ID: 917927881

View in Genome Browser
Species Human (GRCh38)
Location 1:179804019-179804041
Sequence TGACAAGACAAGAGTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917927881_917927885 0 Left 917927881 1:179804019-179804041 CCAGAGCCACTCTTGTCTTGTCA 0: 1
1: 0
2: 2
3: 6
4: 143
Right 917927885 1:179804042-179804064 TGGGCACCAGATGATGCCACAGG 0: 1
1: 0
2: 1
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917927881 Original CRISPR TGACAAGACAAGAGTGGCTC TGG (reversed) Intronic
902112212 1:14091201-14091223 TGAGAAGGCCAGAGTGGCTGAGG - Intergenic
902330045 1:15726837-15726859 TCAGAGGACAACAGTGGCTCAGG - Intronic
906101911 1:43269381-43269403 TGGAAAGACAAGTTTGGCTCAGG - Intronic
906499881 1:46333895-46333917 TAACAGGACAAGAGCGGCTCTGG + Intergenic
908119038 1:60968246-60968268 TGAAAAGGCAAGATAGGCTCTGG + Intronic
910624450 1:89291760-89291782 TGACCACATAAGAGTGGCTTTGG - Intergenic
912309343 1:108604143-108604165 TGACAAGACCAGCCTGGCTGTGG + Intronic
914346838 1:146807148-146807170 TGATACGACAAGAGGGGCTGGGG - Intergenic
915170625 1:153974747-153974769 TGACAAGACAAGCGAAGATCAGG + Exonic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917927881 1:179804019-179804041 TGACAAGACAAGAGTGGCTCTGG - Intronic
918031111 1:180812619-180812641 TGCTTAGACAAGAGTGGCACTGG - Intronic
918249534 1:182689527-182689549 TGGCAAGAGAAGAGAGCCTCTGG + Intergenic
919926601 1:202194741-202194763 TGAGGAGACAAGAGTGGATAAGG - Intronic
921439350 1:215166227-215166249 TGACACAACAGGAGTGGATCTGG + Intronic
921449104 1:215282226-215282248 TGACAAGAGAAGAGTGGAGAAGG + Intergenic
922013076 1:221612286-221612308 TGACAAGATAAGAGAGGGACTGG + Intergenic
923273572 1:232378522-232378544 TGACAAGACAGCAGAGGCTGTGG - Intergenic
1064913640 10:20431871-20431893 TGGCAAGAAAAGTGTGGCTCCGG + Intergenic
1067143202 10:43673411-43673433 TGAGAAGAGAAGAGTGTCTGCGG - Intergenic
1067973732 10:51000340-51000362 TGAAAAGACAAGACTGTCTGTGG - Intronic
1069594642 10:69662882-69662904 TGGCAAGGCAAGAGTTGGTCTGG - Intergenic
1072755785 10:98019853-98019875 GGACAAGACAGGTGGGGCTCAGG - Intronic
1073452592 10:103618562-103618584 AGAGAGGACAACAGTGGCTCAGG - Intronic
1074359093 10:112811009-112811031 GGCCAAGCCAAGAGAGGCTCTGG - Intronic
1076209826 10:128631438-128631460 TGACAAGAGTAGAGCAGCTCTGG + Intergenic
1076454618 10:130581299-130581321 TGACAGGACAGGAGTAGCACAGG - Intergenic
1077882253 11:6360348-6360370 TGAAAAGACAAATTTGGCTCTGG - Intergenic
1080241273 11:30129605-30129627 TTAAAAGAAAAGAGTGGCTAAGG + Intergenic
1082627469 11:55502268-55502290 TTACAAGGCATTAGTGGCTCAGG + Intergenic
1082640602 11:55655339-55655361 TCAGAAGAAAAGAGTGGTTCAGG - Intergenic
1083712222 11:64556405-64556427 TGACGGGACTCGAGTGGCTCTGG - Intronic
1083952234 11:65963115-65963137 TGACATGAGAAGAGGGGGTCAGG + Intronic
1085291159 11:75400616-75400638 TAATAAGACTAGACTGGCTCAGG + Intronic
1089048401 11:115524329-115524351 TGACAAAACAAGAGTGAGTTAGG - Intergenic
1089101457 11:115966035-115966057 TGACATGACAGGAGTGGCCCTGG + Intergenic
1089757232 11:120695875-120695897 GGACAAGACCAGAGTGGGCCTGG + Intronic
1097080869 12:56429893-56429915 TGGCATGACAAAAGAGGCTCTGG - Intronic
1101935466 12:109053020-109053042 TGACAAGACTGGAGTGCCCCGGG - Intronic
1103360986 12:120353446-120353468 TGAGGGGACATGAGTGGCTCAGG - Intronic
1103415396 12:120739272-120739294 TGAGATGAGAACAGTGGCTCAGG - Intronic
1104630598 12:130398316-130398338 TCACATGGCAAGAGTTGCTCTGG - Exonic
1108860736 13:54855440-54855462 GCACAGGACAAGAGTGGGTCTGG - Intergenic
1109364831 13:61340743-61340765 TGACAAGACTAGATTTACTCTGG + Intergenic
1109757775 13:66784125-66784147 AGGGAAGACAAGAGAGGCTCTGG - Intronic
1110779045 13:79443111-79443133 TTACAAAACAGGAGTGGTTCTGG - Intergenic
1112184123 13:97112008-97112030 TGACAAGACAAGTGCTGCTTTGG - Intergenic
1113256068 13:108507066-108507088 TGACAAGAGAAGAATGGTTAGGG - Intergenic
1115236498 14:31213190-31213212 TAACAAGTCAGGAATGGCTCAGG + Intergenic
1115413320 14:33101436-33101458 TGACTAGAAAAGGGTGGCACAGG + Intronic
1116456422 14:45125353-45125375 TGACAAAACATGAATGGCTTTGG + Intronic
1117726657 14:58681451-58681473 TGAGAAGTCAAGAGTGGTGCTGG + Intergenic
1125433095 15:39617280-39617302 TGAGAACATAGGAGTGGCTCAGG + Intronic
1132758262 16:1496385-1496407 GGAAAAGACAGGAGGGGCTCAGG - Intronic
1134095772 16:11417513-11417535 TGTCAAGTCCAGTGTGGCTCTGG - Intronic
1137460338 16:48655609-48655631 AGAGGAGACAAGAGAGGCTCAGG + Intergenic
1139987142 16:70908122-70908144 TGATATGACAAGAGGGGCTGGGG + Intronic
1141543587 16:84746634-84746656 TTGCAAGACTGGAGTGGCTCTGG + Intronic
1147291230 17:39445103-39445125 TGACAGGAGAAGAGGTGCTCTGG + Intronic
1149020956 17:51963582-51963604 TGACAAGTCAGGAGAGGCTGGGG + Intronic
1149116471 17:53103140-53103162 TCTGAAGCCAAGAGTGGCTCAGG - Intergenic
1203167372 17_GL000205v2_random:110193-110215 TGACAAGAGAGGCCTGGCTCTGG + Intergenic
1153265370 18:3263582-3263604 TGTCCAGACAAGAGTTGCTAGGG + Intronic
1167772221 19:51528456-51528478 GGCCCAGACAAGAGTGGCTGGGG - Intronic
1168495707 19:56847761-56847783 TGACAATACAAGATTGTCTCTGG - Intergenic
925172310 2:1757746-1757768 TGCCAAGTCAACAGTGACTCTGG - Intergenic
926670646 2:15574271-15574293 TGAAAAGAAGAGATTGGCTCAGG - Intergenic
929168943 2:38911930-38911952 AGACAAGAACAGAGAGGCTCTGG + Intronic
932071580 2:68626095-68626117 TGACAAGACCACAGTGGCAGAGG + Intronic
934628263 2:95883912-95883934 TGTCAAGACACAAGGGGCTCAGG - Intronic
934832218 2:97539771-97539793 TGTCAAGACATAAGGGGCTCAGG - Intronic
936952930 2:117996376-117996398 TGAAAAGACAAGAGTTGCTAAGG + Intronic
937093575 2:119222521-119222543 TTGCAAGAGAAGAGAGGCTCTGG + Intergenic
937516913 2:122665629-122665651 TGCCAAGAGAAGGCTGGCTCTGG + Intergenic
937900630 2:127016477-127016499 TGCCAAGACACCTGTGGCTCCGG - Intergenic
941175445 2:162192531-162192553 GGACAAAACAAGAGTGGATAGGG - Intronic
942737058 2:179126487-179126509 TGAGAAGAAAAGAGAGCCTCTGG - Intronic
943730862 2:191302045-191302067 GGAAAAGACATGAATGGCTCTGG - Intronic
944782300 2:203032239-203032261 TCAGAATTCAAGAGTGGCTCAGG - Intronic
946311095 2:218883109-218883131 TGACAATCCCAGAGTGGCTTGGG + Intronic
948483062 2:238262407-238262429 AGACAAGTCAAGAGTCACTCAGG + Intronic
1171355034 20:24537387-24537409 TGAGAAAACAAGACTGGCTGTGG - Intronic
1173686917 20:44930428-44930450 AGACAAGACAAGAGCTGCTGGGG - Intronic
1176404387 21:6348942-6348964 TGACAAGAGAGGCCTGGCTCTGG - Intergenic
1176432770 21:6640162-6640184 TGACAAGAGAGGCCTGGCTCTGG + Intergenic
1179306442 21:40157712-40157734 TGACAAGGCGAGACTGTCTCAGG - Intronic
1181965349 22:26652723-26652745 TGGAGAAACAAGAGTGGCTCTGG - Intergenic
1184376643 22:44117547-44117569 TGACAAGACCAGAATGCCACAGG + Intronic
951635886 3:24776152-24776174 TGAAAAGACAAGCATGGATCAGG - Intergenic
956080722 3:65552790-65552812 TGTCATGTCAAGAGTGGCTGTGG - Intronic
959302622 3:104622283-104622305 ACACAAGAAAAGAGTGGCTCAGG + Intergenic
959962264 3:112311876-112311898 TTAAAAGACAAGAATGGTTCAGG - Intergenic
961653352 3:128428459-128428481 TGCCAAGCCCAGAATGGCTCTGG - Intergenic
963495355 3:146052869-146052891 TGAGGAGACAAGAGAAGCTCGGG - Intergenic
969384009 4:6830861-6830883 TGACAAGACTTGGGTGGCTAGGG + Intronic
972694770 4:41434534-41434556 TGACAAAGCAAGACTGTCTCAGG - Intronic
973261833 4:48173105-48173127 TGACAAAACCAAAGTGGCTGAGG + Intronic
975100622 4:70508741-70508763 AGAAAAGTCAAGAGTGCCTCAGG - Intergenic
978167469 4:105625984-105626006 TGAGAAGAAAAGAGTGCCTGAGG - Intronic
978674791 4:111299616-111299638 TGACAAGACAAAAGGGTATCAGG - Intergenic
980588534 4:134852403-134852425 TGACAAGACAAAAGAGTTTCAGG - Intergenic
983992046 4:174131258-174131280 TAACAAGAAAAGACTGGCTAGGG + Intergenic
984161573 4:176258983-176259005 CAACAAAACAAGACTGGCTCTGG - Intronic
989726637 5:44595282-44595304 TAACAAGAGAAGAGTGGTTAAGG - Intergenic
992230691 5:74660511-74660533 GGACAAAACAAGAGTGTCACAGG + Intronic
992468012 5:77026376-77026398 TGATAAAAACAGAGTGGCTCTGG + Intergenic
994773640 5:104015881-104015903 TGAGAAGACACGACTGGCTGGGG - Intergenic
995366243 5:111364643-111364665 AGGCAAAACAAGAGTGCCTCTGG - Intronic
996015995 5:118534597-118534619 TGAGAAGAAAAGATTGCCTCTGG - Intergenic
997189404 5:131916508-131916530 TGAAAACACAAGAGTGGGTTGGG - Intronic
999811186 5:155128807-155128829 TGACAAGAAACCAGGGGCTCAGG - Intergenic
1000830771 5:166098488-166098510 TGAAAAGCGAAAAGTGGCTCTGG + Intergenic
1001125473 5:169015178-169015200 GGACAAAACAAGAGTGGCTCTGG + Intronic
1002136809 5:177112792-177112814 TGACAAGGCAAAAGTGGGTTTGG + Intergenic
1002168444 5:177362262-177362284 TGTCAGGGCAAGAGAGGCTCAGG + Intronic
1004382897 6:15147935-15147957 TGATAAGACAAGACTGGCCATGG + Intergenic
1008732192 6:54495705-54495727 TGGCCAGGCAAGATTGGCTCAGG - Intergenic
1011934652 6:92760393-92760415 TGGCAGGACAGGAGTTGCTCTGG - Intergenic
1011942415 6:92858458-92858480 AGACAAGAGAAGAGTTGTTCAGG + Intergenic
1013535657 6:111060981-111061003 TGACAACACAAGTGTGGCAAAGG + Intergenic
1014703266 6:124715475-124715497 TGATCAGGGAAGAGTGGCTCAGG - Intronic
1016125412 6:140396330-140396352 TGGGAAGACAAGAGTACCTCGGG + Intergenic
1016375915 6:143420496-143420518 TTACATGACAAAAGTGCCTCTGG + Intergenic
1016377564 6:143438916-143438938 TGAGAAGACATCAGGGGCTCTGG - Intronic
1023941550 7:44771513-44771535 GGGCAAGACATGACTGGCTCAGG + Intergenic
1025973390 7:66349625-66349647 TGACAAGAGAAGAGGGACTGGGG + Intronic
1026217591 7:68363423-68363445 TGAAGAGGCAGGAGTGGCTCAGG + Intergenic
1030211059 7:106996212-106996234 TAAAAAGACAAGAGTGGCTCTGG + Intergenic
1031737781 7:125388442-125388464 TGACCAGACATGAGAGCCTCCGG - Intergenic
1033441256 7:141381386-141381408 TGACAAACCAAGTGTGGCACAGG - Intronic
1036987332 8:13549758-13549780 AAAAAAGACAAAAGTGGCTCAGG + Intergenic
1038608360 8:29034027-29034049 TAACAAGACAAATGTGGTTCTGG + Intronic
1041738167 8:61132971-61132993 TGAAAAGACTAGAGCTGCTCAGG - Intronic
1043049978 8:75374428-75374450 AGACCAGACAAGTGTGTCTCTGG - Intergenic
1043535162 8:81194990-81195012 TGTCAAGAGAAGAGTGGCATGGG + Intergenic
1043808868 8:84709285-84709307 TGACTAGATAATGGTGGCTCTGG + Intronic
1045355560 8:101385802-101385824 TCATAAGATAAGAGTGGCTTGGG + Intergenic
1045366405 8:101480033-101480055 TCACATGACAAGAATGGTTCAGG - Intergenic
1046732238 8:117738198-117738220 TGCCAAGGCAAGTGTTGCTCAGG - Intergenic
1048256295 8:132907439-132907461 TGACAAGGCAAAAGGAGCTCTGG - Intronic
1050373300 9:4945032-4945054 TGTCAAAGCAAGAGTGGTTCTGG - Intergenic
1051506562 9:17833327-17833349 TTACAAGACTGGAGTTGCTCTGG + Intergenic
1051693336 9:19741187-19741209 TGAAAATACAAGAGTGGGTTTGG - Intronic
1051708463 9:19905322-19905344 AGACAAGAGAAAAGTTGCTCTGG - Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1057076800 9:92142181-92142203 TGAGGAGACAAGAGTGGATAAGG - Intergenic
1203438766 Un_GL000195v1:168508-168530 TGACAAGAGAGGCCTGGCTCTGG - Intergenic
1186390505 X:9154115-9154137 TGAAAAGAGAAGAGTCTCTCTGG + Intronic
1194793008 X:98174264-98174286 CGAAAAGACAAGTGTGGCTAAGG - Intergenic
1198243195 X:134804542-134804564 TGACAAGGGAAGAGTGACTAAGG - Intronic
1198686817 X:139236168-139236190 GGAAAAGACAAGAGTAGCGCTGG - Intergenic
1199227272 X:145392623-145392645 TTACAAGCCAAGAGTGACTGGGG - Intergenic