ID: 917922714

View in Genome Browser
Species Human (GRCh38)
Location 1:179764392-179764414
Sequence AAAGTCTCGTGGATAGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917922708_917922714 29 Left 917922708 1:179764340-179764362 CCATTTTGAGGAACAGAGAAACT 0: 1
1: 0
2: 5
3: 40
4: 354
Right 917922714 1:179764392-179764414 AAAGTCTCGTGGATAGACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 60
917922707_917922714 30 Left 917922707 1:179764339-179764361 CCCATTTTGAGGAACAGAGAAAC 0: 1
1: 0
2: 1
3: 22
4: 294
Right 917922714 1:179764392-179764414 AAAGTCTCGTGGATAGACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 60
917922712_917922714 3 Left 917922712 1:179764366-179764388 CCATGATTGGGGAGTGAAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 94
Right 917922714 1:179764392-179764414 AAAGTCTCGTGGATAGACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917922714 Original CRISPR AAAGTCTCGTGGATAGACTT TGG Intronic
900801683 1:4741020-4741042 AAAGTCTCGTTGAAAGCCTGGGG + Intronic
911721897 1:101200188-101200210 AAGGTCTCTTGAAAAGACTTTGG - Intergenic
912205191 1:107500831-107500853 AAAGTCACTTGGGTTGACTTTGG - Intergenic
917922714 1:179764392-179764414 AAAGTCTCGTGGATAGACTTTGG + Intronic
1066341268 10:34536098-34536120 AAACTCTCGTTGAAAGACTTTGG + Intronic
1068904797 10:62310699-62310721 AAACTCTCATGGATATACTTTGG + Intergenic
1069146413 10:64896928-64896950 AAAGTCTCTTGAACAGAATTTGG - Intergenic
1070986405 10:80693476-80693498 AAAGTCTCATGGTTAAACGTAGG + Intergenic
1073687202 10:105768300-105768322 AAAGTCACATAAATAGACTTAGG + Intergenic
1077828058 11:5831774-5831796 AAAGTTTCTTGGATAGAATCTGG - Intronic
1078407730 11:11086029-11086051 AATGTCTAGTGGATAGTATTTGG - Intergenic
1082810746 11:57477406-57477428 AAAGTGTCCAGGGTAGACTTAGG - Exonic
1084226068 11:67715533-67715555 AAAGTCTCATGGACACACTGGGG - Intergenic
1084970810 11:72771153-72771175 ATAGTCTCAGGGATGGACTTTGG - Intronic
1087732043 11:101790041-101790063 AAAGTATCGTATATAGAGTTTGG - Intronic
1093056857 12:14564633-14564655 TAAGTCTGATGAATAGACTTGGG + Intronic
1095211683 12:39501718-39501740 AAAATCTGGTGAATATACTTTGG - Intergenic
1098980902 12:76954755-76954777 AAAGTATTTTGGATATACTTTGG + Intergenic
1100685128 12:96979321-96979343 AAAGTCTAGTAGACAGATTTTGG + Intergenic
1111543484 13:89699447-89699469 ATAATATAGTGGATAGACTTTGG - Intergenic
1117848563 14:59940905-59940927 AAAGTCACGTTCAAAGACTTTGG - Intronic
1121962310 14:98272829-98272851 TAAGTCTCTTAGAGAGACTTAGG - Intergenic
1123437653 15:20267165-20267187 AGAGTCTCTTGGAGAAACTTAGG - Intergenic
1123974968 15:25544566-25544588 AAAGACTTGTGGAGAGTCTTTGG - Intergenic
1136846924 16:33583690-33583712 AGAGTCTCTTGGAGAAACTTAGG + Intergenic
1140284106 16:73584593-73584615 AAAGTCTAAAGGATATACTTTGG + Intergenic
1203108632 16_KI270728v1_random:1432345-1432367 AGAGTCTCTTGGAGAAACTTAGG + Intergenic
1143791990 17:9304711-9304733 ACAGTCTCGTGGAAAGATTATGG - Intronic
1144578345 17:16443817-16443839 AATGTCACGTGGATTGACCTGGG - Exonic
1146562571 17:33884002-33884024 ATAGTCTCGTGGCTACACATTGG - Intronic
1165033635 19:33017051-33017073 AGAGTCTCTTGGAGAAACTTAGG - Intronic
1165704680 19:37967093-37967115 AAAGTCTTCTTGATAGACCTCGG - Intronic
1166129794 19:40739405-40739427 AAGGTCTGGATGATAGACTTCGG + Exonic
929491783 2:42403593-42403615 AAAGTCACGTAGAGAGACTGAGG - Intronic
932894046 2:75621683-75621705 AAAGCCTTGTGGATTGGCTTGGG - Intergenic
934151453 2:89151379-89151401 AAAGTCACATGGTCAGACTTGGG - Intergenic
934215805 2:90030527-90030549 AAAGTCACATGGTCAGACTTGGG + Intergenic
936757245 2:115729944-115729966 AAAGTCTCCTTGATATAATTGGG + Intronic
936809218 2:116376061-116376083 AATGTTTTGTGGATAAACTTTGG + Intergenic
936869410 2:117116742-117116764 AAAGACTAGTGGATAGTTTTTGG + Intergenic
943957510 2:194211324-194211346 AAAGTCTCCTGGTTTAACTTTGG + Intergenic
1168946042 20:1758788-1758810 ACATTCTCTTGGATAGATTTGGG + Intergenic
1170745045 20:19091614-19091636 AAAGTCCCATGGAGGGACTTTGG - Intergenic
1177508315 21:22048298-22048320 AAAGTCTCCTTAATAGACATTGG + Intergenic
1183287126 22:36973897-36973919 AAAGTGTCATGGAAGGACTTTGG + Intergenic
952461931 3:33536591-33536613 AAAGCCTATTGTATAGACTTTGG + Intronic
959837214 3:110933568-110933590 AAAGCCTCCTGGATTGAATTTGG - Intergenic
960842130 3:121970454-121970476 AAAGTCTGATGGAAAGTCTTTGG - Intergenic
967321382 3:188198476-188198498 AGGGTATGGTGGATAGACTTTGG + Intronic
967780944 3:193438690-193438712 TAAGTCTCTTGGTTAGAGTTTGG - Intronic
971408731 4:26347316-26347338 AATATCTCTTGGATAGAGTTAGG + Intronic
974905113 4:68045557-68045579 AATGTCTGGTGAATAGACATAGG - Intergenic
986964740 5:13257021-13257043 AATGTCTCGTACAAAGACTTAGG - Intergenic
989809250 5:45652993-45653015 AAAGTCTAGTGGATATAAATAGG - Intronic
992898587 5:81270094-81270116 AAAGTCTCCTGGATAGAACCTGG + Intergenic
994177030 5:96722014-96722036 AAACTCCCGTAAATAGACTTGGG - Intronic
1000138239 5:158375173-158375195 AAAGTCTGTTGGACAGACTCAGG + Intergenic
1015823171 6:137284287-137284309 ACAATCTCGTAGATAGACTGAGG + Intergenic
1017525643 6:155239553-155239575 AAAGTCTGGTGGATACAGATAGG + Intronic
1020691246 7:11357329-11357351 AAAGGCTCATGTATAGTCTTGGG - Intergenic
1032771306 7:135060161-135060183 AAAATCTGCTGGATAGACTTGGG - Intronic
1035270519 7:157717167-157717189 AAAGCCTCGTGGATCGATTTTGG - Intronic
1036200247 8:6764990-6765012 ACTGGCTCGTGGATAGATTTTGG + Intergenic
1040578499 8:48675351-48675373 ACAGTCTCCTGGATAGCCTTGGG - Intergenic
1048831037 8:138477758-138477780 AAAGTCTAGTGAATGGAATTAGG + Intronic
1051130561 9:13855778-13855800 ACAGTCTGGTGGAAAGAGTTTGG - Intergenic
1056784431 9:89580092-89580114 ATAGTCACGTGGATAGATTTTGG - Intergenic