ID: 917926889

View in Genome Browser
Species Human (GRCh38)
Location 1:179796865-179796887
Sequence AAACTGTTCTCTAGGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917926886_917926889 -5 Left 917926886 1:179796847-179796869 CCTCTTGCTAACATTCCTAAACT 0: 1
1: 0
2: 3
3: 12
4: 145
Right 917926889 1:179796865-179796887 AAACTGTTCTCTAGGACAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 160
917926885_917926889 -4 Left 917926885 1:179796846-179796868 CCCTCTTGCTAACATTCCTAAAC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 917926889 1:179796865-179796887 AAACTGTTCTCTAGGACAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917926889 Original CRISPR AAACTGTTCTCTAGGACAGC AGG Intronic
904904071 1:33881349-33881371 AAACTGTTCTGTAGGAGAAAGGG + Intronic
910251593 1:85203064-85203086 AAACTCTGCTCTAGGCCAGGCGG + Intergenic
910370014 1:86505508-86505530 AAACTGTTGTTTAAGACTGCAGG - Intergenic
914198926 1:145467255-145467277 AAACTGGTCTCTCACACAGCTGG - Intergenic
914478038 1:148040391-148040413 AAACTGGTCTCTCACACAGCTGG - Intergenic
915531343 1:156503955-156503977 TAACTTTTCTCTAGGAAAGATGG - Intergenic
916168826 1:161985683-161985705 GGACAGCTCTCTAGGACAGCAGG - Intronic
917926889 1:179796865-179796887 AAACTGTTCTCTAGGACAGCAGG + Intronic
918947397 1:191085255-191085277 AAACTGTACTCTAGACCAGATGG + Intergenic
919454625 1:197806561-197806583 AAAGTGTTATCTTGGAGAGCAGG - Intergenic
921277120 1:213531608-213531630 CAGCAGTTCTCCAGGACAGCTGG + Intergenic
922860482 1:228811851-228811873 AACCTCTTCTCCAGGGCAGCTGG + Intergenic
1064342012 10:14495574-14495596 AAACTATTCTTGAGTACAGCAGG - Intergenic
1069298515 10:66877352-66877374 AAACTGTTCTTTTGCACAGCAGG + Intronic
1069878907 10:71579681-71579703 AAACTGTTCTGCAGGAAGGCAGG + Intronic
1070889036 10:79928438-79928460 AAGCTGTGTTCTAGGACACCGGG + Intergenic
1073867810 10:107825150-107825172 AAACTATTCTGTATGACAGTGGG + Intergenic
1075062671 10:119267682-119267704 AAACTGTCCTCCAGGAAAGGCGG + Intronic
1075256972 10:120933031-120933053 AAACTGTTCTCTAGCAGTTCTGG - Intergenic
1083146128 11:60760276-60760298 AAACTGTTGTTTAAGACTGCAGG - Intronic
1083713948 11:64565147-64565169 ACACTGTTCTCTGGCACAGGGGG + Intronic
1086817656 11:91393211-91393233 AAACTGTTCCCTTGTACAGTGGG - Intergenic
1088718044 11:112566132-112566154 AAACTGATCTCTGGGATATCTGG + Intergenic
1092066100 12:5590762-5590784 AAACTATTTTCTAGAACAGTAGG + Intronic
1093323376 12:17741878-17741900 AAAGTCTCCTCTAGGACAGACGG + Intergenic
1093575715 12:20727275-20727297 AAACTGTTCTCCAAAATAGCTGG + Intronic
1094301484 12:28969523-28969545 CATCTGTTCTCCAGGACATCAGG + Intergenic
1095200375 12:39377497-39377519 AAACTCTTTTCTAGAACAGAAGG - Intronic
1098433508 12:70445775-70445797 AAACTGTTGTGTAAGACTGCGGG + Intergenic
1098770011 12:74539989-74540011 AAACTGTTCAATGTGACAGCTGG - Exonic
1102977692 12:117218340-117218362 AAACTGTTCTCTGGGACGTGGGG + Intronic
1104899064 12:132178462-132178484 GAAGTGTTCTCAGGGACAGCTGG - Intergenic
1109628432 13:65010607-65010629 AAACTGATCTTCAGGATAGCTGG + Intergenic
1112925601 13:104670833-104670855 AAAATGTCCTCAAGGACTGCAGG + Intergenic
1115036234 14:28860192-28860214 AAACTTTTCTCTAGAACCTCTGG + Intergenic
1115637358 14:35303419-35303441 AAACTGTTCTCTAGTTCTTCAGG + Intronic
1116222910 14:42111642-42111664 AGACTGTTATATAGGCCAGCAGG + Intergenic
1118786620 14:69051104-69051126 TAATGATTCTCTAGGACAGCAGG - Exonic
1119559687 14:75580031-75580053 ATACTGCACTCTAGGAAAGCTGG - Intronic
1120213304 14:81655678-81655700 AAGCTCTTCTCTAGGAGGGCTGG + Intergenic
1120372404 14:83652940-83652962 ACAATGTTCTCTAGGAAGGCAGG + Intergenic
1124504992 15:30264877-30264899 ATACTGGCCTCTAGGACTGCCGG + Intergenic
1124738560 15:32273758-32273780 ATACTGGCCTCTAGGACTGCCGG - Intergenic
1125220540 15:37328055-37328077 AAACTGTTCTCCAGGAGGGTTGG - Intergenic
1126195252 15:45923738-45923760 AGCCTGTTCTCTGGGACATCAGG + Intergenic
1128583617 15:68827613-68827635 AATCTTTTCTCTCTGACAGCTGG - Intronic
1128855051 15:71003439-71003461 AATCTGTACTCTAAGAAAGCTGG - Intronic
1131731852 15:95290156-95290178 AAACTGCTGTATAGGCCAGCTGG - Intergenic
1132774684 16:1586486-1586508 CAACTGGCCTCTAGGAAAGCTGG - Intronic
1139266836 16:65647893-65647915 AAACTTTTCTGTATGACACCTGG + Intergenic
1140050563 16:71477592-71477614 AAACAGTACTCTAACACAGCTGG - Intronic
1140127574 16:72131041-72131063 ACAGTGTTCTCTAGGACGGTGGG - Intronic
1143285917 17:5789239-5789261 AAACTGCCCTCTAAGACACCTGG + Intronic
1143346559 17:6253813-6253835 ACAATGCTCTCTAGGACAGATGG + Intergenic
1143879831 17:10021605-10021627 AGACTGTCTTCTAAGACAGCAGG + Intronic
1151609403 17:75162094-75162116 AAATTCTTCTCTAGGAGAACAGG - Intronic
1155620328 18:27770842-27770864 AAACTCTCCTCTATGGCAGCAGG - Intergenic
1156030342 18:32705837-32705859 ACACTGTCCTTTTGGACAGCGGG + Intronic
1156665710 18:39403639-39403661 AAACTGTGATCTAGATCAGCAGG + Intergenic
1157183310 18:45517078-45517100 GAACTGTGCTCCAGGAGAGCAGG - Intronic
1158746425 18:60204932-60204954 AATGTGGTCACTAGGACAGCTGG + Intergenic
1160590500 18:79941938-79941960 AAACCGTTCTCTCGGCCAGCCGG + Intronic
1161175146 19:2837694-2837716 CAAATGTTCTCTTGGAAAGCTGG + Intergenic
1162082444 19:8226372-8226394 AGACTGTTCTGTGGGAGAGCAGG - Intronic
1162279263 19:9681850-9681872 AAAAGGTTCTGCAGGACAGCAGG + Intergenic
1163538562 19:17892936-17892958 AAACACTTCTCTAGGGCAGCTGG - Intronic
1164140819 19:22461057-22461079 ATTCTGTTCTCTATGACAGTGGG - Intronic
1164439010 19:28257481-28257503 AAAATGCTCTCTGTGACAGCAGG - Intergenic
926124893 2:10265882-10265904 AAACTGTTGACAAAGACAGCAGG - Intergenic
929307617 2:40381623-40381645 CATCTGTTCTATAGGACAGCTGG - Intronic
930944328 2:57053626-57053648 AAATTTATCTCTAAGACAGCAGG - Intergenic
935590234 2:104841611-104841633 GAACCTTTCTCTAGGACAACAGG + Intergenic
936267962 2:111024650-111024672 AAACTGTTCTCAAGGTCACATGG + Intronic
936837939 2:116730697-116730719 ACACTGGTCTTTAGAACAGCAGG + Intergenic
937254764 2:120547418-120547440 GAATTGTTCTCTGGGGCAGCTGG + Intergenic
939282785 2:140086490-140086512 AAACTTTTCTGTAGGAGATCTGG - Intergenic
943531979 2:189093785-189093807 CAATTGTTCTCTAGGACTCCTGG + Intronic
943728893 2:191281066-191281088 ATACTGTTCTCTAGTGCAGATGG + Intronic
1169243816 20:4009073-4009095 ACTCTGTCCCCTAGGACAGCAGG - Intronic
1169650069 20:7857203-7857225 AAACTGTTCTCTAGACAAACGGG + Intergenic
1170368255 20:15620090-15620112 AAGCAGTTCTCCAGGACAGAAGG + Intronic
1173827114 20:46055163-46055185 AAACTGATCTCCCAGACAGCAGG + Intronic
1180975510 22:19845718-19845740 AGCCTGCTCTCCAGGACAGCAGG - Intronic
1181629510 22:24143237-24143259 ACACTCCTGTCTAGGACAGCTGG - Intronic
1181918830 22:26303153-26303175 AATCTCTCCTCTAGGACAGAAGG + Intronic
1182208452 22:28652750-28652772 AACCTGTTCTGTAAGCCAGCAGG + Intronic
1182964673 22:34509896-34509918 AAAATGTACTATAGGACAGTTGG + Intergenic
951749742 3:26021230-26021252 ATAGTGTTCTATAGCACAGCAGG - Intergenic
952627667 3:35426491-35426513 AAACTGCTTTCTAGCTCAGCAGG - Intergenic
953905024 3:46864395-46864417 AAACTGGTCCCTGGGCCAGCAGG - Intronic
954044231 3:47915802-47915824 AAAGAGTTGTCTAGGAGAGCAGG + Intronic
957141069 3:76358266-76358288 AAACAAGTCTCAAGGACAGCTGG - Intronic
957765166 3:84614893-84614915 AAACTGTTTCCAAGCACAGCTGG - Intergenic
959151065 3:102608713-102608735 AAACTGTTCCCTAACACACCTGG - Intergenic
959245140 3:103856786-103856808 AAACTGTTATCTGGTAGAGCTGG - Intergenic
960739338 3:120815828-120815850 GAACTGATGTCCAGGACAGCTGG + Intergenic
961227435 3:125264377-125264399 AAACTGTATAATAGGACAGCCGG + Intronic
961536238 3:127572772-127572794 ACACTGTTGTCTTGGGCAGCCGG - Intergenic
962349694 3:134647692-134647714 AAACAGTTTTCAAGGGCAGCAGG + Intronic
962933448 3:140058644-140058666 AAACTGTTCACCAGGAGAGTAGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
965150573 3:164969106-164969128 AAACTATTCTCTCAGACACCTGG - Intergenic
966953198 3:184844094-184844116 AAAATATTCTCTAGGACCGAGGG - Intronic
967026887 3:185572506-185572528 AAACTGTTGTTTAAGACTGCGGG - Intergenic
967825239 3:193872309-193872331 TAGCTTTTCTCCAGGACAGCAGG - Intergenic
968769924 4:2498477-2498499 AAACAGTGCTCTAGGCCAGGCGG - Intronic
972206658 4:36781634-36781656 ACACTGATCTTCAGGACAGCTGG - Intergenic
972344505 4:38181772-38181794 AAAGTTTTCTCTAGTACAGAAGG + Intergenic
973644963 4:52941005-52941027 AAACTGCTATCTAGGACCGGGGG - Intronic
974897205 4:67953824-67953846 AAACTGTTCTGTGGAACAGAAGG - Intronic
975695212 4:77006126-77006148 AAACTGTTCTGTAGGGTGGCTGG - Intronic
976597457 4:86907339-86907361 AAAATGTTCTCTTGGAGAGGAGG + Intronic
977514768 4:98007217-98007239 AGACTGACCTCTAGGACAGTAGG - Intronic
977762981 4:100761509-100761531 AAACTGTACCCTAGGACAAATGG + Intronic
983286898 4:165751472-165751494 GAACTGTTATCTAGGAGAGTAGG - Intergenic
984938180 4:184908094-184908116 AAACAGTTCTCTTGGAGAGGTGG - Intergenic
985930376 5:3052350-3052372 AGCTTGTTCTCCAGGACAGCTGG - Intergenic
986370428 5:7074545-7074567 AGACTGTCCTCTGTGACAGCTGG - Intergenic
987248385 5:16073875-16073897 AAACTGTACCCTAGAACAGATGG + Intronic
989120869 5:38003252-38003274 ATACTGATCTCAAGGACAGATGG - Intergenic
990003103 5:50918028-50918050 AAACAGTTCTCTACAACAACTGG - Intergenic
995848305 5:116518148-116518170 CAACTGTTATCTTGGACAACAGG + Intronic
996284481 5:121772029-121772051 AGACTTTTCTCTAAGAAAGCTGG - Intergenic
996399624 5:123047219-123047241 ACACTGTTCTCTTGGACATTAGG - Intergenic
996433981 5:123414085-123414107 AAACTGTTCTCAAGGACAAGGGG + Intronic
998010403 5:138690505-138690527 CTAGTGTTCTCTAGGACTGCAGG - Intronic
998450113 5:142227742-142227764 AGAGTGTTCAATAGGACAGCAGG + Intergenic
999344851 5:150808049-150808071 AAACTGTTCTGTATCACAGAAGG - Intergenic
999454429 5:151703064-151703086 CAACTGCTCTCTAGGCCAGAGGG + Intergenic
1004126465 6:12878834-12878856 AAACTGTTGTCTAAAACAGGAGG + Intronic
1009624618 6:66124034-66124056 AAACTGTACTCCAGGACAAATGG - Intergenic
1009800034 6:68525646-68525668 AAACTGTACCCTAGGACAAATGG - Intergenic
1011786691 6:90854418-90854440 AAACTGTGGTCCAGGAGAGCAGG + Intergenic
1011944890 6:92888634-92888656 AAAAGGTAGTCTAGGACAGCTGG - Intergenic
1012176097 6:96086897-96086919 AACCTATTCTCTGTGACAGCAGG - Intronic
1012270340 6:97202202-97202224 AAACTGTTATTTAGGATAGGTGG - Intronic
1013191742 6:107809607-107809629 AAACTGTTATCTTGGATAGCTGG + Intronic
1013862783 6:114656587-114656609 AAACTGTTTTCTAGGAATGATGG + Intergenic
1017701525 6:157077588-157077610 AAAGGATACTCTAGGACAGCTGG - Intronic
1018377461 6:163226750-163226772 AACCTGTTCTCTAGGAGGGTTGG + Intronic
1023674103 7:42612492-42612514 AAAATGGATTCTAGGACAGCAGG - Intergenic
1027581239 7:79998385-79998407 GAAATGGTTTCTAGGACAGCTGG + Intergenic
1034180325 7:149132484-149132506 AAGCTGTTCTCTAGGCCGGGCGG - Intronic
1034331795 7:150289231-150289253 AAGCTGTTCTCAGTGACAGCTGG + Intronic
1037379092 8:18265065-18265087 AAATTGTTGTCTTGGGCAGCTGG - Intergenic
1037569859 8:20149041-20149063 AAACTGTGCTCAAGACCAGCTGG - Intronic
1039329067 8:36516373-36516395 AAGCTGTCCACTAGGACAGGAGG + Intergenic
1039757321 8:40537602-40537624 AAACTGTTCTGAAGCACATCAGG - Intronic
1040117825 8:43644936-43644958 AAACTGTTCTTTTGATCAGCAGG + Intergenic
1040118962 8:43659373-43659395 AAACTGTTCTTTTGATCAGCAGG + Intergenic
1044228574 8:89748062-89748084 AAACTATACTCTAGAACAACCGG + Intergenic
1048711543 8:137217578-137217600 TAACTGCTGTCTAGGAAAGCAGG - Intergenic
1048876234 8:138838726-138838748 AAAATGTTCCCGAGGAAAGCAGG + Intronic
1050667749 9:7960421-7960443 AAACTACTGTCTAGGACATCAGG - Intergenic
1051202009 9:14636532-14636554 AAACTGCTCTCTAGACCAACTGG + Intronic
1052774766 9:32722402-32722424 AAACAGTTTTCTAGGGCAGGTGG - Intergenic
1060009005 9:120026966-120026988 ATACTGTTCACTGGGAGAGCTGG + Intergenic
1187477644 X:19626179-19626201 CAACTGTTGTCTGGGACAGGAGG + Intronic
1191223078 X:58012083-58012105 AAACTGTACTCCAGGACAAATGG - Intergenic
1192904090 X:75531634-75531656 AAACTGTACTCTAGAACAAATGG - Intergenic
1194335519 X:92641459-92641481 AATCTGTACTCTAGAACAACTGG - Intergenic
1196404747 X:115349431-115349453 AAACTGGCCCCTAAGACAGCTGG + Intergenic
1198428925 X:136546490-136546512 AAACTGTGCTCTGGGGCACCTGG + Intronic
1200254353 X:154571957-154571979 AAAATGTTGTCTAAGACACCTGG + Intergenic
1200263416 X:154632451-154632473 AAAATGTTGTCTAAGACACCTGG - Intergenic
1200643948 Y:5758217-5758239 AACCTGTACTCTAGAACAACTGG - Intergenic
1200646167 Y:5785417-5785439 AAACTATACTCTAGGACAAGTGG + Intergenic