ID: 917926797

View in Genome Browser
Species Human (GRCh38)
Location 1:179795863-179795885
Sequence ATGGAAATGAGTTCCTGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917926794_917926797 -3 Left 917926794 1:179795843-179795865 CCCAAGTTTGGCTTGGTTTTATG 0: 1
1: 0
2: 0
3: 13
4: 195
Right 917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG 0: 1
1: 0
2: 0
3: 17
4: 136
917926793_917926797 -2 Left 917926793 1:179795842-179795864 CCCCAAGTTTGGCTTGGTTTTAT 0: 1
1: 0
2: 2
3: 22
4: 248
Right 917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG 0: 1
1: 0
2: 0
3: 17
4: 136
917926787_917926797 23 Left 917926787 1:179795817-179795839 CCTTTTGTCTTTTTCTAACCCCT 0: 1
1: 1
2: 3
3: 57
4: 571
Right 917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG 0: 1
1: 0
2: 0
3: 17
4: 136
917926790_917926797 4 Left 917926790 1:179795836-179795858 CCCTCTCCCCAAGTTTGGCTTGG 0: 1
1: 0
2: 2
3: 12
4: 204
Right 917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG 0: 1
1: 0
2: 0
3: 17
4: 136
917926792_917926797 3 Left 917926792 1:179795837-179795859 CCTCTCCCCAAGTTTGGCTTGGT 0: 1
1: 0
2: 2
3: 6
4: 182
Right 917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG 0: 1
1: 0
2: 0
3: 17
4: 136
917926795_917926797 -4 Left 917926795 1:179795844-179795866 CCAAGTTTGGCTTGGTTTTATGG 0: 1
1: 0
2: 0
3: 13
4: 134
Right 917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG 0: 1
1: 0
2: 0
3: 17
4: 136
917926789_917926797 5 Left 917926789 1:179795835-179795857 CCCCTCTCCCCAAGTTTGGCTTG 0: 1
1: 0
2: 4
3: 20
4: 183
Right 917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG 0: 1
1: 0
2: 0
3: 17
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917926797 Original CRISPR ATGGAAATGAGTTCCTGCGT TGG Intronic
902095192 1:13938291-13938313 ATGGGAATGAGTTCTTGATTTGG + Intergenic
908094679 1:60724734-60724756 ATGGAATTGTGTTCCTGATTTGG + Intergenic
911117545 1:94261626-94261648 ATGGAATTGCGTTCCTGATTTGG - Intronic
911391419 1:97249300-97249322 ATTGAACTGACTTCCTGCCTTGG - Intronic
915078585 1:153334270-153334292 ATGGAATTGAGTTCTTGATTTGG - Intronic
915340287 1:155173631-155173653 AGGAAAATGAGTTCCTGGTTGGG - Intronic
915647061 1:157279804-157279826 ATGGAAAGGAGTTGCAGAGTGGG + Intergenic
917926797 1:179795863-179795885 ATGGAAATGAGTTCCTGCGTTGG + Intronic
918561543 1:185873904-185873926 ATGTAATGGAGTTCCTGGGTAGG - Intronic
919578491 1:199341122-199341144 ATGGAATTGCCTTCCTGAGTTGG - Intergenic
920390303 1:205595999-205596021 ATGGAAAGGCCTTCCTGGGTAGG + Intronic
920628183 1:207624583-207624605 ATGAAATTGAGTTCCTGTCTAGG - Intronic
920638280 1:207726466-207726488 ATGAAATTGAGTTCCTGACTAGG - Intronic
920820058 1:209371880-209371902 ATGGAAATGTATTCCTGGGTGGG - Intergenic
1063607071 10:7531797-7531819 CTGGAAGTGAGTTCCTTCCTGGG - Intergenic
1063758493 10:9043609-9043631 ATGGGAATGGGTTTCTGTGTAGG + Intergenic
1064097586 10:12435385-12435407 ATGGAAATGAGGTGCTGAGCAGG - Intronic
1066033344 10:31453102-31453124 ATGCAAATGAGTGCATGCTTAGG + Intronic
1067067924 10:43113963-43113985 CTTGAAATGTGTTCCTGGGTGGG - Intronic
1068082345 10:52335215-52335237 ATGGAAAAGAGGTCCTGGGAAGG + Intergenic
1069063809 10:63921871-63921893 TTTTAAATGAGTTCCTGCGTTGG + Intergenic
1070013782 10:72503834-72503856 ATGGAATTGAGTTCTTGATTTGG - Intronic
1070513965 10:77186523-77186545 ATCGAAATTAGTACCTGTGTAGG - Intronic
1070901786 10:80036439-80036461 TTGGAAGTGAGTTCCTTGGTTGG - Intergenic
1074235446 10:111580404-111580426 AAAGAAATGAGTTACTGTGTTGG - Intergenic
1075166449 10:120072083-120072105 ATTGAAATGTGATCCTGTGTTGG - Intergenic
1078538422 11:12193708-12193730 ATGGATATGAGTTTCTGCTTTGG + Intronic
1079484422 11:20920159-20920181 GTGGACATGAGTTCCAGCCTAGG + Intronic
1081011277 11:37815593-37815615 ATGGAAATGAATTTCTGACTTGG + Intergenic
1081743242 11:45455504-45455526 AGGGAAATGAGTTGCTGCTATGG - Intergenic
1081976709 11:47240012-47240034 ATGGACAGGAGATCCTGGGTTGG - Exonic
1085855981 11:80176655-80176677 ATGGAATTGTGTTCCTGATTTGG + Intergenic
1085860955 11:80235094-80235116 ATGGAATTGTGTTCCTGATTTGG - Intergenic
1088603364 11:111504247-111504269 ATGGAACTGAGTTTATGTGTGGG - Intronic
1093115585 12:15206806-15206828 TGGGAAATGAGTTTCTGCATAGG + Intronic
1099385325 12:82006298-82006320 ATGGAAAGGAGTTCCTTGGCAGG + Intergenic
1100016081 12:90012363-90012385 CTCTAAATGAGTTCCTGCCTTGG + Intergenic
1101309997 12:103568992-103569014 ATGGGATTGAGTTCTTGCTTTGG - Intergenic
1103670335 12:122609422-122609444 AAGGAAAAGAGTACCTTCGTAGG - Exonic
1105672866 13:22639892-22639914 TTTGATATGAGTTCCTGCATTGG + Intergenic
1107026383 13:35805766-35805788 ATGGTAATGAGCTCCTGTGAAGG + Exonic
1110334759 13:74314951-74314973 ATGGAATTGCGTTCCTGATTTGG + Intergenic
1118634544 14:67735565-67735587 ATGGATATGGCTTCCTGCCTTGG + Intronic
1118964904 14:70571853-70571875 ATGGAATTGAGTTCTTGATTTGG - Intergenic
1119380025 14:74222527-74222549 ATGGAAATGAGGTTCTGCCAGGG - Intergenic
1123407252 15:20028462-20028484 CTGGGGCTGAGTTCCTGCGTTGG + Intergenic
1123516579 15:21035118-21035140 CTGGGACTGAGTTCCTGCGTTGG + Intergenic
1125209478 15:37196629-37196651 ATGGAAAAGAGTTGGTGGGTGGG + Intergenic
1129583331 15:76835898-76835920 ATGGAAATGTGTTCTTGATTTGG - Intronic
1139736663 16:68995672-68995694 ATGGAAATAAGTTCCAGCATGGG - Intronic
1146182525 17:30707322-30707344 AGGGAAAAGGGTTCCTGAGTAGG - Intergenic
1155931837 18:31716675-31716697 ATGGAGATGAGTTCCAGGGTAGG - Intergenic
1157340136 18:46771048-46771070 ATGGAACTGAGTTCTTGCCAAGG - Intergenic
1158486284 18:57868921-57868943 ATGGAAGTGACTCCCTGCCTAGG - Intergenic
1160606412 18:80053427-80053449 ATGGAATTGAGTTCTTGATTTGG - Intronic
1162976296 19:14208483-14208505 AGGGAAAAGGGTTCCTGAGTAGG + Intergenic
1165381877 19:35487530-35487552 ATGGAAAGGAATTTCTGCCTCGG + Intronic
925074336 2:1001489-1001511 ATGGAATTGACTTCCTGAATTGG - Intronic
925352954 2:3215063-3215085 ATGAAAATGTGTTCCTGGGGCGG - Intronic
927719046 2:25371634-25371656 CTGGAAGTGAGTTCCTGCCTTGG + Intergenic
930675647 2:54197693-54197715 AAGAAAATGTGTTCCTGCCTCGG - Intronic
937382993 2:121398387-121398409 ATGGAAAGGAGTCCCTAGGTTGG + Exonic
937651610 2:124325612-124325634 ATGTTAATGAGTTCCAGAGTTGG - Intronic
939724104 2:145693257-145693279 CTGGAACTGAGTTCCTGGGGTGG - Intergenic
940173432 2:150852720-150852742 AGGGAAATGAGTTCCTTCAAGGG - Intergenic
940532781 2:154901602-154901624 ATGGCAATGAGTTCTTGATTTGG + Intergenic
942095717 2:172535056-172535078 ATGCAAATGAGTTCCTTCAATGG - Intergenic
943145505 2:184039357-184039379 ATGAAAATAAGTTCTTGCTTGGG + Intergenic
946882390 2:224189566-224189588 ATGGAAATAAGTTTCTGTGTTGG + Intergenic
947252761 2:228126179-228126201 ATGGAAAAGAGCTGCTGGGTAGG - Intronic
947797617 2:232904993-232905015 ATGGGAAAGAGTTCCTGCATAGG - Intronic
948900234 2:240952998-240953020 ATGGGAATGAGGGGCTGCGTGGG - Intronic
1170935831 20:20808408-20808430 ATGGCATTGACTTCCTGCCTTGG - Intergenic
1172899845 20:38326430-38326452 ATGGTAAGCAGTTCCTGGGTTGG + Exonic
1177544545 21:22539396-22539418 ATGGAATTGTGTTCCTGATTAGG - Intergenic
1177933242 21:27311846-27311868 ATGGAATTGAGTTCTTGATTTGG + Intergenic
1182312032 22:29416129-29416151 ATGGGAATGAGCTCCTGGGAGGG - Intronic
1182688227 22:32137114-32137136 ATGGGAATGAGCTCCTGGGAGGG + Intergenic
949128088 3:470531-470553 ATGGAAATGAGTTACTTATTGGG + Intergenic
952876197 3:37946555-37946577 ATGGAAATGACTAACTTCGTGGG - Intronic
955133548 3:56193661-56193683 ATGAAAATGAGCTCATGCATTGG - Intronic
959368606 3:105494489-105494511 AGGTGAATGAGTTCCTGCTTAGG - Intronic
960644852 3:119868226-119868248 AAGAAAATGAGTTGCTGCATAGG - Intronic
964793865 3:160477395-160477417 GTTAAAATGAGTTCCTGCTTTGG + Intronic
965263022 3:166506898-166506920 ATGGAATTGTGTTCTTGCTTTGG + Intergenic
965853918 3:173065508-173065530 ATGAAAGTGATTTCCTGTGTGGG - Intronic
967122338 3:186393589-186393611 ATGGAAATGTGTTCTTGATTTGG - Intergenic
973570320 4:52232461-52232483 ATGAAAATGAAATCCTGAGTTGG + Intergenic
974850771 4:67402974-67402996 CAGGAAATGGGTTCCTGGGTAGG + Intergenic
976440714 4:85070832-85070854 ATGGAAGTGAGTTCTTGTTTTGG + Intergenic
976904642 4:90222088-90222110 ATGGAAATGATTTCTGGGGTGGG + Intronic
978722179 4:111923446-111923468 ATGGAATTCAGCTCCTGCTTAGG - Intergenic
979833356 4:125329122-125329144 ATGGAAATATATTCCTGCCTTGG - Intronic
980707695 4:136520757-136520779 ATGGAGATGAGTACCTTCTTGGG - Intergenic
980749233 4:137067400-137067422 ATGGGACTGAGTTCCTGATTTGG + Intergenic
981878442 4:149577992-149578014 ATGGAATTGTGTTCCTGATTAGG + Intergenic
981926414 4:150145134-150145156 ATGGAATTGAGTTCTTGATTTGG + Intronic
982510211 4:156273343-156273365 ATGGGAATGAGTTCTTGATTTGG + Intergenic
983469484 4:168138862-168138884 ATGGAATTGAGTTCTTGATTTGG + Intronic
983533800 4:168836318-168836340 ATGGAAAAGATTTCCTGCTGCGG + Intronic
989188693 5:38648970-38648992 ATGGAAATGAATTACAGCCTTGG - Intergenic
990703073 5:58496714-58496736 ATGGCAATAAATTCCTGCGGGGG - Exonic
993833763 5:92790883-92790905 ATGGGATTGAGTTCCTGATTTGG + Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995961060 5:117840447-117840469 ATGGAATTGTGTTCCTGATTTGG - Intergenic
996195015 5:120594328-120594350 ATGGAATTGTGTTCCTGATTTGG - Intronic
996604801 5:125308653-125308675 ATGTAATTGAGTTCCTGATTTGG + Intergenic
997794884 5:136798840-136798862 ATGGAATTGAGTTCTTGATTTGG - Intergenic
1003054640 6:2807040-2807062 AAGGAAGTGAGTTTCTGCATTGG - Intergenic
1004058384 6:12164240-12164262 ATGGAAGTGAGTTCAGGCTTGGG - Exonic
1004942803 6:20578913-20578935 ATGGAAGAGAGTTACTGGGTGGG + Intronic
1006392244 6:33765369-33765391 GTGCACATGAGTCCCTGCGTGGG + Intergenic
1011063410 6:83297178-83297200 ATGGGATTGAGTTCCTGATTTGG - Intronic
1013142063 6:107347134-107347156 ATGGAAATGAGGACCTGCATGGG + Intronic
1013729062 6:113141422-113141444 ATGGAAGTGTGTTCCTGAGTAGG + Intergenic
1016498749 6:144693659-144693681 ATGGGATTGTGTTCCTGCTTTGG + Intronic
1017060222 6:150476628-150476650 ATGGAATTGAGTTCTTGATTTGG + Intergenic
1018046938 6:159973731-159973753 CAGGAAATGAATGCCTGCGTTGG + Intronic
1020024282 7:4887728-4887750 AGGGAGATGAGTTTCTGCGCTGG - Intergenic
1023301674 7:38779470-38779492 ATGGAGATGAATTGCTGAGTGGG - Intronic
1024540012 7:50468479-50468501 ATGTATATGAATTCCTGGGTAGG - Intronic
1028532786 7:91856698-91856720 ATGGGATTGAGTTCCTGATTTGG - Intronic
1029312393 7:99679309-99679331 ATGTAAATGATATCCTGGGTTGG + Intronic
1030430152 7:109435233-109435255 ATGGAATTGAGTTCCTGGTGTGG - Intergenic
1031421174 7:121553168-121553190 ATGGAGATGAGTTCCTTGGCGGG - Intergenic
1031791210 7:126107285-126107307 ATGGAAATGAGTTCTTGATTTGG - Intergenic
1032757734 7:134907124-134907146 ATGGACCTGAGTTCCTGAGTTGG + Intronic
1034708178 7:153165848-153165870 ATGGGATTGAGTTCCTGATTTGG + Intergenic
1035273634 7:157734323-157734345 ATGGAAAAGAGTAACTGCGCTGG - Intronic
1036620894 8:10424152-10424174 ATGGATAGGAGTTCCTGCGATGG + Intronic
1039293652 8:36126212-36126234 CTGGATATGAGATCCTGGGTTGG + Intergenic
1039859194 8:41441783-41441805 ATGGAAATGGGATCCAGCTTTGG + Intergenic
1041940725 8:63384467-63384489 ATGAAAATGAGTAGCTGAGTTGG + Intergenic
1042727022 8:71889562-71889584 ATGGGAATGTGTTCCTGATTTGG + Intronic
1046333029 8:112747004-112747026 ATGTAAATGAATGCCTGCGATGG - Intronic
1051050643 9:12928328-12928350 ATGGTAATTAGTTCCTTCCTGGG - Intergenic
1062294830 9:135818895-135818917 ATGGCAATGAGTGCCTGTGACGG - Intronic
1185854646 X:3522952-3522974 TTGAGAATGAGTTCCTGGGTTGG - Intergenic
1186622462 X:11256030-11256052 ATTGCAATGAGTCCCTGCGTGGG - Intronic
1187455353 X:19436620-19436642 ATGCAAATGAGTTGCTGAGAGGG - Intronic
1187487195 X:19715833-19715855 CTGGAAATGTGTTCCTGGGTTGG + Intronic
1189190747 X:39101527-39101549 ATGGAAATTCGTTCCTGATTTGG + Intergenic
1189573990 X:42330352-42330374 ATGGCACTGAGTTCCTGCCTGGG - Intergenic
1190437977 X:50446050-50446072 ATGGAATTGCGTTCCTGATTTGG + Intronic
1190911443 X:54775494-54775516 AAGGAAAGGAGGTCCTGCCTTGG + Intronic
1192109210 X:68347185-68347207 AAGGAAATGAGGTCCTGAGAGGG - Intronic
1196229631 X:113206517-113206539 ATGGAAAAGAGTTGGTGGGTAGG + Intergenic
1196238487 X:113311009-113311031 ATGGAATTGTGTTCCTGACTTGG - Intergenic
1197142735 X:123134310-123134332 ATGGAATTGTATTCCTGAGTTGG - Intergenic
1197279209 X:124515566-124515588 ATGGAAGTGTGTTCCTGATTTGG - Intronic
1197484767 X:127034986-127035008 ATGGAATTGAGTTCCTTATTTGG - Intergenic
1197595643 X:128460705-128460727 ATGGAAATGAGTGCTGGTGTGGG + Intergenic
1197759040 X:130015008-130015030 ATGGAGATGGGCTCCTGCTTGGG - Exonic
1199515834 X:148674676-148674698 ATGCAAATGGTTTCCTGCGCTGG - Intronic