ID: 917928781

View in Genome Browser
Species Human (GRCh38)
Location 1:179809759-179809781
Sequence GCTTATGGACAGAGAGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917928781_917928791 15 Left 917928781 1:179809759-179809781 CCTAGACCTCTCTGTCCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 917928791 1:179809797-179809819 ATATGCAGGGAAGTGGTGAGGGG 0: 1
1: 0
2: 2
3: 23
4: 322
917928781_917928792 24 Left 917928781 1:179809759-179809781 CCTAGACCTCTCTGTCCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 917928792 1:179809806-179809828 GAAGTGGTGAGGGGATGAAGTGG 0: 1
1: 0
2: 2
3: 69
4: 717
917928781_917928788 8 Left 917928781 1:179809759-179809781 CCTAGACCTCTCTGTCCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 917928788 1:179809790-179809812 GCGACGAATATGCAGGGAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
917928781_917928789 13 Left 917928781 1:179809759-179809781 CCTAGACCTCTCTGTCCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 917928789 1:179809795-179809817 GAATATGCAGGGAAGTGGTGAGG 0: 1
1: 0
2: 3
3: 32
4: 286
917928781_917928784 1 Left 917928781 1:179809759-179809781 CCTAGACCTCTCTGTCCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 917928784 1:179809783-179809805 GCCCTCAGCGACGAATATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 23
917928781_917928790 14 Left 917928781 1:179809759-179809781 CCTAGACCTCTCTGTCCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 917928790 1:179809796-179809818 AATATGCAGGGAAGTGGTGAGGG 0: 1
1: 0
2: 1
3: 29
4: 313
917928781_917928786 2 Left 917928781 1:179809759-179809781 CCTAGACCTCTCTGTCCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 917928786 1:179809784-179809806 CCCTCAGCGACGAATATGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917928781 Original CRISPR GCTTATGGACAGAGAGGTCT AGG (reversed) Intronic
900290876 1:1923112-1923134 GCTTCTGGAGAGAGAGGGCCTGG + Exonic
900734967 1:4293830-4293852 GCTTATGAACTGTGAGGTCTTGG + Intergenic
901185456 1:7369868-7369890 CCTTACCCACAGAGAGGTCTGGG - Intronic
901437364 1:9255832-9255854 GCTTCTGGAAGGAGGGGTCTAGG - Intronic
902681074 1:18044109-18044131 GCTGAAGGCCAGAGAGCTCTAGG - Intergenic
903793209 1:25908507-25908529 GCTTGAGGACTGAGAGGGCTGGG + Intergenic
904093731 1:27961924-27961946 GAGTTTGGACAGACAGGTCTGGG - Intronic
904423679 1:30409986-30410008 CCTTATAGTCAGAGAGGTCTGGG + Intergenic
906745118 1:48216026-48216048 GCTTGAGAACAGAGAGGTGTTGG + Intergenic
908919045 1:69168352-69168374 GCTTATGGACAAAGTGGCCATGG + Intergenic
910195671 1:84637332-84637354 GCTTCTGCACAGAGAGTTGTTGG + Intergenic
910482402 1:87672920-87672942 TCTGATGGACACAGAGGTTTAGG - Intergenic
911160546 1:94678883-94678905 AATTAAGGACAGAGAGTTCTGGG + Intergenic
912411482 1:109483568-109483590 GCGTCTGGGCAGAGAGGTTTGGG + Intronic
916053677 1:161052954-161052976 CCTCATGGACAAAGAGGGCTGGG + Intronic
917928781 1:179809759-179809781 GCTTATGGACAGAGAGGTCTAGG - Intronic
918320688 1:183361319-183361341 GCTAAGGGCCAGAGAGGTTTGGG - Intronic
921741289 1:218687911-218687933 GATTTTGGACACAGAGGTCTTGG + Intergenic
922751979 1:228074308-228074330 GGTGAGGGACAGAGAGGGCTGGG + Exonic
1062838327 10:650701-650723 GCTTCTGGCCAGAGTGCTCTGGG + Intronic
1063193483 10:3719017-3719039 GCTTGGGGACAGGGAGGTCCAGG + Intergenic
1065896277 10:30165640-30165662 GCTTCTGGCCAGTGAGGTCATGG + Intergenic
1067338794 10:45384539-45384561 CCATATGGACAGAGAGGCCAAGG - Intronic
1067544749 10:47184782-47184804 GCTGGTGGTCAGAGAGGTGTTGG - Intergenic
1067787286 10:49259858-49259880 GCCTGTGGACAGACAGGCCTAGG - Intergenic
1068250918 10:54438911-54438933 TCTTATGTAAAGAGAGGACTAGG - Intronic
1068610575 10:59056014-59056036 GTTTATGCACAGAGAGGTGGAGG + Intergenic
1078513904 11:12007437-12007459 GCACCTGGACAGAGAGGGCTGGG + Intronic
1079373767 11:19873585-19873607 CCTGATGGCCAGAGAGATCTAGG + Intronic
1080981923 11:37417906-37417928 GCCCATGTACAGACAGGTCTGGG + Intergenic
1081708399 11:45200268-45200290 TCATCTGGACAGAGAGGACTGGG - Intronic
1083283135 11:61639792-61639814 GCTGATGCCCAGAGAGGTTTAGG + Intergenic
1083869694 11:65479124-65479146 ACTGAGGGGCAGAGAGGTCTGGG + Intergenic
1084685845 11:70694776-70694798 GCTTGTGGACAGAGATGAGTAGG - Intronic
1085323840 11:75591770-75591792 GCTTATTGCCTGAAAGGTCTTGG + Intronic
1088549059 11:110991887-110991909 GCTTAGCAACAGAGAGCTCTAGG - Intergenic
1088829210 11:113520940-113520962 ACTTATGGGCAGAGAGGTAGAGG + Intergenic
1093414139 12:18900961-18900983 GCTAGTGCACAGAGAGGTCAAGG - Intergenic
1094326219 12:29242320-29242342 GCTTATTCACTGAGAGGACTGGG - Intronic
1096544883 12:52331201-52331223 GCAGAGGGACAGAGAGGTCTGGG - Intergenic
1097235410 12:57536092-57536114 GCTTATGTACAGAGAGGGTGGGG - Intronic
1098917154 12:76269389-76269411 GTTTATGGATGGAGAGGTCAGGG - Intergenic
1103332587 12:120164502-120164524 GCACAGGGACAGACAGGTCTGGG + Intronic
1106024126 13:25940926-25940948 GCTGATTCACAGAGAGGGCTGGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106894657 13:34286473-34286495 GATTCTGGACAGAGAGCTGTGGG - Intergenic
1106912434 13:34477156-34477178 GCTTAGGATCAGAGAGGTCTAGG + Intergenic
1107642700 13:42460201-42460223 GCTTCTGGAAAGAGAGGTTCTGG - Intergenic
1107647413 13:42509326-42509348 GCTTTTGGAAAGAGAGGTTCTGG + Intergenic
1108360162 13:49661911-49661933 CCTTAGGGACAGAGTGGCCTGGG - Intronic
1108554688 13:51581621-51581643 GCTTATGAAGAGAGAGGTGAAGG - Intergenic
1110472533 13:75876193-75876215 GCTTATGATCAGAGAGGGCTGGG - Intronic
1112512102 13:100019246-100019268 GGATATGGACAGTGAAGTCTAGG + Intergenic
1119613287 14:76081811-76081833 GCTAATGCACATAGAGATCTGGG + Intronic
1120100867 14:80444432-80444454 GCCTATGGATAGAGAGGTAGGGG - Intergenic
1124627788 15:31318926-31318948 GCTTATGGCGACAGAGCTCTAGG - Intergenic
1124823263 15:33068465-33068487 GATTATGATCAGAGAGGCCTGGG + Intronic
1125821365 15:42634922-42634944 GCTTATGGACAGACAGGCTCTGG + Exonic
1127628106 15:60800292-60800314 GATTAGGGCCAGAGAGGTGTTGG - Intronic
1128549440 15:68588782-68588804 GCTGATGGAAAGAAAGGTGTTGG + Intronic
1128838019 15:70827076-70827098 GCTTAGAGACAGAGAGACCTTGG + Intergenic
1130608784 15:85341631-85341653 GGTGATGGAAAGTGAGGTCTTGG + Intergenic
1130991761 15:88879797-88879819 GCTCAAGGGCAGGGAGGTCTGGG + Intronic
1135073823 16:19376056-19376078 GCCTATGGACACAGATCTCTGGG - Intergenic
1137370817 16:47904204-47904226 GCCTAGGGACAGAGAGGCATAGG + Intergenic
1140606860 16:76549310-76549332 GCTTTGGGACAGAGAGGGCATGG - Intronic
1142801127 17:2346583-2346605 GCTTCTGGACAGACAGGTTTAGG - Intronic
1143054614 17:4153577-4153599 TTTTATGGACAGAGAACTCTAGG + Intronic
1145105538 17:20112179-20112201 GTTTAAGGACAAAGATGTCTGGG + Intronic
1147411205 17:40253939-40253961 CATTATTGACAGAGAGGTTTTGG + Intronic
1149973002 17:61237723-61237745 GCTTATGGGCTGAGCAGTCTTGG - Intronic
1155883970 18:31185211-31185233 TCTTCTGGCCAGAGAGATCTGGG + Intergenic
1156446488 18:37241004-37241026 GATTATGGAGAGAGAGCTCAGGG - Intergenic
1158037456 18:53050666-53050688 GCTTTTGGACAGAGACGTTGGGG + Intronic
1159575800 18:70175237-70175259 GCTTAAGAAAAGAAAGGTCTAGG + Intronic
1164981822 19:32619885-32619907 GCCTGTGGACAGACAGGCCTGGG - Intronic
1167353487 19:48990178-48990200 GCTAAGGGACAGACAGGTCCAGG - Intronic
1167693286 19:51000368-51000390 GCTTAAGGAAAGAGGGGGCTGGG - Intronic
924998416 2:384991-385013 GTTTATGAAAAGAGAGGTTTGGG + Intergenic
927483733 2:23474321-23474343 GCTGGTGAACAGAGAGGTCTAGG - Intronic
928897529 2:36282317-36282339 GATTGGGGACAAAGAGGTCTGGG - Intergenic
929303160 2:40329264-40329286 GATTGTGGAGACAGAGGTCTGGG - Intronic
931298678 2:60955824-60955846 GCTTATGGCCAGAGGGGTGGTGG - Intronic
933623444 2:84571317-84571339 GCTTATGGACAGAGAATTTGAGG - Intronic
936292308 2:111235682-111235704 TCTCTTGGACAAAGAGGTCTGGG - Intergenic
937585897 2:123549298-123549320 ACTGTTGGACAGAGTGGTCTGGG - Intergenic
938176416 2:129135270-129135292 GCAACTGGACAGAGAGGTATAGG + Intergenic
938976037 2:136479833-136479855 GCTTGTGGTCAGAGAGGGCGGGG + Intergenic
939190518 2:138912158-138912180 GCTCATGGGCAGAAGGGTCTTGG - Intergenic
939580230 2:143937891-143937913 GCTGATGCACCCAGAGGTCTGGG + Intergenic
940028818 2:149238781-149238803 ATTTATGGAAAGAGAGGTGTTGG + Intergenic
940167703 2:150793198-150793220 GCTCAGGCACAGAGAGATCTGGG - Intergenic
942349957 2:175041897-175041919 GAGTATGGATAGAGAAGTCTAGG + Intergenic
946033900 2:216726505-216726527 GCTTATGGAGAGGAAGTTCTTGG + Intergenic
946427997 2:219609554-219609576 GCGTGTGGGCAGAGAGGTCAAGG - Intronic
947129357 2:226905405-226905427 GCCTATGGTCAGAGAGTGCTTGG + Intronic
947775820 2:232708513-232708535 GCTTTTGAACAGAGAGATGTGGG + Intronic
1170169744 20:13397457-13397479 GCTTATGGTCAGAGAGGAAGTGG + Intronic
1170678636 20:18505004-18505026 CCTCAGGGACAGAGAGATCTGGG + Intergenic
1173113256 20:40216091-40216113 AGTTATGCAAAGAGAGGTCTAGG + Intergenic
1174777264 20:53355861-53355883 ACTTATGCAAAGAGAGGTCTTGG + Intronic
1174834812 20:53846869-53846891 TCTTATGGCAAGAGAGGTCATGG - Intergenic
1175149019 20:56918400-56918422 CCCTATGGGCAGAGTGGTCTGGG - Intergenic
1175392081 20:58633850-58633872 GCTGGTTGACAGAGAGCTCTGGG - Intergenic
1175680762 20:60986870-60986892 GCTTGTGGCCAGAGAGGTGCTGG + Intergenic
1175904899 20:62374948-62374970 GCTCATGCACAGAGAGGTGGGGG + Intergenic
1179457983 21:41512764-41512786 GCTCATGGACAAAGTGGCCTCGG - Intronic
1180276939 22:10651988-10652010 GATAATGGACACAGAGTTCTTGG - Intergenic
952701086 3:36328378-36328400 GCTCATGGACAAAGTGGTCATGG - Intergenic
953205724 3:40827106-40827128 GTTTATGGTCAGAGAGCTCTGGG - Intergenic
954940865 3:54371980-54372002 ACTCATACACAGAGAGGTCTGGG - Intronic
961904325 3:130246827-130246849 CCTTCTGGACTCAGAGGTCTTGG + Intergenic
962251612 3:133839430-133839452 GCTCCTGGACAGGGAGCTCTGGG - Intronic
962890476 3:139667942-139667964 GCTGCTGGACACAGATGTCTGGG + Intronic
964349964 3:155792419-155792441 GCTTGTGGATATTGAGGTCTGGG - Intronic
964903008 3:161682515-161682537 TCTTCTGGACATATAGGTCTAGG + Intergenic
965493214 3:169365704-169365726 GCTTATATTCAGAGAGGTGTGGG + Intronic
968439072 4:612499-612521 GCTTCTGGACTGAGAGGTACCGG + Intergenic
973198003 4:47467504-47467526 GTTTTTGGACAGGGAGGTCATGG + Intergenic
978581502 4:110236131-110236153 GCTTAAGGTCAGAGAGGGCTGGG - Intergenic
984116987 4:175694388-175694410 GATTATGTACAGTGAAGTCTAGG + Intronic
989070542 5:37506479-37506501 GCTTAAGAACAGAGGTGTCTGGG - Intronic
995492162 5:112705022-112705044 GCATATGGACTGATAGGGCTTGG + Intergenic
998011204 5:138696948-138696970 GCCTCTGGAGAGAGGGGTCTGGG + Intronic
998512656 5:142726255-142726277 GCTTAAGGGGAGAGAGGACTGGG - Intergenic
998663539 5:144268270-144268292 GCTTCTGGCCACAGAGGTATAGG + Intronic
999476265 5:151901616-151901638 GCTTTTGGACAGAAAGTTTTGGG + Intronic
999931427 5:156436964-156436986 TCTTATGGACAGAAAAGTCCTGG + Intronic
1000301783 5:159963229-159963251 GCTCATGTATAGAAAGGTCTGGG - Intronic
1005775829 6:29129989-29130011 GCTCCTGGACAGAGAGGGATGGG + Intergenic
1005938391 6:30542458-30542480 GCTTGGGGAAAGAGAGGTCGTGG - Exonic
1006783697 6:36650414-36650436 GCTTCTGGTCAGAGAAGCCTAGG - Intergenic
1009044097 6:58216637-58216659 GCTTATGGACAGCCAGTTGTGGG + Intergenic
1012354437 6:98296070-98296092 GAATGTGGTCAGAGAGGTCTGGG + Intergenic
1012902508 6:105022633-105022655 GTTTTTGCACAGAAAGGTCTGGG + Intronic
1013894754 6:115073229-115073251 GCATTAGAACAGAGAGGTCTTGG - Intergenic
1014787464 6:125634928-125634950 GATTATGGACAAGGGGGTCTGGG - Intergenic
1015657876 6:135540337-135540359 GCTTATGGTCAGGGAGGGTTAGG + Intergenic
1016932035 6:149421073-149421095 GCTTAAGAACAGGGAGGTCAAGG + Intergenic
1018547609 6:164955272-164955294 ACTTCTAGGCAGAGAGGTCTGGG - Intergenic
1019602869 7:1894023-1894045 GCTTATGGAGAGGGCAGTCTAGG - Intronic
1020406641 7:7842893-7842915 CCCTATAGACTGAGAGGTCTGGG - Intronic
1020986991 7:15148287-15148309 GTTTGTGGACATAGAGTTCTAGG + Intergenic
1024529739 7:50381954-50381976 GCTTAGGGACAGACAGGTAATGG + Intronic
1024597070 7:50947243-50947265 GCTCAGGCACAGAGAGGTATAGG - Intergenic
1030515283 7:110530776-110530798 GCTTTTTAACAGAGAGGTGTTGG + Intergenic
1031117222 7:117681505-117681527 GCTGTTGGACTGAGAGGTCATGG + Intronic
1032566462 7:132952085-132952107 GCATATGGGCACAGAGGCCTTGG + Intronic
1033366909 7:140678788-140678810 CCTAATGGAAAGAGAGGGCTGGG + Intronic
1034489373 7:151385273-151385295 CCTTATAGAGGGAGAGGTCTGGG - Exonic
1037756863 8:21715909-21715931 ACTCATGTACAGATAGGTCTTGG - Intronic
1039440607 8:37592713-37592735 ACTTATGGACACATAGATCTGGG + Intergenic
1042469065 8:69162270-69162292 TTTTATGGAAGGAGAGGTCTTGG + Intergenic
1042737822 8:72008651-72008673 GCTAAAAGACAGAGAGGACTTGG - Intronic
1043477099 8:80615768-80615790 GCATATGGACAGGGAGGACCAGG + Intergenic
1047938741 8:129807200-129807222 GCTGATGGACAGTGAAGGCTAGG + Intergenic
1050560894 9:6833541-6833563 GATTATGAACTGTGAGGTCTTGG + Intronic
1051859365 9:21606912-21606934 TCTGATGGAGAGAGAGGTCCTGG - Intergenic
1052347646 9:27426461-27426483 GCTTATGCACACAGAGGTCCAGG + Intronic
1052960313 9:34290348-34290370 GCTTATGGACAGACAGGTGCTGG - Exonic
1053472481 9:38356887-38356909 GATCAGGGACAGAGAGGGCTGGG - Intergenic
1059717154 9:116923905-116923927 GCTTCTGGAGAGACAGATCTAGG - Intronic
1059994658 9:119897058-119897080 CCTTATGGACAGAAGGGACTGGG - Intergenic
1060091116 9:120744466-120744488 TCTTATAGACAGAGTGGTCATGG + Intergenic
1062085521 9:134646090-134646112 GCTGATGTGCAGAGAGGCCTGGG - Intronic
1190786920 X:53660460-53660482 TCTCATGGACAGTGATGTCTTGG - Intronic
1193658775 X:84231187-84231209 GCTTGTGGCCAGAGAGGTGGAGG + Intergenic
1197735430 X:129847301-129847323 CCTTATGGCCAGACAGGCCTCGG + Intergenic
1199514315 X:148658492-148658514 GCATGTGGACTTAGAGGTCTAGG - Intronic