978354688 4:107859042-107859064 TTCCTCAGTGGGCATAGAATGGG - Intronic
979402766 4:120270113-120270135 TGAGAAATTAGGCATACAATGGG - Intergenic
986505286 5:8443332-8443354 TGACACATGGGGATTACAATTGG + Intergenic
987923387 5:24311394-24311416 TTACACTGGGGGCATACACTTGG + Intergenic
989080532 5:37615406-37615428 TTACTCACAGGGAATACAATAGG + Intronic
989212595 5:38870864-38870886 TTTCACAGTGGGCATACTTTGGG + Intronic
993494736 5:88594937-88594959 TGACACAATGTGCATAAAATTGG + Intergenic
994178416 5:96737147-96737169 TGACACATGGGGATTACAATTGG + Intronic
996797351 5:127363642-127363664 TTAGACATTGGGTGTACAATTGG + Intronic
998202381 5:140135339-140135361 TTGGCCACTGGGCATACAATGGG + Intergenic
999841940 5:155437615-155437637 TTGCACTTTGGGCATGTAATGGG - Intergenic
1000990981 5:167911606-167911628 TTACACATTGGAACTACAACTGG + Intronic
1004405463 6:15329055-15329077 TGACACAATGGGTTTACAATAGG - Intronic
1006203112 6:32314442-32314464 TTGCACATGGGCCATATAATTGG - Intronic
1008611573 6:53189133-53189155 TTACACATTGGGTATAGATTAGG - Intergenic
1011949049 6:92941411-92941433 GTATACATTGGACTTACAATGGG - Intergenic
1015104060 6:129515840-129515862 TTACACTTTGGGCATAGATGGGG + Intronic
1016474229 6:144408956-144408978 TTACACATTGGGTCTGCCATTGG + Intronic
1016610822 6:145987043-145987065 TTATGCATTGAGCATACAAGAGG + Intergenic
1018529034 6:164743500-164743522 TTTCACATTGGGCATGTTATGGG - Intergenic
1023169858 7:37380006-37380028 TTACCCATTGTGCATGCACTTGG + Intronic
1023308958 7:38862994-38863016 TTACACATTTGCCATAAATTAGG - Intronic
1026972317 7:74475907-74475929 GTACACATTGGGCCTGCAGTGGG + Intronic
1027396694 7:77763648-77763670 TGAGACAATGAGCATACAATGGG + Intronic
1027629553 7:80585572-80585594 TTACATATTTGGCAAAAAATGGG + Intronic
1037698913 8:21254205-21254227 TTAGACATTGGGCAGACAGTTGG - Intergenic
1043667123 8:82828245-82828267 TTACAGAATTGGAATACAATAGG - Intergenic
1043816651 8:84810398-84810420 TAAAACATAGGCCATACAATAGG - Intronic
1046265714 8:111826804-111826826 TTATACATTGGGCATAAGTTTGG - Intergenic
1048148036 8:131864655-131864677 TGACACATGGGGATTACAATTGG + Intergenic
1048693710 8:136999106-136999128 TTACACATTTATCATTCAATTGG + Intergenic
1050640790 9:7665306-7665328 AGAGACATTGAGCATACAATTGG + Intergenic
1052569561 9:30201926-30201948 TTTCACATTTGCCATATAATAGG - Intergenic
1055032162 9:71781687-71781709 CTATACACTGGGGATACAATGGG - Intronic
1055155715 9:73060555-73060577 CTAGACACTGGGGATACAATAGG - Intronic
1055406791 9:75983304-75983326 CTACACATGGGGCAAGCAATAGG - Intronic
1057733879 9:97634667-97634689 TTACACATAAGCCTTACAATCGG + Intronic
1185915967 X:4035773-4035795 TTAAAAATTAGGCATACTATTGG + Intergenic
1192636369 X:72823493-72823515 TAACACTTGGGGCACACAATAGG - Intronic
1192645345 X:72897321-72897343 TAACACTTGGGGCACACAATAGG + Intronic
1193432081 X:81420350-81420372 TTACGCACTGGGGTTACAATGGG - Intergenic
1196207448 X:112957032-112957054 TGACACATTGGGATTACAACTGG - Intergenic
1196550856 X:117022945-117022967 TTAGACAAAGGGCATACACTGGG + Intergenic
1197890406 X:131264581-131264603 TTACACACTGGTCACACATTAGG - Intergenic
1202031022 Y:20574419-20574441 TTACTTGTTGGGCATATAATTGG - Intergenic