ID: 917925474

View in Genome Browser
Species Human (GRCh38)
Location 1:179786077-179786099
Sequence CCCCACTCCCTTGCCAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917925468_917925474 18 Left 917925468 1:179786036-179786058 CCTTCTGGGGAGGTTCTACTAGT 0: 1
1: 0
2: 0
3: 7
4: 66
Right 917925474 1:179786077-179786099 CCCCACTCCCTTGCCAAAAAGGG 0: 1
1: 1
2: 4
3: 21
4: 198
917925467_917925474 26 Left 917925467 1:179786028-179786050 CCAAATCACCTTCTGGGGAGGTT 0: 1
1: 0
2: 3
3: 12
4: 135
Right 917925474 1:179786077-179786099 CCCCACTCCCTTGCCAAAAAGGG 0: 1
1: 1
2: 4
3: 21
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917925474 Original CRISPR CCCCACTCCCTTGCCAAAAA GGG Intronic
902636583 1:17738761-17738783 CCCCACTCATTTGCCAAATGGGG - Intergenic
902694734 1:18132725-18132747 CCCCACCCCCTTGCCCACCAAGG - Intronic
902914407 1:19627874-19627896 CCCCACTCCCTTTTCCAGAAAGG + Exonic
904624921 1:31796992-31797014 CACCACACCCTTCCCAGAAAAGG - Intronic
904868723 1:33602849-33602871 CCCCTCTCCCTTCCCAGGAATGG + Intronic
906231586 1:44169344-44169366 CCCCACTCCTTTCCGAAGAAGGG - Intergenic
906688751 1:47779048-47779070 CCCCACTCCCATGCTAAAGGAGG - Intronic
907247601 1:53117943-53117965 CCTCCCTCCCTTCCCACAAATGG + Intronic
910059573 1:83072992-83073014 CCTGACTCCCTTCCCCAAAATGG + Intergenic
913278696 1:117164343-117164365 CCCCACCCCCCTGCCAGAACTGG - Intronic
915474273 1:156143903-156143925 CCACACTCCCATGACAAACAAGG - Intergenic
915598848 1:156909988-156910010 CCCCACTCCTTCTCCAAGAAGGG + Exonic
915641987 1:157234830-157234852 CCCCAGTCCCCAGGCAAAAAGGG - Intergenic
915931019 1:160061104-160061126 CCCCACTCCTTCCCAAAAAAAGG + Intronic
916306508 1:163341116-163341138 CCCTATACCCTTGCCAAAACTGG + Intronic
917210924 1:172631438-172631460 CTCCATTCCCTTACCAAAAAAGG - Intergenic
917562943 1:176178856-176178878 CCCCACTCCATCCCAAAAAAAGG + Intronic
917705013 1:177623979-177624001 ACCCACTCCCATGCCAGCAAAGG + Intergenic
917925474 1:179786077-179786099 CCCCACTCCCTTGCCAAAAAGGG + Intronic
918486311 1:185032279-185032301 CCCCACCCCCATGCCTAGAAGGG + Intergenic
918500043 1:185183978-185184000 CCCCACTCCCACTCCAAACAGGG + Intronic
920737667 1:208548479-208548501 GCCCACTAGCTTGGCAAAAATGG + Intergenic
920822994 1:209398720-209398742 TCTTGCTCCCTTGCCAAAAAAGG + Intergenic
923653562 1:235896411-235896433 CCCCACTTCCTTGCCAAAAATGG + Intergenic
1063975864 10:11415124-11415146 CGCCACTCCCTTGGGAAAAGTGG - Intergenic
1068633922 10:59327561-59327583 CCCCACCCCCCCACCAAAAAAGG + Intronic
1072758876 10:98039687-98039709 ACCCACTTCTTTGTCAAAAAGGG - Intergenic
1073322185 10:102622111-102622133 CCCCCCTCCCTGGCCAAAGGTGG + Intronic
1073331345 10:102671871-102671893 CAGCACTCCCTGCCCAAAAAAGG - Intergenic
1074329615 10:112492181-112492203 CCCCACTTTCTTGTCAATAAGGG + Intronic
1074554995 10:114480553-114480575 CCCCACCTCCATGCCAAAGATGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078480535 11:11671804-11671826 GACAAGTCCCTTGCCAAAAATGG + Intergenic
1078989539 11:16632715-16632737 CCCCATTCCTGTGCCAAAGAGGG - Intronic
1080802493 11:35620302-35620324 CCTCATTCCCTTTCCGAAAAAGG + Exonic
1080820046 11:35796918-35796940 CCCCACACCCTTGCCAATAACGG - Intronic
1081502366 11:43679592-43679614 CCCCACTCCCCAACCAAAAAAGG + Intronic
1081644334 11:44779129-44779151 GGCCTCTCCCTTGCCAAAAAGGG - Intronic
1083578888 11:63812820-63812842 CCGGACTCCCGTGCCAAAAATGG + Intergenic
1086070756 11:82796404-82796426 CCCCACTCCCTTAGTTAAAAAGG + Intergenic
1088838498 11:113602008-113602030 CCCCAACCCCCTGCCAAAAAAGG - Intergenic
1091091734 11:132777427-132777449 CCCCAGTTCCTTACCAATAAAGG - Intronic
1092030374 12:5278658-5278680 CCCCACTCCTCTGCCCAGAAAGG + Intergenic
1093170208 12:15851899-15851921 CCCCTCTCCCCTCCCACAAAAGG + Intronic
1095864473 12:46956593-46956615 CACCACTCCATTGACGAAAAGGG + Intergenic
1095888983 12:47218226-47218248 CCCCACTTCAGTGCCAACAACGG - Intronic
1096295688 12:50382001-50382023 CCCCACTCCCTACTCAAAAGGGG - Intronic
1098272402 12:68781596-68781618 TCTCACTCCATTGCCCAAAATGG + Intronic
1099818951 12:87684654-87684676 CCCCACTCCTTTCCCCAAATAGG - Intergenic
1101759901 12:107649926-107649948 CCCCTGTTCCTTGCCAAAAGTGG + Intronic
1102784868 12:115596159-115596181 CACCACTCCCCTGCAAAAAAGGG - Intergenic
1103758672 12:123232463-123232485 CCCTACCCCCTAGCAAAAAAAGG + Intronic
1104583611 12:130029471-130029493 CACCACACCCTTCCCAACAAAGG - Intergenic
1104923192 12:132301678-132301700 CCCCACTCGCTGGCCAGAGAGGG + Intronic
1106288067 13:28335416-28335438 CTCCACTCCCTTTCCCCAAAGGG + Intronic
1107537519 13:41350263-41350285 CCCACTTCCCTGGCCAAAAAAGG + Intronic
1107871360 13:44749366-44749388 CCCAACTGCCCTGCCATAAATGG + Intergenic
1109368002 13:61382743-61382765 CCCCACTCCAGTGACAAGAAAGG - Intergenic
1109612708 13:64787433-64787455 CCCCTCCTCCTTGCCAAAACAGG - Intergenic
1110766057 13:79280378-79280400 GCCCACTCACCTGCCAAAAGTGG + Intergenic
1111511630 13:89272342-89272364 ACCCAGTGCATTGCCAAAAATGG + Intergenic
1114295685 14:21327137-21327159 CACAACTCCTTTGCCAAACAGGG + Intronic
1117641654 14:57806145-57806167 TCCCACATCCTTACCAAAAAAGG + Intronic
1118828158 14:69403154-69403176 TCTCACTCCCTTACCAAACAGGG - Intronic
1122140066 14:99658030-99658052 CCCCATTCCCTTAGCCAAAATGG + Intronic
1122421925 14:101583152-101583174 CGCCACTCCCATCCCAAAACTGG + Intergenic
1124551042 15:30681753-30681775 CCCCACACCCTCGCCAAGACTGG - Intronic
1124680212 15:31723915-31723937 CCCCACACCCTCGCCAAGACTGG + Intronic
1125511316 15:40293949-40293971 CCTCCCTCCCTAGCCAAAGAGGG + Intronic
1128305158 15:66593456-66593478 CCCCTCTCCCTTGACAACCAAGG - Intronic
1128801554 15:70500344-70500366 CCCCTCTCCCTCACCAAGAAAGG + Intergenic
1128956551 15:71952973-71952995 TCCCTCTCCATTGCCAAATATGG - Intronic
1129068725 15:72933222-72933244 CCCCACTCCCATTCCATAGAAGG - Intergenic
1129390399 15:75217402-75217424 CCCTTCTCCCTTGCCCATAAAGG + Intergenic
1131065095 15:89429577-89429599 GCCCACTCCCTGGACAGAAAAGG - Intergenic
1131842180 15:96449250-96449272 ACCCAGTCCCTTGCAAAAAAGGG - Intergenic
1132122314 15:99187259-99187281 CCCCTCTACCCCGCCAAAAAAGG + Intronic
1132278766 15:100594050-100594072 CTCAACTCCCTGGCAAAAAATGG + Intronic
1137248221 16:46722707-46722729 CCCCACCCCCACCCCAAAAAAGG - Intronic
1137933079 16:52607145-52607167 CCACACTCACTTGCCTTAAAAGG - Intergenic
1138079961 16:54081264-54081286 CCCTACCCCCTTTCCAAAGAAGG + Intronic
1138440226 16:57029911-57029933 CCCCACTCCCTTGCAAGGCAAGG + Intronic
1138550074 16:57742942-57742964 CCCCCATCCCTTGCCAACCAGGG + Intronic
1140414196 16:74761846-74761868 CACAACTCCATTGCCAAATAAGG + Intronic
1141017502 16:80464468-80464490 CCCCCTTCCCATTCCAAAAAAGG + Intergenic
1141537642 16:84693670-84693692 CCTCACTCCTTTGCCCATAATGG - Intergenic
1141840796 16:86572953-86572975 CCCCACCCCCATCCAAAAAAGGG + Intergenic
1143898486 17:10155657-10155679 TCCCACTCCCATCCCAAAACTGG + Intronic
1144531941 17:16047947-16047969 CATCACTCCCTCTCCAAAAATGG + Intronic
1145411674 17:22671080-22671102 CCTGACTCCATTCCCAAAAAAGG - Intergenic
1145966018 17:28917835-28917857 CCACACTCCCTTCCCAGGAAGGG + Intronic
1146784922 17:35711471-35711493 CCCCACTCCCCGGCCCAAGATGG + Intronic
1146960064 17:36966757-36966779 CTCCCCTCCCCTGCCAAGAAAGG - Intronic
1149446484 17:56717335-56717357 ACCCAATCCCTTGCCCAAAGAGG + Intergenic
1150556772 17:66261781-66261803 CCCCTCACCCTTGCCATTAAAGG + Intergenic
1154065949 18:11107087-11107109 CCCCTTCCCCTTGCTAAAAAGGG - Intronic
1157389448 18:47288955-47288977 CCCCACTCACTTTCCAATAGGGG - Intergenic
1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG + Intronic
1160917865 19:1506372-1506394 GCCCCCTCCCTTGCCAGAAGAGG + Intronic
1162359859 19:10212468-10212490 CACCACACCCTGCCCAAAAAAGG + Intronic
1163326474 19:16606611-16606633 CCCCGCTCCCCTCCAAAAAATGG - Intronic
1167468434 19:49662470-49662492 TCCCACTCCCTTCCCAAACCTGG - Exonic
927758011 2:25724120-25724142 CCCCTCTCCCTTGCCGAAGCTGG - Intergenic
929546010 2:42855617-42855639 CCCCACTCTCTTGCAAGAACTGG - Intergenic
929689434 2:44062168-44062190 CCCCCCTCCCTTATGAAAAAAGG + Intergenic
931436991 2:62256267-62256289 CCCCACTCCCTTATGAAGAAGGG - Intergenic
932153068 2:69390612-69390634 CCCCACTCCTGTGGCAAAGAAGG + Intergenic
933627915 2:84622817-84622839 CTCCACGCCCTTGCCAACATGGG + Intronic
934504735 2:94881028-94881050 CCCCACTACCTTCCCCAACAGGG + Intergenic
934906227 2:98206722-98206744 CCTCACTCCCTAGCCAAGAGTGG + Intronic
937234775 2:120424119-120424141 CCACACACCCTGGCCAAGAAGGG + Intergenic
939941086 2:148352232-148352254 CCCCACCTCCTTGCCACCAATGG + Intronic
940004321 2:148997434-148997456 CCCCTGTCCCTTGCCATATACGG - Intronic
942706844 2:178783535-178783557 CCCTTCTTCCTTGCCAAATATGG + Intronic
942859585 2:180593246-180593268 CCCCACACCCTTGTCTACAATGG + Intergenic
943802075 2:192073043-192073065 CCACATTCCTTTGCCTAAAAAGG + Intronic
944526431 2:200624469-200624491 CCCCTTTCCCTTTCCAAACAGGG - Intronic
945468864 2:210203703-210203725 TCTCACTCTGTTGCCAAAAATGG + Intronic
946074459 2:217062496-217062518 TCTCACTCCCTTTTCAAAAATGG + Intergenic
946389132 2:219404999-219405021 CCCCACTCCCCAGCCAGAAAAGG - Intergenic
946434754 2:219644151-219644173 CCGCCCTCCCTTGCCATAGATGG - Intergenic
946677704 2:222179874-222179896 CCCTACTTCATTGTCAAAAAGGG + Intergenic
1168827149 20:821689-821711 CCCCACTCCCACGCCAAACAGGG + Intergenic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1169655914 20:7922894-7922916 CCCCACTCCATCTCAAAAAATGG + Intronic
1172178022 20:32984407-32984429 CCCCTCTTGCTTGGCAAAAACGG - Intronic
1174200361 20:48802820-48802842 CCCCATTCCCTTTGCAACAAGGG + Intronic
1175579273 20:60086607-60086629 ACCCACTCCCTGACCTAAAAAGG - Intergenic
1178045668 21:28691435-28691457 GCCAACTCACTGGCCAAAAATGG - Intergenic
1178049680 21:28733868-28733890 CCCCACCCCCTTCCCAGCAACGG + Intergenic
1178279257 21:31266758-31266780 CCCCAGTCCCTGGCTGAAAATGG - Exonic
1178501396 21:33128535-33128557 CCCCTCTCCCTTGGAAAATAAGG + Intergenic
1178934486 21:36850022-36850044 CCCAACTCCCCTCCCTAAAATGG + Intronic
1179655637 21:42842572-42842594 CCCCACTCCCCTTCCAGACAGGG - Intergenic
1181151894 22:20890139-20890161 CCCCACTCCCATGCCCAGGAAGG + Exonic
1182145948 22:27996749-27996771 CCACACTCCCTTCCGAAACAGGG + Intronic
1183318860 22:37152699-37152721 CCCTTCTCCCCCGCCAAAAAAGG - Intronic
1183911921 22:41086371-41086393 CTCCACTTCCTTGCCAATATTGG + Intergenic
1183954524 22:41371391-41371413 CCACACTGCCTTGCCTAGAAAGG - Intronic
1184459850 22:44630964-44630986 CCCCTCTCCCTGACCAAGAAGGG + Intergenic
1184812789 22:46848192-46848214 CCCCACTCCCTCCAAAAAAATGG + Intronic
949478949 3:4474996-4475018 CCCCATTCACCTGCCACAAAGGG + Intergenic
950330445 3:12152126-12152148 CCCCACTTCCTTGGCCAAAAGGG + Intronic
951089856 3:18560005-18560027 CCCCTCTCCCCTGCCAAAACTGG + Intergenic
951728190 3:25783185-25783207 CCCCAGTCCCTGGCCGAACAAGG + Intronic
952862641 3:37826817-37826839 TCCCACATCCTTGCCCAAAATGG + Intergenic
954335209 3:49912277-49912299 CCCCACTCCCTTGCCCATCTTGG + Intronic
955064402 3:55522207-55522229 CCCTTCTCCCCTACCAAAAATGG - Intronic
955385436 3:58475544-58475566 CCCCACTCCCATGCAATGAAGGG - Intergenic
955604505 3:60686317-60686339 CCCCACACACTTCCCAAAATTGG - Intronic
956250026 3:67226152-67226174 CCTCACTCCCCTTCCAAACAAGG - Intergenic
958163893 3:89854102-89854124 CCCTACTCCTTCTCCAAAAAAGG - Intergenic
961440616 3:126950866-126950888 CATCACTCCCTTCCCAACAATGG - Intronic
962061851 3:131936350-131936372 CCCCCATCCATTGCAAAAAAGGG - Intronic
962796791 3:138856425-138856447 CCCCACTGCCTTGCAAAAAAAGG + Intergenic
966437687 3:179906969-179906991 CCCTACTTCCTTTCCAAAAGAGG - Intronic
966848411 3:184148286-184148308 CCCTACTCCCTTGCATAAAATGG + Intronic
971768657 4:30867677-30867699 CGCCACTTCCTTGCGAGAAAGGG + Intronic
974079350 4:57196172-57196194 CGCCACTCCCTTTCCCAAGAGGG + Intergenic
974155936 4:58072623-58072645 CCCCACTCTCATGCCAAGAGAGG + Intergenic
974889968 4:67869957-67869979 ACACCCTCCCCTGCCAAAAATGG + Intronic
976113291 4:81699960-81699982 CCCTACTCCCATGCCCAGAAGGG + Intronic
976852132 4:89559850-89559872 CCCCAGACCCTCGCCAAAAAAGG - Intergenic
977755295 4:100663514-100663536 CCCTACACCCTTGCCAACACTGG + Intronic
979210686 4:118098003-118098025 ACCCACCCCCTTCCAAAAAAAGG - Intronic
984779060 4:183506779-183506801 CCCCACCCCCTCCCCAAACACGG - Intronic
986154693 5:5163064-5163086 CACCACTGCCTGACCAAAAAGGG + Intronic
986267186 5:6200979-6201001 TCCCCTTCCCTTGCCAAAGATGG + Intergenic
986267701 5:6204607-6204629 TCCCCTTCCCTTGCCAAAGATGG + Intergenic
986476457 5:8139062-8139084 CCCTACTGCCTTGTGAAAAAAGG - Intergenic
990061865 5:51660260-51660282 TCCCATTCCATTGCCAAAATGGG + Intergenic
992138838 5:73775105-73775127 CCCCACTTCCTTGGCTAAAAAGG + Intronic
995246567 5:109942013-109942035 CTCCATTCCCTTAACAAAAATGG - Intergenic
995506213 5:112862803-112862825 CCCCACTCCTTTACAAACAAAGG - Intronic
998694485 5:144623960-144623982 CCCCACTCCCACCCCAAAACAGG + Intergenic
998763412 5:145457334-145457356 ACCTACTCCCTTGCCAAAGATGG - Intergenic
999333978 5:150699424-150699446 CCCTACCCTCTTCCCAAAAAAGG - Intronic
1002178148 5:177414175-177414197 CCCCTTTTCCTTGCCAAACATGG - Intronic
1005170530 6:22980230-22980252 CCCCACCCCCTAGCCAAGAGAGG + Intergenic
1005219312 6:23568007-23568029 CCTCACTCCATGACCAAAAAAGG + Intergenic
1006144769 6:31952099-31952121 CCCCACTCCCTTGCCCCAAAAGG - Exonic
1006373662 6:33659923-33659945 CCTCACTCGCTTGCCAATGAGGG - Intronic
1008803625 6:55401091-55401113 CCCCACTGCCATCCAAAAAAGGG - Intronic
1008876271 6:56332582-56332604 CCCCCCGCCCCCGCCAAAAAGGG + Intronic
1011673919 6:89712700-89712722 CCACAGTCCCATGCCAAGAATGG + Exonic
1011725190 6:90203990-90204012 CCCAAATCCCGTGCCACAAAAGG - Intronic
1014049432 6:116934998-116935020 CCCCCCTCCATTTCCAAAATAGG - Intergenic
1018092446 6:160356609-160356631 CCCCACTCCATAGCCATGAAGGG - Intronic
1018150849 6:160936919-160936941 CCCCACTCCCATTCCTAAAAAGG - Intergenic
1021314168 7:19125727-19125749 CCACTCTGCCTTGCCAGAAAAGG - Intergenic
1023087432 7:36585363-36585385 TCCCACACCCTTGCCAATACTGG - Intronic
1023197691 7:37659576-37659598 CCCCACTTCCTTTCCATACATGG - Intergenic
1024731296 7:52256510-52256532 CCCCACACCCTTGCCCTGAAGGG + Intergenic
1026258494 7:68733732-68733754 TCCCAATTCCTTGCCAAACAGGG + Intergenic
1028554579 7:92108404-92108426 CTCCACTCCCTTCCCCAAAAAGG - Intronic
1029805595 7:102992609-102992631 CCCCATCCCCCTCCCAAAAAGGG - Intronic
1032354436 7:131196901-131196923 CCCCTCTCCCTGGTCAAGAATGG + Intronic
1032824438 7:135555303-135555325 CCCCACCCAGTTGCCAAAATCGG - Intergenic
1034334747 7:150313899-150313921 CCCAAGTCCCTTGCAAAAACTGG - Intronic
1035641223 8:1186575-1186597 CCCCACCTCCATGACAAAAAGGG - Intergenic
1036583164 8:10096360-10096382 CCCCACCCACCTCCCAAAAATGG - Intronic
1037677331 8:21062953-21062975 TCTTATTCCCTTGCCAAAAATGG + Intergenic
1039315596 8:36368265-36368287 GCTCACTCTCTTTCCAAAAATGG + Intergenic
1040829387 8:51660829-51660851 CCTCACTCTGATGCCAAAAATGG - Intronic
1041740801 8:61154447-61154469 TCCCACTCCCTATCAAAAAATGG - Intronic
1047327961 8:123858030-123858052 CCCCAGTCCCTGGCCAAATGAGG - Intronic
1048685798 8:136904236-136904258 CCCTTCTCCCTTTGCAAAAATGG - Intergenic
1049507812 8:143013211-143013233 GCCCACTCCTTTTCCAAAGAGGG - Intergenic
1053428390 9:38026044-38026066 CCCCACCCCCTTCCCAAGGAAGG + Intronic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1062094828 9:134697733-134697755 TCCCACTCCCTTGCCATAGGTGG + Intronic
1186185811 X:7018710-7018732 CCTCCCTCCCTTTCCAAGAAGGG + Intergenic
1189152466 X:38722546-38722568 CCCTACACCCTTACCAACAATGG - Intergenic
1189852815 X:45193920-45193942 CCCCACTCCCCGGCCACTAAAGG + Intronic
1191633418 X:63350448-63350470 CTCCACTGCCTTGCCAATCAGGG + Exonic
1191741024 X:64434981-64435003 CCCCACCCCCCTCCCAGAAAGGG - Intergenic
1192373958 X:70540038-70540060 GCCCACTCCCTTGCTAAAGCAGG + Intronic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1194012918 X:88584337-88584359 CCACCCTCCCTTGCCAAACAAGG + Intergenic
1194170462 X:90574738-90574760 CCCAACTCCCTGTCCCAAAAGGG - Intergenic
1195408077 X:104538983-104539005 CACTAATCCCTTGCAAAAAAGGG + Intergenic
1196012871 X:110906732-110906754 CCAAACTCCCTTGCAAATAAGGG - Intergenic
1197371354 X:125629274-125629296 CCCCCCTCCCCTGCCAACAAAGG - Intergenic
1198179566 X:134192979-134193001 CCCCACAACCTTGCCAAAATGGG - Intergenic
1200936396 Y:8742126-8742148 TCTCACTCCCTTTCCAAAAGAGG + Intergenic