ID: 917929031

View in Genome Browser
Species Human (GRCh38)
Location 1:179811286-179811308
Sequence ACTCAGAGACAAAACTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917929022_917929031 22 Left 917929022 1:179811241-179811263 CCCAGGGGTATGAAGGAAGGCTT 0: 1
1: 0
2: 0
3: 14
4: 184
Right 917929031 1:179811286-179811308 ACTCAGAGACAAAACTGGGAAGG 0: 1
1: 0
2: 0
3: 30
4: 272
917929023_917929031 21 Left 917929023 1:179811242-179811264 CCAGGGGTATGAAGGAAGGCTTA 0: 1
1: 0
2: 1
3: 7
4: 145
Right 917929031 1:179811286-179811308 ACTCAGAGACAAAACTGGGAAGG 0: 1
1: 0
2: 0
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917929031 Original CRISPR ACTCAGAGACAAAACTGGGA AGG Intronic
902705735 1:18202947-18202969 ACCCAAAGCCAAGACTGGGATGG - Intronic
902892042 1:19451571-19451593 ACCCTCAGACAAAACTGAGAGGG + Intronic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
904329805 1:29751201-29751223 ACCCAGAGACAGGACTGGAAAGG + Intergenic
907867193 1:58409862-58409884 AGTTGGAGACAAAATTGGGAAGG - Intronic
908143512 1:61213016-61213038 AGTCAGGGAAAATACTGGGATGG - Intronic
908309712 1:62867558-62867580 ACTCAGATACAGAACTGAAAAGG + Intergenic
908860453 1:68480647-68480669 TTTCAGAGACATGACTGGGAAGG - Intronic
909630174 1:77762525-77762547 ACTCAGTTACAAAAATGAGAAGG - Intergenic
910017881 1:82549925-82549947 ACACAGAGACAAGTCTGGGCTGG - Intergenic
910226711 1:84943376-84943398 CCTCAGAGAGACCACTGGGAAGG + Intronic
910859966 1:91733556-91733578 CCTCATAGACAAGACAGGGAAGG - Intronic
912240412 1:107901744-107901766 ACTTAAAAACAAAACTGGGCTGG + Intronic
913139243 1:115924093-115924115 AGTCAGAGACAAAAGAAGGAAGG - Intergenic
913318219 1:117570718-117570740 AGCCAGAGACAAAGTTGGGAAGG - Intergenic
914702251 1:150145579-150145601 ACACACACACAAAACAGGGAGGG - Intergenic
917929031 1:179811286-179811308 ACTCAGAGACAAAACTGGGAAGG + Intronic
918449729 1:184646902-184646924 ACTCAGAGCCAACACTGAGTGGG - Intergenic
918632206 1:186731118-186731140 ACTTTCATACAAAACTGGGAAGG + Intergenic
923432598 1:233937684-233937706 ACTCTGAAACAAAACGGAGAAGG + Intronic
924766438 1:247035308-247035330 ATTCATAGACAAAAAAGGGAGGG + Intergenic
1066614222 10:37279733-37279755 CCTCTGAGACAAAAGTGGCAGGG + Intronic
1067684555 10:48458745-48458767 ACTGAGCGTCAACACTGGGATGG + Intronic
1068721154 10:60247547-60247569 ATTCGGAGACAAAAGTAGGATGG - Intronic
1070754859 10:78985663-78985685 ACTCAGAGACACCACTGTGCTGG + Intergenic
1072747699 10:97952964-97952986 ACTCAGCTCCAGAACTGGGAAGG - Intronic
1074220663 10:111434498-111434520 TCTCAGAGAGAACACTGGGCAGG - Intergenic
1075207859 10:120462313-120462335 CCACAGAGGCAAAACTGGGGGGG + Intronic
1075223960 10:120608679-120608701 AATCAGAGGCAAAACATGGAGGG + Intergenic
1076996649 11:300285-300307 AGCCAGAGACAAGACTGGGGCGG - Intergenic
1077600440 11:3571007-3571029 TCTCAGAGGTAACACTGGGAAGG - Intergenic
1079852738 11:25557841-25557863 ACTCAAGGGGAAAACTGGGAAGG - Intergenic
1080179740 11:29411278-29411300 ACACACACACAAAACTAGGATGG - Intergenic
1080311982 11:30905347-30905369 ACTCAGTGACAGGCCTGGGAGGG - Intronic
1081403370 11:42668123-42668145 ATTCAGAGGCAAAACTGACAAGG - Intergenic
1081697054 11:45120181-45120203 ACACAGAAATAAAGCTGGGAGGG + Intronic
1083239285 11:61374550-61374572 AGTCAAAGACAAAACTGACAAGG - Intergenic
1083334094 11:61912861-61912883 ACACAGAAACAAAGATGGGAAGG + Intronic
1084256354 11:67945622-67945644 TCTCAGAGGTAACACTGGGAAGG - Intergenic
1084488154 11:69463222-69463244 ACCCAGAGGCAAAGCTGGGATGG + Intergenic
1084816414 11:71649676-71649698 TCTCAGAGGTAACACTGGGAAGG + Intergenic
1085847750 11:80085220-80085242 AATCAGGGACAACACTGGGATGG - Intergenic
1087937866 11:104056504-104056526 ACACAGAGACACAACGGAGAAGG + Intronic
1089132847 11:116225542-116225564 ACTCTGAGTCACAACTGGGTGGG + Intergenic
1090692274 11:129196312-129196334 ACTCAGGGAAAAAAGAGGGATGG + Intronic
1092466790 12:8740490-8740512 ACTCAGGGAGAAGAGTGGGAGGG - Intronic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1095300076 12:40574174-40574196 TCTCATACACAAAACTGGGTAGG + Intergenic
1095710822 12:45286111-45286133 GCTCAGAGGTAAAACAGGGAAGG - Intronic
1096448455 12:51716591-51716613 AATTAGAGTCAAAGCTGGGAGGG + Intronic
1097173593 12:57130202-57130224 ATCCAAAGACAAAACTGGGCTGG + Intronic
1097396585 12:59082491-59082513 AGTGAGAGACAGAACTGGAAAGG - Intergenic
1098743324 12:74201899-74201921 ACTTAGAGACAAATCTGACATGG - Intergenic
1099602292 12:84756427-84756449 ACGCAGACACAACAATGGGATGG - Intergenic
1099919629 12:88941202-88941224 ACTCAGGGAAAAGGCTGGGAGGG + Intergenic
1100233660 12:92635559-92635581 AATCACAGGGAAAACTGGGATGG + Intergenic
1101194023 12:102364252-102364274 ACACAAAGACAAAACAGGGATGG + Intergenic
1101815103 12:108140233-108140255 ACTGAGATACAAAACTGGAAGGG + Intronic
1103051455 12:117783502-117783524 GGCCAGAGCCAAAACTGGGATGG - Intronic
1106085627 13:26539367-26539389 ACCCAGGGAGAAAACAGGGAAGG + Intergenic
1107840288 13:44450544-44450566 AGACAGAGAGAAAAGTGGGATGG + Intronic
1107848150 13:44540536-44540558 ACTCAGCTTTAAAACTGGGAAGG + Intronic
1109326480 13:60873367-60873389 ACTCAGAGACCAAAATGTGAAGG + Intergenic
1110081527 13:71319954-71319976 AGGCAGAGACAAACCTTGGAAGG - Intergenic
1111226116 13:85273085-85273107 ACTCAGAGGGAAGAGTGGGAGGG + Intergenic
1111775598 13:92657513-92657535 AATTAGAGACACAACTGGCACGG + Intronic
1112678986 13:101740324-101740346 ACTCAGATACAAATTTGGAAAGG + Intronic
1113066112 13:106375439-106375461 CCACACAGAGAAAACTGGGAAGG - Intergenic
1113359203 13:109613028-109613050 AGTCAGAGGCAACACTGTGAAGG - Intergenic
1114912761 14:27220789-27220811 ACGCACAAACAAAGCTGGGAAGG + Intergenic
1115246503 14:31301129-31301151 ATTTATAAACAAAACTGGGAAGG + Intronic
1115755348 14:36522594-36522616 ACTCTGGGACACAACTGGGACGG + Intergenic
1117136721 14:52742189-52742211 ACCCAGAGCCAAAGCTAGGAAGG + Intronic
1118086524 14:62424279-62424301 GCTCAGAGACAACACTCTGAAGG - Intergenic
1118101577 14:62610886-62610908 ACTCAGGGAGAAGACTGGGAGGG + Intergenic
1118329552 14:64804828-64804850 GAGCAGAGAGAAAACTGGGAAGG + Intronic
1118775012 14:68968358-68968380 TCTCAGCCACAAAACAGGGATGG + Intronic
1118908914 14:70045264-70045286 ACTCAGAGAAAACAGTGAGATGG + Exonic
1118932168 14:70252963-70252985 CCTGAGAGACAAAAGGGGGAAGG - Intergenic
1119184656 14:72631434-72631456 TCTCAGAGAGAACACTGGGATGG + Intronic
1119785125 14:77307346-77307368 ACTTAGAGAAAAAAGTGGGTTGG - Intronic
1121800407 14:96769598-96769620 GCTCAGAGACAGACCTGGAATGG - Intergenic
1122149907 14:99719595-99719617 ACACAGAGACAGAAGTGGAATGG - Intronic
1122186555 14:100002379-100002401 ATTCAGAGACACAACTGACAAGG + Intronic
1122555259 14:102575538-102575560 ACTCAGACAGAAAATTGGTATGG + Intergenic
1123699659 15:22904785-22904807 ACTCAGAGACAGACCTGTGGCGG - Intronic
1123955390 15:25329241-25329263 AGTCAGTGAGAGAACTGGGAGGG + Intergenic
1125872371 15:43113802-43113824 ACACAGATACATAACTGGAAAGG - Intronic
1126201956 15:45996489-45996511 ATTAAGAGGTAAAACTGGGAAGG - Intergenic
1126536869 15:49775837-49775859 CCTGAGAGAGAAAACAGGGAGGG + Intergenic
1126556810 15:49997421-49997443 ATTCAGTGAGAAAACTGGGATGG - Intronic
1129206977 15:74043167-74043189 ACTCAGAGACTAAATTAGAAAGG - Intronic
1133290355 16:4716570-4716592 AATCAGAGTCAAAAGTAGGATGG - Intronic
1134908429 16:18002221-18002243 ACTCAGAGGGAAAGCGGGGAGGG + Intergenic
1135491186 16:22911190-22911212 ACCCAGGGACAGAACTGGAAAGG + Intronic
1135965193 16:27029681-27029703 ACTCAGAGGCAAAACCATGATGG - Intergenic
1136746819 16:32597953-32597975 ACACAGAGAAAAAGCTAGGATGG - Intergenic
1137608175 16:49800855-49800877 GCTCAAAGGCAAAACAGGGAAGG + Intronic
1138039385 16:53646502-53646524 AGTCAGAGACAAACCTTGAAGGG + Intronic
1138165822 16:54800839-54800861 ACTGAAAGGCAAAACAGGGAAGG + Intergenic
1139402692 16:66695670-66695692 ACCCAGAGTTAAATCTGGGAGGG - Intronic
1139443028 16:66978422-66978444 ACTCACAGCCAGACCTGGGAAGG - Intergenic
1140166023 16:72552478-72552500 ACACAGACACAAAAATGGGCCGG - Intergenic
1143751120 17:9028514-9028536 GGTCAGAGAGAAAACTGGGCAGG - Intronic
1144384538 17:14737083-14737105 ACTTGGAGAGAAAACTGGAAAGG + Intergenic
1144874731 17:18391443-18391465 ACACAGAGCCAAACCTGTGAGGG - Intergenic
1145157494 17:20552978-20553000 ACACAGAGCCAAACCTGTGAGGG + Intergenic
1145775565 17:27525626-27525648 ACTCAGTGACCAAACTGTAAGGG - Intronic
1146159300 17:30551272-30551294 ACACAGAGCCAAACCTGTGAGGG - Intergenic
1147119839 17:38329521-38329543 AATCAGAGACAAATCTGAGGCGG - Exonic
1147264969 17:39229118-39229140 CCTCAGAGAAAGCACTGGGAAGG - Intergenic
1148854406 17:50570841-50570863 ACTGAGTGAGAAAACTGGGCTGG + Intronic
1149002243 17:51769516-51769538 ACTCAGAAACATTTCTGGGAAGG + Intronic
1149538732 17:57452596-57452618 ACTTACAAACAAAAGTGGGAGGG + Intronic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1150885455 17:69080668-69080690 ACTGAGGGATAAAAGTGGGAAGG + Intronic
1151235022 17:72713621-72713643 ACACATAAAAAAAACTGGGAGGG + Intronic
1153093171 18:1371537-1371559 AATCAGAAGCAATACTGGGAAGG + Intergenic
1153644162 18:7179532-7179554 ACTCAGAGACACAAGTTGTATGG + Intergenic
1155880128 18:31136551-31136573 AATCAAAGACAAAGCTGAGAAGG + Intronic
1159408117 18:68033025-68033047 ACTCAGATACCCAACTGGTAGGG - Intergenic
1159534056 18:69692696-69692718 AGTCACAGGCAAAACTTGGATGG - Intronic
1161709113 19:5837934-5837956 ACTCAGAGCCCGGACTGGGAGGG + Intronic
1163596231 19:18222488-18222510 ACTCAAAGACCAAAGTGTGAGGG - Intronic
1164082255 19:21868731-21868753 ATTCAGAGAGAAATCTGGGGAGG + Intergenic
1164873946 19:31670080-31670102 AATCAGAGACAGAGCTGGAAAGG + Intergenic
1164961256 19:32432422-32432444 AGTGAGACACAAAACAGGGATGG - Intronic
1167715364 19:51139546-51139568 AATCAGAAAAAAAAATGGGAAGG - Intergenic
926304469 2:11628038-11628060 ACTCAGCCACGAAACTCGGAGGG + Intronic
926809461 2:16743535-16743557 GCTCAGAGACAAGACTGGACTGG + Intergenic
926855412 2:17251063-17251085 ACTCAGAAAGAAAAATGGTACGG + Intergenic
933859948 2:86456083-86456105 ACTCAGTAACACAAATGGGAAGG - Intronic
934136191 2:88998566-88998588 ACATAGAGACAGAACTGGAATGG - Intergenic
935267102 2:101404190-101404212 ACTCAGGGAAAAAACTGTGAAGG - Intronic
936974017 2:118201799-118201821 AATCAGAGACCAGACTGGGAAGG - Intergenic
937844045 2:126557901-126557923 ACACAGAGAGAAAATTGAGACGG - Intergenic
938184291 2:129214772-129214794 ATTCAGAGACAACACTGTGGAGG + Intergenic
939338603 2:140863577-140863599 AATCAGAGACAAGATTGGGCAGG - Intronic
940330586 2:152470056-152470078 ACACAGACACAAAGCAGGGAGGG - Intronic
941424704 2:165327964-165327986 ACTCACACACATACCTGGGAAGG - Intronic
941656293 2:168148338-168148360 ACTCTGAGTGCAAACTGGGAGGG + Intronic
943601754 2:189930076-189930098 ACTTAGAGAGAAAAGTAGGATGG - Intronic
943796022 2:191995302-191995324 GCTCAAAGAAAAAACTGAGAGGG + Intronic
944234463 2:197429144-197429166 ACTATGAGTCCAAACTGGGAAGG - Intronic
944280522 2:197891377-197891399 TCTGGGAGACAGAACTGGGATGG - Intronic
945142892 2:206705889-206705911 ATACAGAGACAAGAATGGGAAGG + Intronic
947854457 2:233313810-233313832 ACTGAGAGACCAAGGTGGGAAGG - Intronic
948791859 2:240383373-240383395 CCTGAAAGACACAACTGGGAGGG - Intergenic
1169605651 20:7315844-7315866 CCTGGGAGACAAAAGTGGGAGGG + Intergenic
1169719380 20:8657106-8657128 AGACAGAGAAAAAACAGGGAGGG + Intronic
1170441736 20:16386276-16386298 ACTCAGAGAAAAATCTGGAAAGG + Intronic
1171168987 20:22998713-22998735 ACTCAGAGACGGGACTGAGAAGG + Intergenic
1174471636 20:50765543-50765565 CTTCAGAGACATAACTGGGAAGG + Intergenic
1178094219 21:29197072-29197094 CCACAGAGATAAATCTGGGAAGG + Intronic
1179770284 21:43610178-43610200 ACTCAAAGGAAAAACTGGAATGG + Intronic
1181614991 22:24048007-24048029 ACACACAGAAAAAAATGGGATGG - Intronic
1182728619 22:32469357-32469379 GCTAGGAGACAAAAGTGGGAGGG + Intergenic
1184142218 22:42584577-42584599 ACTCAGTGACAACACTGGCCTGG + Exonic
949174619 3:1044887-1044909 GCTCAGAGAAAAATCTGAGAAGG - Intergenic
950986346 3:17372610-17372632 ACTCAGTGACTAAACTGTGAGGG - Intronic
951465715 3:22998572-22998594 CCTCAGAGAGAACACTGGGATGG - Intergenic
951523067 3:23627270-23627292 ACTAAGACAGAAAACTGGCATGG - Intergenic
952934582 3:38386211-38386233 ACACAGAGACAACACAGGTAAGG - Intronic
952953014 3:38539303-38539325 AGTCAGAGGCAGAGCTGGGAAGG - Intronic
953203508 3:40799344-40799366 AGTGAGTGGCAAAACTGGGATGG + Intergenic
953728651 3:45425568-45425590 ACTGATGGACAAAACTTGGAAGG - Intronic
953904688 3:46862614-46862636 TCTCAGAGTCTAAACTTGGAGGG - Intronic
957071262 3:75569659-75569681 TCTCAGAGGTAACACTGGGAAGG - Intergenic
957327553 3:78716032-78716054 ACACAGACACAAAGCTGAGAAGG - Intronic
958590327 3:96150003-96150025 AATCAGAGACAAAATTGAAAGGG + Intergenic
958640091 3:96794772-96794794 AGTGAGGGACAAAGCTGGGATGG + Intergenic
959241452 3:103800772-103800794 GCTCAGTGACAAAATTGGTAGGG - Intergenic
960590305 3:119359579-119359601 ACTCAGAGGGAAAATTGGGGTGG + Intronic
960857078 3:122113001-122113023 ACTCAGAGGAAAGAGTGGGAGGG - Intronic
961953223 3:130772249-130772271 TCTAAGATACTAAACTGGGAAGG - Intergenic
963238522 3:142979720-142979742 ACTAAGATACAAAACTGAGATGG - Intronic
963884735 3:150569080-150569102 AGTCAGAGAAAAAACAAGGATGG + Intronic
964370196 3:155992493-155992515 CCTCTGAGACAAAACTGAAATGG + Intergenic
964592295 3:158378019-158378041 ACTCAGAGAAAAAAATTGGGAGG - Intronic
966417845 3:179707627-179707649 ACTCTGAGACAAAAAAGTGAAGG - Intronic
967321713 3:188201204-188201226 ACTGGGAGCCAATACTGGGAAGG + Intronic
967861266 3:194153576-194153598 ACTCACAGATAAGACTGGGAGGG + Intergenic
968341736 3:197961021-197961043 AAGCAGAGAGAAAAATGGGATGG - Intronic
968391936 4:200207-200229 AATCGGATACAAAACTGGGGAGG + Intergenic
969739074 4:9011086-9011108 TCTCAGAGGTAACACTGGGAAGG + Intergenic
970052377 4:11929166-11929188 ACTCAGACTCAAAACAGGAAAGG + Intergenic
970671312 4:18399750-18399772 ATTCATATACAAAACTTGGAAGG + Intergenic
971037921 4:22715281-22715303 ACACAGAGACACAAGGGGGAAGG + Intergenic
971955612 4:33414363-33414385 AGTCAAAGACAAAACTGTCAAGG - Intergenic
972830738 4:42811041-42811063 TCTTACAGACAAAACTGAGAGGG + Intergenic
973608459 4:52610821-52610843 GCTGTGAGTCAAAACTGGGAAGG - Intronic
974069551 4:57110974-57110996 ACTGGGAGACAAAGCGGGGAGGG - Intergenic
975593902 4:76028664-76028686 GCTCAGAGTGAAAACTGTGAAGG - Intronic
976242678 4:82974879-82974901 ACGTAGATACAAAAGTGGGATGG + Intronic
976471086 4:85429992-85430014 ATTCAGAGAGAAAACTGTGGTGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979342518 4:119543405-119543427 ACTCAGAGACAGAAGTGATAAGG - Intronic
980914936 4:139025202-139025224 TCTCACAGACAAAGCCGGGAAGG - Intronic
981474794 4:145178050-145178072 ACTGAGTCACATAACTGGGAAGG + Intronic
982518687 4:156385805-156385827 AATGAGAGACCAAACTGGGCAGG + Intergenic
984412409 4:179410851-179410873 AACCAGAGACAAAATTGGCATGG + Intergenic
984497796 4:180520142-180520164 TCTCAGAGAGAAAACAGTGATGG + Intergenic
984985990 4:185329884-185329906 AGTGAGAGACAAGACTGGGTGGG + Intronic
987155995 5:15090221-15090243 ATTCAGAGAAAAAAATGGGATGG - Intergenic
987392911 5:17392939-17392961 ACTAAGAGACAACAATGGGGTGG + Intergenic
987746680 5:21982712-21982734 ACTGATAGACAAAACTTAGAAGG - Intronic
987759181 5:22137306-22137328 ACTATAAGACAAAGCTGGGAAGG - Intronic
988533977 5:32049804-32049826 AAGCAGAGAAAAAACTGGCATGG + Intronic
988961710 5:36377690-36377712 ACCCTGAGACCACACTGGGAAGG - Intergenic
992441787 5:76803461-76803483 ACTCATTGTCAAAACAGGGAGGG + Intergenic
992765259 5:79992308-79992330 ACTCAGAGGCATGACTGCGAGGG - Intronic
992883142 5:81130538-81130560 ACTCAGAGCAGAAACAGGGAAGG + Intronic
993237005 5:85324117-85324139 GCTCAGAGACAAAGGAGGGAAGG + Intergenic
993454225 5:88108930-88108952 AGTGAGAGATAAAACTGGAAAGG + Intergenic
995203290 5:109450291-109450313 ACTCAGAGCCATTACTGAGAAGG - Intergenic
995589096 5:113679978-113680000 ACTCAAAAAGAAAATTGGGAAGG + Intergenic
996716523 5:126592274-126592296 ACTCCCAGACAAATCTGGCAGGG + Intronic
997857441 5:137384751-137384773 ACACAGAGACAAAGAGGGGAAGG - Intronic
998780146 5:145647382-145647404 AGTCTGAGATCAAACTGGGATGG - Intronic
999338030 5:150740891-150740913 ACTCAGGGGGAAAGCTGGGAAGG + Intronic
999426622 5:151493150-151493172 ACTCAGTGACAAAAAGGGAAGGG - Intergenic
1000235929 5:159360558-159360580 ACTCAGAGGGAAGAGTGGGAGGG + Intergenic
1001184172 5:169551759-169551781 TCTCAGAGACAAATCAGGGGAGG + Intergenic
1001838465 5:174852815-174852837 ACAAAGAGAGGAAACTGGGAGGG + Intergenic
1002969041 6:1995478-1995500 TCTCTGAGACAACACAGGGATGG - Intronic
1004097035 6:12566596-12566618 ACTCAGAGGGAAGAATGGGATGG + Intergenic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1006765970 6:36507354-36507376 AATCACAGGCAAACCTGGGAAGG + Intronic
1007716542 6:43859360-43859382 ACTAAGAGACAGAACCGGGAAGG - Intergenic
1007913138 6:45535908-45535930 AATGAGAGACAAGACTGGAAAGG + Intronic
1008549430 6:52613527-52613549 ACTCAGTCACAAAACCGGGAAGG - Intergenic
1012228688 6:96735425-96735447 TATCAGAGAAAAATCTGGGAAGG + Intergenic
1014861840 6:126478570-126478592 TGTCACTGACAAAACTGGGATGG - Intergenic
1017034291 6:150253071-150253093 ACTCAGAGGCAAAAATAGGGTGG - Intergenic
1018089238 6:160331262-160331284 CCTGACAGACAGAACTGGGAAGG + Intergenic
1019880354 7:3854257-3854279 TCTCAGTCACAAAACTAGGAAGG - Intronic
1020788167 7:12594153-12594175 ACTCAGAGTCAGAAGTGGGTTGG + Intronic
1020944253 7:14581294-14581316 ATACAGAGACACAACTAGGATGG + Intronic
1021953551 7:25799695-25799717 CCTCAGAAAAAAAACTAGGAAGG - Intergenic
1023525112 7:41093988-41094010 AAGCAGAGATAAAGCTGGGAAGG - Intergenic
1023547039 7:41328911-41328933 ACTGAGAGACTAACTTGGGAGGG + Intergenic
1026378532 7:69775946-69775968 ACTCAGAGAAAGAAGTGGGGTGG - Intronic
1026637134 7:72094062-72094084 GCTTAGAGACAAACCTGGTAGGG - Intronic
1027480453 7:78689543-78689565 AGACAGAGAGAAAACTGCGAAGG - Intronic
1027611989 7:80373077-80373099 GCTAAAAGACAAAAATGGGAAGG - Intronic
1028496824 7:91470813-91470835 ACTCAGAGGGAAGAATGGGAGGG - Intergenic
1029073545 7:97918990-97919012 TCTCAGAGGTAACACTGGGAAGG - Intergenic
1029225266 7:99022407-99022429 ACTCAGAGGTGAAACAGGGAAGG + Intergenic
1029305823 7:99619505-99619527 ATGTAGAGACAGAACTGGGATGG + Intronic
1031123284 7:117745041-117745063 ACTCTGACACAAAACTGAAATGG - Intronic
1032497023 7:132370184-132370206 ACTCAGAGCTAAGACTGGGAAGG - Intronic
1033603800 7:142910156-142910178 CCTGTGACACAAAACTGGGAGGG + Intronic
1036244151 8:7102310-7102332 TCTCAGAGGTAACACTGGGAAGG + Intergenic
1036256589 8:7211441-7211463 TCTCAGAGGTAACACTGGGAAGG - Intergenic
1036308639 8:7670026-7670048 TCTCAGAGGTAACACTGGGAAGG - Intergenic
1036360899 8:8076051-8076073 TCTCAGAGGTAACACTGGGAAGG + Intergenic
1036890072 8:12590950-12590972 TCTCAGAGGTAACACTGGGAAGG - Intergenic
1036897682 8:12649107-12649129 TCTCAGAGGTAACACTGGGAAGG - Intergenic
1038684589 8:29704727-29704749 ACTCAGGGAGAAAAGTGGGAGGG - Intergenic
1038898922 8:31819675-31819697 ACTGAGACACAAAACTGAAAAGG - Intronic
1039252739 8:35684560-35684582 ACTGAGAGAGAAAAATGGGGAGG - Exonic
1039840004 8:41286380-41286402 ACACAGGGACACAACTGTGAAGG + Intronic
1040009706 8:42651181-42651203 AGCCAGAGACAGAACTGGGCTGG - Intergenic
1041174020 8:55174760-55174782 ACTTAGAGACAATTCAGGGATGG + Intronic
1042065197 8:64867344-64867366 AGGCAGAGAGAAAAATGGGAGGG - Intergenic
1047230345 8:122992752-122992774 ACTAAGAGGCAAAATTGGTAGGG - Intergenic
1047985155 8:130225611-130225633 ACACACAGACAACACTTGGATGG + Intronic
1048839047 8:138548633-138548655 AATCAAAGACATAACAGGGAGGG + Intergenic
1048945456 8:139443070-139443092 TCTTAAAGACACAACTGGGATGG + Intergenic
1049331887 8:142059011-142059033 ACTGAGAGGCAAGGCTGGGACGG - Intergenic
1049827870 8:144681689-144681711 GGTAGGAGACAAAACTGGGATGG + Intergenic
1050923517 9:11234948-11234970 AGTGAGAGACAAGACTGGGTGGG + Intergenic
1051105184 9:13571161-13571183 ACTCAGAGAAAAGACAGGGTTGG - Intergenic
1052940083 9:34126231-34126253 AGTCAGAGGCAAAACAGGAATGG - Intronic
1053558089 9:39159200-39159222 ACACAGCGACAGAAATGGGAAGG - Intronic
1053616011 9:39766622-39766644 ACTAAGAGACAAAGTTGGGATGG - Intergenic
1053822208 9:41979486-41979508 ACACAGTGACAGAAATGGGAAGG - Intronic
1053874184 9:42525932-42525954 ACTAAGAGACAAAGATGGGATGG - Intergenic
1053898436 9:42768653-42768675 ACTAAGAGACAAAGATGGGATGG + Intergenic
1054139025 9:61459752-61459774 ACACAGTGACAGAAATGGGAAGG + Intergenic
1054237506 9:62575768-62575790 ACTAAGAGACAAAGTTGGGATGG + Intergenic
1054268149 9:62940822-62940844 ACTAAGAGACAAAGATGGGATGG + Intergenic
1054551642 9:66610279-66610301 ACTAAGAGACAAAGTTGGGATGG + Intergenic
1054608367 9:67207927-67207949 ACACAGTGACAGAAATGGGAAGG + Intergenic
1054807936 9:69411336-69411358 ATTGAGAGACAACACTAGGATGG - Intergenic
1055319647 9:75069862-75069884 ACTCAGAGACAATATTAGGGTGG + Intronic
1056518091 9:87373830-87373852 ACTCAGAGACAAAGTAGAGAAGG - Intergenic
1059521784 9:114949472-114949494 AATCACACACAAAGCTGGGAGGG - Intergenic
1060089694 9:120732103-120732125 GCTTAGAAACAAACCTGGGATGG - Intergenic
1061224682 9:129274045-129274067 AGTCAGAGATGAAGCTGGGAAGG - Intergenic
1185791969 X:2933983-2934005 ACTCAGACACCAAACTGGAGAGG - Intergenic
1186728925 X:12387138-12387160 ACTCAGAGACAAAGAAAGGATGG - Intronic
1187001186 X:15180347-15180369 ACTAAAAGACAAAAATGGAATGG + Intergenic
1187484226 X:19686854-19686876 TCTCAGAAACAAAACTGAGGAGG - Intronic
1188409444 X:29853106-29853128 ATTCAGAGAAAATAATGGGATGG + Intronic
1192505858 X:71682520-71682542 ATTCAGAGAGAAAACTGGTAAGG - Intergenic
1194032561 X:88834597-88834619 ACTCAGGGAAAAAGGTGGGAGGG + Intergenic
1195405699 X:104510819-104510841 GCTCTGAGGCAAGACTGGGAAGG + Intergenic
1195688728 X:107606926-107606948 ACTCACACACAAGTCTGGGATGG - Intergenic
1196588786 X:117461081-117461103 AAGCAGAGACAAAAGTGAGAAGG + Intergenic
1199030041 X:142986932-142986954 AATCAGAGACCAAACTATGAAGG - Intergenic
1199477544 X:148262242-148262264 AGTCAGAGAAAAAAGTGGAAAGG - Intergenic
1200733482 Y:6768640-6768662 TTTCAGGGAAAAAACTGGGAAGG - Intergenic