ID: 917929101

View in Genome Browser
Species Human (GRCh38)
Location 1:179811717-179811739
Sequence CTTTGTGAGCACAGTGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 326}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917929094_917929101 12 Left 917929094 1:179811682-179811704 CCCCTTTTACCTGGTGAACACAC 0: 1
1: 0
2: 1
3: 12
4: 193
Right 917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG 0: 1
1: 0
2: 0
3: 27
4: 326
917929093_917929101 13 Left 917929093 1:179811681-179811703 CCCCCTTTTACCTGGTGAACACA 0: 1
1: 0
2: 0
3: 16
4: 232
Right 917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG 0: 1
1: 0
2: 0
3: 27
4: 326
917929100_917929101 -10 Left 917929100 1:179811704-179811726 CCAGGGTGCATAGCTTTGTGAGC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG 0: 1
1: 0
2: 0
3: 27
4: 326
917929095_917929101 11 Left 917929095 1:179811683-179811705 CCCTTTTACCTGGTGAACACACC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG 0: 1
1: 0
2: 0
3: 27
4: 326
917929096_917929101 10 Left 917929096 1:179811684-179811706 CCTTTTACCTGGTGAACACACCA 0: 1
1: 0
2: 0
3: 11
4: 170
Right 917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG 0: 1
1: 0
2: 0
3: 27
4: 326
917929099_917929101 3 Left 917929099 1:179811691-179811713 CCTGGTGAACACACCAGGGTGCA 0: 1
1: 0
2: 1
3: 8
4: 153
Right 917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG 0: 1
1: 0
2: 0
3: 27
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917929101 Original CRISPR CTTTGTGAGCACAGTGCAGT TGG Intronic
900890767 1:5448164-5448186 TTTTATGAACACACTGCAGTTGG - Intergenic
900931263 1:5739301-5739323 CCCTGTGAGGACAGTGCAGTGGG - Intergenic
901492850 1:9605433-9605455 GTTTGAGGGCACAGGGCAGTCGG + Intronic
901610846 1:10496638-10496660 CTTTGGGAGCCCTGAGCAGTTGG + Intronic
902648704 1:17822712-17822734 ATGTGTGTGCAAAGTGCAGTGGG + Intronic
902985354 1:20151275-20151297 CTTTGTGAGCTGAGTGGGGTGGG + Intergenic
903789104 1:25880721-25880743 CAGTGTGAGCACGGTGCAGTGGG + Intergenic
904249986 1:29216389-29216411 CTTTTTGAGAAGATTGCAGTGGG - Intronic
905645998 1:39625616-39625638 CATTGGGTGCACAGTGCAGAGGG - Exonic
906001686 1:42431799-42431821 CTGTGGGAGCACAGTGCACAGGG - Intronic
906037587 1:42761640-42761662 CTTTGGGAGCCCAAGGCAGTAGG + Intronic
906393693 1:45441858-45441880 CTTTGGGAGGCCAGTGCAGGTGG - Intronic
906426181 1:45714982-45715004 CTTTGGGAGGACAGGGCAGGCGG + Intronic
906449029 1:45928400-45928422 CTATGTCAGCACAGTGTATTTGG + Intronic
907347781 1:53797868-53797890 CTTTGGGAGGCCAGTGCAGGAGG - Intronic
909457793 1:75869811-75869833 CTCTGTTAGGACAGTGCAGAAGG + Intronic
913014516 1:114719066-114719088 CTTTGAGAGGACAGGGCAGGAGG + Intronic
914717074 1:150262225-150262247 CTTTCTGACCCCAGTGCAGGTGG - Exonic
914804664 1:150983315-150983337 CTGTGGGAGCACAGGGTAGTTGG - Intronic
915822219 1:159036828-159036850 CTGTGTGGTCACAGTGCAGTTGG - Intronic
916550809 1:165848386-165848408 CTTTGGGAGGCCAGTGCAGGAGG + Intronic
917328854 1:173861649-173861671 CTTTGGGAGGGCAGGGCAGTTGG + Intergenic
917438821 1:175047602-175047624 CTTTGGGAGCCCAGGGCAGGAGG - Intergenic
917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG + Intronic
917943519 1:179946842-179946864 CTTTGGGAGACCAGTGCAGGAGG + Intergenic
917983888 1:180294940-180294962 CTTTGGGAGACCAGTGCAGAAGG - Intronic
918092050 1:181305532-181305554 CTTGCTGAGCACAGTCCTGTGGG - Intergenic
918770510 1:188552138-188552160 CTTTGTGAGAATAGAGCACTAGG - Intergenic
920280389 1:204839187-204839209 CTTTGTTAGCATGGAGCAGTGGG + Intronic
920724367 1:208420004-208420026 CTGTCTGAGCACTGTGCAGTGGG + Intergenic
922221490 1:223611743-223611765 CTTTGTGAGCCAAGGGCAGGTGG + Intronic
923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG + Intronic
1065742713 10:28811729-28811751 CTTTGGGAGGACAGGGCAGGTGG - Intergenic
1065892117 10:30130345-30130367 CCTTGTCAGAACAGGGCAGTTGG - Intergenic
1067016560 10:42760222-42760244 CTTTGTGACCAGAGCCCAGTTGG - Intergenic
1067257619 10:44659695-44659717 CTTTGTGAGTGCAGTGTATTGGG - Intergenic
1068774042 10:60852403-60852425 CTTTGGGAATACAGTGCATTTGG - Intergenic
1069549274 10:69351262-69351284 CTTTGGGAGGCCAGGGCAGTCGG + Intronic
1070182747 10:74030062-74030084 CTTAATTAGCACAGTGCATTAGG - Intronic
1071327806 10:84534295-84534317 CTCTGTGAGGGCAGTGCAGAAGG + Intergenic
1071672220 10:87619221-87619243 CATGGTGCTCACAGTGCAGTGGG - Intergenic
1073073125 10:100807355-100807377 GTGTGTGAGCACAGTACCGTGGG - Intronic
1073073137 10:100807406-100807428 GTGTGTGAGCACAGTACCGTGGG - Intronic
1073073149 10:100807457-100807479 GTGTGTGAGCACAGTACCGTGGG - Intronic
1073073160 10:100807508-100807530 GTGTGTGAGCACAGTACCGTGGG - Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1078383042 11:10861249-10861271 CTTTGGGAGGACAGGGCAGGAGG + Intergenic
1078529719 11:12127615-12127637 CTTTGGGAGCACAGGGAAGGAGG + Intronic
1078660494 11:13281751-13281773 CTTTGGGAGGCCAGTGCAGGTGG - Intronic
1079647126 11:22879267-22879289 TTTTTTGAGCACAGTGCACATGG + Intergenic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1083749369 11:64752937-64752959 CTTGGGGAACACAGTGCAGGAGG + Intronic
1084917526 11:72440316-72440338 CTTTGTGAGGCCAAGGCAGTAGG + Intergenic
1085179791 11:74523968-74523990 CTTTGGGAGGCCAGTGCAGGAGG + Intronic
1085701712 11:78751835-78751857 CTTTGTATTGACAGTGCAGTTGG + Intronic
1086888447 11:92228048-92228070 GTTTCTGTGCACAGTGCACTGGG + Intergenic
1087094841 11:94308218-94308240 CTTTGAGACTTCAGTGCAGTGGG - Intergenic
1087732335 11:101793029-101793051 CAGGGTAAGCACAGTGCAGTGGG + Intronic
1088762811 11:112948417-112948439 CTCTGTTAGGACAGTGCAGAAGG - Intergenic
1089305465 11:117523722-117523744 CATTGTGAGCATAGGGCAGTAGG - Intronic
1089598417 11:119597773-119597795 CTGTGTGAGCAGAGTACAGGGGG - Intergenic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090302404 11:125654986-125655008 CTCTCTGAGCTCAGTGCAGTAGG + Intronic
1091253026 11:134159857-134159879 CTGTCTGGTCACAGTGCAGTGGG + Intronic
1093532629 12:20185703-20185725 CTTTGTAAACTCAGTGTAGTTGG + Intergenic
1094355031 12:29568025-29568047 CTTTGTAAGGACATTGCATTAGG - Intronic
1097027552 12:56068631-56068653 CTTTGTGAGGCCAATGCAGGAGG - Intergenic
1097027858 12:56071333-56071355 CTTTGTGAGGCCAAGGCAGTGGG + Intergenic
1097999828 12:65928437-65928459 CTTTGTAAACACAGTACACTTGG + Intronic
1098125090 12:67282860-67282882 CTTTGTGTATACATTGCAGTGGG + Intronic
1098327331 12:69316315-69316337 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1098926870 12:76360594-76360616 CTCTGCTAGCACAGTGCAGAAGG - Intronic
1100038477 12:90281973-90281995 CTTTGTTAGGGCAGTGCAGAAGG + Intergenic
1100189491 12:92175584-92175606 CTTTGGGAGGCCAGCGCAGTAGG - Intergenic
1100320879 12:93491132-93491154 CTTTGGGAGCCCAAGGCAGTGGG - Intronic
1102612818 12:114127628-114127650 ATTTCTGTGCACAGAGCAGTTGG - Intergenic
1104447212 12:128844266-128844288 CTTTGTGAGGACAGAGCAGGAGG + Intergenic
1104807314 12:131597941-131597963 GTTGGTGAGCACAGTGCTCTGGG - Intergenic
1104954048 12:132455119-132455141 CTCTGAGAGCAGAGTCCAGTGGG + Intergenic
1106616136 13:31329728-31329750 TGTTGTGAGCACAGCACAGTGGG - Exonic
1107614416 13:42149613-42149635 GGTTGTGAGCAAAGTGCAGAAGG - Intronic
1108766342 13:53634780-53634802 CATTGTGAACATAGTGCATTGGG + Intergenic
1109407309 13:61918749-61918771 CTTTGCTAGGGCAGTGCAGTAGG - Intergenic
1110169572 13:72484605-72484627 CTTTGAGATCACAATTCAGTTGG + Intergenic
1110394214 13:75011175-75011197 CCTTGTGTGCACAGTGCACATGG - Intergenic
1112567363 13:100562926-100562948 CTTTTTTAGCACATGGCAGTGGG - Intronic
1113130280 13:107028960-107028982 TTTTGCGAGTCCAGTGCAGTTGG + Intergenic
1113536887 13:111075210-111075232 CTTTGTGAGGACAAGGCAGGAGG - Intergenic
1115008307 14:28512748-28512770 CTAAATTAGCACAGTGCAGTAGG + Intergenic
1115140354 14:30163902-30163924 CTTTGAGAGGCCAGTGCAGAAGG + Intronic
1117495919 14:56303839-56303861 CTTTTATATCACAGTGCAGTGGG - Intergenic
1117568550 14:57021973-57021995 CTTTGGGAGTACAGTGCAGAAGG - Intergenic
1117635630 14:57740101-57740123 CTTTGTGAGGCCAGGGCAGGTGG - Intronic
1119167278 14:72505017-72505039 CTTTGTGAGGCCAATGCAGGCGG - Intronic
1119413406 14:74453101-74453123 CTTTGGGAGCACAAGGCAGGTGG + Intergenic
1120921051 14:89755732-89755754 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1123466308 15:20518752-20518774 CGTGCTGAGCACCGTGCAGTCGG + Intergenic
1123651806 15:22482286-22482308 CGTGCTGAGCACCGTGCAGTCGG - Intergenic
1123742225 15:23291145-23291167 CGTGCTGAGCACCGTGCAGTCGG - Intergenic
1123761099 15:23433340-23433362 CGTGCTGAGCACCGTGCAGTCGG + Intergenic
1123794084 15:23754056-23754078 TTTTGAAATCACAGTGCAGTAGG - Intergenic
1124132382 15:27002663-27002685 CTTTGGGAGGCCAGGGCAGTAGG + Intronic
1124268190 15:28256182-28256204 CGTGCTGAGCACCGTGCAGTCGG - Exonic
1124277035 15:28334730-28334752 CGTGCTGAGCACCGTGCAGTCGG + Intergenic
1124305665 15:28576876-28576898 CGTGCTGAGCACCGTGCAGTCGG - Intergenic
1124899291 15:33807632-33807654 CATGGTGATCACAGTGCAGAGGG - Intronic
1124938370 15:34194181-34194203 CTTTGTGAGCCCAAGGCAGGTGG - Intronic
1125637857 15:41204305-41204327 CTTTGGGAGGTCAGGGCAGTTGG + Intronic
1125753376 15:42045547-42045569 CTTTCTGAGCACAGAGCAGGTGG - Intronic
1129195449 15:73962515-73962537 CTGTGTGTTCACTGTGCAGTTGG + Intergenic
1129612936 15:77074691-77074713 CTTCCTGAGCACTGGGCAGTAGG - Intronic
1130958346 15:88642978-88643000 CTTTGGGAGGCCAGTGCAGAAGG + Intronic
1131973338 15:97914923-97914945 CTTAGTGAGAATAATGCAGTTGG + Intergenic
1132396573 15:101479369-101479391 CTGGGTGAGCACAGAGCAGTGGG + Intronic
1132864577 16:2087116-2087138 CTGGGTGGGCACAGTGTAGTTGG + Intronic
1132979164 16:2726652-2726674 CTTTGGGAGGCCAGTGCAGGCGG - Intergenic
1133250489 16:4477107-4477129 CTTTCTGAGCGCAGTGCTCTGGG + Intronic
1133308908 16:4830045-4830067 CTTTGGGAGGCCAGTGCAGGAGG - Intronic
1133795853 16:9045568-9045590 CTTTGGGAGTCCAGTGCAGGAGG + Intergenic
1133989461 16:10693336-10693358 CTTTGTGAGGCCAGGGCAGGTGG - Intronic
1135568923 16:23533383-23533405 CTTTGGGAGGCCAGTGCAGGAGG - Intronic
1135677434 16:24428854-24428876 CTTTGTGAGGCCAAGGCAGTAGG - Intergenic
1136132413 16:28231819-28231841 ATTTGCCAGCACAGTGCATTTGG - Intergenic
1136286011 16:29242632-29242654 CTTTGTGAGGCCAATGCAGGTGG - Intergenic
1136456843 16:30384631-30384653 TTTTGGGAGGACAGGGCAGTCGG + Intronic
1138224583 16:55281819-55281841 CTTTGGGAGGCCAGTGCAGGAGG - Intergenic
1139322336 16:66125680-66125702 GTTCATGAGCTCAGTGCAGTGGG - Intergenic
1139910945 16:70397282-70397304 CTTTGAGAGCACAGGGCGGACGG - Intronic
1142091349 16:88212825-88212847 CTTTGTGAGGCCAATGCAGGCGG - Intergenic
1142785845 17:2221976-2221998 CTTTGGGAGGCCAGTGCAGGTGG - Intronic
1143449188 17:7025587-7025609 CTTTGGGAGGCCAGTGCAGGAGG + Intronic
1144145240 17:12391403-12391425 CTTTGGGAACACATTGCACTAGG + Intergenic
1145899309 17:28479774-28479796 CTTTGGGAGGCCAGTGCAGGAGG + Intronic
1146313583 17:31789894-31789916 GTTTGTGAGCACATTGGAGATGG - Intergenic
1146381808 17:32335754-32335776 CATTGAGTGCACAGTACAGTGGG - Intronic
1146404413 17:32524944-32524966 CTTTGGGAGGCCAGTGCAGGAGG - Intronic
1147128230 17:38388013-38388035 CTTTGGGAGGCCAATGCAGTTGG - Intronic
1147182480 17:38695275-38695297 CTTTGAGAGCACAGGGCAGGAGG - Intergenic
1147586276 17:41655504-41655526 CTGAGTGAGCACAGGGCAGCGGG - Intergenic
1147593879 17:41704177-41704199 CTTTGGGAGCCCAATGCAGGAGG + Intergenic
1147809029 17:43153845-43153867 CTTTGTAAAAACAGTGTAGTAGG + Intergenic
1150631086 17:66880980-66881002 CTTTGGGAGGCCAGGGCAGTTGG - Intronic
1153933448 18:9899633-9899655 CTTTGGGAGGCCAGTGCAGGGGG - Intergenic
1154014621 18:10605239-10605261 CCTTGTGAGCACAGGGCTATCGG + Intergenic
1154223199 18:12475341-12475363 CTTAGTGAGCACAGTGTCTTAGG - Intronic
1154491566 18:14925937-14925959 TTTTGTGAGCACAGGACAGGTGG - Intergenic
1155118977 18:22798953-22798975 CTTTGGGAGCCCAAGGCAGTAGG - Intronic
1156406044 18:36783599-36783621 CATTGTTAACACAGTGCAGGGGG + Intronic
1157479695 18:48045433-48045455 CTTTCTGAGCACAGCTGAGTGGG + Intronic
1158341360 18:56470058-56470080 TTTTATAAGCAGAGTGCAGTTGG + Intergenic
1159147823 18:64477718-64477740 TTTTGTAAGCAAAGTGCAATGGG - Intergenic
1159222442 18:65482157-65482179 CTTTGGGAGCCCAGGGCAGGCGG + Intergenic
1159314086 18:66748606-66748628 CTTTGGGAGCCCAGGGCAGGAGG + Intergenic
1159642311 18:70877544-70877566 CTTTGGGAGGACAGTGCAGGTGG + Intergenic
1160787906 19:909939-909961 CTTTGTGAGCCCAAGGCAGGTGG + Intronic
1162837192 19:13328146-13328168 CTTTGGGAGGCCAGTGCAGGAGG - Intronic
1164418469 19:28066417-28066439 CTAAGTGAGGACAGTGCTGTGGG + Intergenic
1165381411 19:35483798-35483820 CTTTGGGAGTCCAGTGCAGGCGG + Intergenic
1165540150 19:36486426-36486448 CTTTGGGAGGACAAGGCAGTTGG + Intronic
1165704746 19:37967493-37967515 CTTTGGGAGCACAAGGCAGGTGG - Intronic
1166120217 19:40681914-40681936 CTTTGGGAGGCCAGGGCAGTTGG - Intronic
925899536 2:8498731-8498753 CTGTGTGAGAACAGTGAGGTGGG + Intergenic
926391972 2:12402960-12402982 CTCTGTGAGGGCAGTGCAGGAGG + Intergenic
928033956 2:27804581-27804603 CTTTGTGCGAAAAGTGAAGTTGG + Intronic
930184321 2:48396497-48396519 CTTTGGGAGGACAGGGCAGGAGG - Intergenic
930186900 2:48420019-48420041 CTCGGTGAGCACAGGGCAGTGGG + Intergenic
931774433 2:65528288-65528310 CTGTGTGAGCAATGTGCAGCAGG + Intergenic
933633733 2:84683986-84684008 CTGTGTGAGAACTGTGCATTAGG - Intronic
934625745 2:95849301-95849323 CTTTGGGAGGCCAGTGCAGGTGG - Intronic
934770477 2:96904635-96904657 CTTTGGGAGGCCAGGGCAGTTGG - Intronic
934807826 2:97252017-97252039 CTTTGGGAGGCCAGTGCAGGTGG + Intronic
934829684 2:97505170-97505192 CTTTGGGAGGCCAGTGCAGGTGG - Exonic
935549164 2:104433399-104433421 TTTTCGGAGCACCGTGCAGTGGG + Intergenic
936677360 2:114730831-114730853 CTTTGTGAGGCCAAGGCAGTTGG - Intronic
936746510 2:115582865-115582887 TTTTGTCACCACATTGCAGTGGG + Intronic
936998855 2:118443195-118443217 GTCTGAGAGCACAGTGCAGATGG + Intergenic
937257714 2:120566613-120566635 CTTGGTGTCCACTGTGCAGTGGG - Intergenic
937936933 2:127253512-127253534 ATTTATAAGAACAGTGCAGTAGG - Intergenic
938298940 2:130196850-130196872 CTTCGAGAGCACAGAGCAGGTGG - Intronic
938331221 2:130449868-130449890 CTCTGTGAGGCCAGTGCAGAAGG + Intergenic
938358731 2:130671635-130671657 CTCTGTGAGGCCAGTGCAGAAGG - Intergenic
938457782 2:131477663-131477685 CTTCGAGAGCACAGAGCAGGTGG + Intronic
940444817 2:153765076-153765098 CTTTGTGAGGGCAGTGCAGAAGG + Intergenic
940667992 2:156632441-156632463 GTTTTAGAGCACTGTGCAGTTGG - Intergenic
940668629 2:156639950-156639972 ATTTGTGAGCGCAGTATAGTTGG - Intergenic
940792128 2:158040068-158040090 CTTTGTGGGCTGACTGCAGTGGG + Intronic
940876458 2:158902459-158902481 CTTTGGGAGGCCAGGGCAGTTGG + Intergenic
940895138 2:159074193-159074215 TCTGGTGACCACAGTGCAGTGGG + Intronic
944735256 2:202557085-202557107 CTTTGTGAGGCCAGGGCAGGTGG + Intronic
944928623 2:204492413-204492435 CTTGGAGAGAAAAGTGCAGTTGG - Intergenic
945105520 2:206309562-206309584 CTTTGTGAGCTTTCTGCAGTCGG - Exonic
945495014 2:210499262-210499284 CTCTGGGATCACGGTGCAGTGGG - Intronic
946832911 2:223743799-223743821 TTTTGGGGGCAGAGTGCAGTGGG - Intergenic
947953865 2:234171057-234171079 CTTTCTGAGAACAGCGCAGTGGG - Intergenic
948555020 2:238803628-238803650 CTTTATGAGCACAGCACAGTCGG + Intergenic
948930023 2:241126139-241126161 CTCCCAGAGCACAGTGCAGTGGG - Intronic
1169036155 20:2454057-2454079 TATTGTGCGCACAGAGCAGTGGG + Intergenic
1169606527 20:7326410-7326432 CTTTGTGAGGACAGGAAAGTAGG - Intergenic
1170498781 20:16953139-16953161 CTTTGAGATTACAATGCAGTTGG + Intergenic
1172088624 20:32410382-32410404 CTTTGGGAGACCAGTGCAGGAGG - Intronic
1172159305 20:32854591-32854613 CTTTGGGAGGCCAGTGCAGAAGG + Intergenic
1172384826 20:34526605-34526627 CTTTGTGAGGACACTGGAGGTGG - Intronic
1173349087 20:42227967-42227989 CTTTCTAACCACACTGCAGTAGG + Intronic
1174106636 20:48166842-48166864 CTTTGGGAGCAGATTTCAGTGGG + Intergenic
1174230357 20:49041095-49041117 CTTTGAGACCACACTGCAGTTGG - Intergenic
1175635978 20:60584070-60584092 CTTTATAAGCACAGTGAACTTGG + Intergenic
1175900134 20:62356749-62356771 CTTCCTGGGCACAGGGCAGTGGG + Intronic
1176126682 20:63478671-63478693 CCTTGTGCGCTCTGTGCAGTGGG - Intergenic
1178055998 21:28799030-28799052 TGTTGTGTGCACAGTGCAGTTGG - Intergenic
1178510685 21:33202565-33202587 TTTTGTGACCACAATGCAGAAGG - Intergenic
1178848679 21:36194960-36194982 CTTTGGGAGGCCAGTGCAGGTGG + Intronic
1178966506 21:37124358-37124380 CTTTGGGAGCCCAGGGCAGGTGG - Intronic
1179200554 21:39215748-39215770 CTTTGGGAGGACAGGGCAGGAGG + Intronic
1180786831 22:18552348-18552370 CTTTGTGTGCACACAGCACTGGG - Intergenic
1181234907 22:21442960-21442982 CTTTGTGTGCACACAGCACTGGG + Intronic
1181243742 22:21491869-21491891 CTTTGTGTGCACACAGCACTGGG - Intergenic
1182892835 22:33833078-33833100 CTTGGTGAGCACAGTGCTCTTGG - Intronic
1184338895 22:43874653-43874675 CTCTGCTAGGACAGTGCAGTAGG + Intergenic
949432159 3:3989399-3989421 CAATGTGAGCACAGTGCTATGGG + Intronic
949791736 3:7800211-7800233 CTTTGTGAGCACAGATCACAGGG - Intergenic
951563265 3:23988793-23988815 CTTTGTGAGCTCAGTACTGATGG + Intergenic
953409402 3:42681536-42681558 CTTTGGGAGGCCAGGGCAGTGGG - Intergenic
954014464 3:47674706-47674728 CTTTGGGAGGCCAGGGCAGTAGG - Intronic
955329783 3:58037614-58037636 ATTTGTGTGCACAGTGCTGTGGG - Intronic
956158307 3:66321401-66321423 CTCTGAGAGCCCAGTGCAGGAGG - Intronic
959095623 3:101952356-101952378 CTTTGGGAGGCCAGTGCAGGCGG + Intergenic
959452437 3:106520226-106520248 CTGTGTGAGTACACAGCAGTGGG + Intergenic
959783664 3:110267315-110267337 CTTTGTAAGTAGAGTCCAGTGGG + Intergenic
961494377 3:127280555-127280577 CCCAGTGAGCACACTGCAGTGGG - Intergenic
961572519 3:127810111-127810133 CTTTGTGCACTCAGTTCAGTTGG - Intronic
963153481 3:142071399-142071421 CTTTGAGAGACCAATGCAGTTGG - Intronic
965101921 3:164309550-164309572 CTCTGTTAGGACAGTGCAGAAGG - Intergenic
967002506 3:185349853-185349875 CTGTGTGCGTACACTGCAGTAGG + Intronic
970067547 4:12116209-12116231 CCCTGAGATCACAGTGCAGTGGG - Intergenic
972065254 4:34934813-34934835 CTTTGTGAGGCCAAGGCAGTTGG - Intergenic
972276446 4:37562556-37562578 CTGTTTGAGGACAGGGCAGTGGG + Intronic
972747442 4:41951260-41951282 CCTTTTGAGCACAGTTCAGGTGG + Intronic
972798684 4:42449077-42449099 CTTTGGGAGCCCAATGCAGGTGG - Intronic
973015418 4:45131232-45131254 CTTTGTGAGCACATGGCTATTGG + Intergenic
976408630 4:84687384-84687406 CTTTGGGAGGTCAGTGCAGGCGG - Intronic
976964918 4:91025686-91025708 CCTTCTTAGCTCAGTGCAGTGGG - Intronic
979353116 4:119669393-119669415 CTTTGTGAGGCCAATGCAGGTGG + Intergenic
980335571 4:131469074-131469096 CTTTGTTAGAGCAGTGCAGAAGG + Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
981795389 4:148589672-148589694 CTTTGCTAGGACAGTGCAGAAGG + Intergenic
981983206 4:150822521-150822543 CTTTGGGAGGACAATGCAGCAGG + Intronic
982056856 4:151559421-151559443 CTGAGTCAGCACAGGGCAGTGGG - Intronic
983247383 4:165303805-165303827 CTTTGGGAGGCCAGTGCGGTTGG - Intronic
983603237 4:169554172-169554194 CTTTGGGAGGCCAGTGCAGGAGG + Intronic
985248575 4:188000615-188000637 CTTTGTGAGCACAAGGCTGGCGG - Intronic
986006452 5:3672608-3672630 ATGTGTGAGCATAGTGCAGTGGG - Intergenic
990815852 5:59784085-59784107 CTTTGTGAGCTCAGACAAGTTGG - Intronic
991077278 5:62554956-62554978 CTTTGGGAGTCCAGTGCAGGTGG - Intronic
991957100 5:72005928-72005950 CTTGGTGATCCCTGTGCAGTGGG - Intergenic
992878882 5:81085376-81085398 CTTAGGGAGAATAGTGCAGTGGG + Intronic
993777007 5:92012305-92012327 CTCTGCTAGCACAGTGCAGAAGG + Intergenic
995402898 5:111761503-111761525 CTTTGTGGTCACAGTGCACCAGG + Intronic
997520072 5:134517586-134517608 ATTTGTGTGCATAGTGTAGTCGG + Intergenic
997791993 5:136769813-136769835 CTTTCAGAGCACAGTGTGGTGGG + Intergenic
998108857 5:139485973-139485995 CTTTGGGAGCTCAAGGCAGTAGG + Intergenic
999421113 5:151444726-151444748 CTTTGGGAGGCCAGGGCAGTGGG - Intronic
999946198 5:156598298-156598320 CTTTGGGAGCCCAGTGCAGGTGG + Intronic
1000000040 5:157129190-157129212 CTTTGGGAGGCCAGTGCAGGTGG + Intronic
1000301203 5:159957690-159957712 CTTTGGGAGGCCAGTGCAGGTGG + Intronic
1001555699 5:172635638-172635660 CTTATTGGGGACAGTGCAGTGGG + Intergenic
1002145279 5:177175380-177175402 CTCTGTGAGGCCAGTGCAGGAGG + Intronic
1003333916 6:5152849-5152871 GTTTGTCAGCACAGGGCAGTGGG - Intronic
1003768176 6:9264803-9264825 CTTTGTGAGGAAAATACAGTTGG - Intergenic
1004120891 6:12821216-12821238 CTTTGTGAGGTCAAGGCAGTTGG + Intronic
1004286225 6:14323079-14323101 CAATGTGAACACAGAGCAGTGGG + Intergenic
1004477847 6:15990371-15990393 GTGTGTGAGCACAGTGCAGCGGG + Intergenic
1004834586 6:19516405-19516427 CTCTGTTAGGACAGTGCAGAAGG + Intergenic
1006534605 6:34688159-34688181 CTTTGGGAGGCCAGTGCAGGTGG + Intronic
1006535042 6:34692205-34692227 CTTTGGGAGGCCAGGGCAGTAGG - Intronic
1006575370 6:35041394-35041416 CTTTGTGAGACCTTTGCAGTGGG - Intronic
1009203424 6:60773496-60773518 CTTTGGGAGGCCAGTGCAGGAGG + Intergenic
1013935388 6:115587538-115587560 CTCTGCTAGCACAGTGCAGAAGG + Intergenic
1014384285 6:120781311-120781333 CTTGGGGAGCACAATGAAGTAGG - Intergenic
1015061632 6:128973886-128973908 CTTTGTGGGGACAATGCTGTGGG + Intronic
1016969262 6:149747529-149747551 CTTTGGGAGGACAAGGCAGTTGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018012365 6:159683096-159683118 CTTTGGGAATACAGAGCAGTTGG + Intronic
1018250467 6:161864895-161864917 CTTTGTGAGGCCAGGGCAGGCGG - Intronic
1018281880 6:162195228-162195250 CTTTGAAAGCACAGTGGAGGAGG - Intronic
1018845272 6:167551567-167551589 CTTTGTGAACACAGGGCCCTTGG - Intergenic
1019463345 7:1172955-1172977 CTCTGTGAGCACCAGGCAGTGGG - Intergenic
1020633995 7:10674134-10674156 CTTTGTGACAACAGTCCAGTAGG - Intergenic
1021883760 7:25118558-25118580 CTTTGGGAGGACAGGGCAGATGG - Intergenic
1022477355 7:30720244-30720266 TTGTGTGAGCTCAGTGCTGTAGG + Intronic
1024134346 7:46391319-46391341 GCCTGTGAGCACAGTGCAGCTGG + Intergenic
1026473641 7:70715773-70715795 CTTTGGGAGGACAGGGCAGGTGG - Intronic
1026987824 7:74565724-74565746 CTTTGGGAGGCCAGTGCAGGAGG + Intronic
1028333133 7:89621814-89621836 CCCTGAGATCACAGTGCAGTGGG + Intergenic
1029533531 7:101141571-101141593 CTTTGTGATCACAGTACTTTGGG - Intergenic
1030777235 7:113549341-113549363 CTTTGTAATCATAGTCCAGTAGG + Intergenic
1032077599 7:128843429-128843451 CTTGGTCAGCACCGTGAAGTGGG - Exonic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1033137401 7:138796787-138796809 CCTTGAGAGCACAGTGCAGCAGG - Intronic
1034061646 7:148097181-148097203 CTTTATGAGTACAGGGCATTAGG + Intronic
1034113111 7:148557559-148557581 CTTTGAGATCATGGTGCAGTGGG - Intergenic
1034204243 7:149301927-149301949 CTATGAAATCACAGTGCAGTTGG + Intergenic
1035959552 8:4122222-4122244 TTTTGTGAGGGAAGTGCAGTTGG + Intronic
1037362926 8:18092793-18092815 CTTTGGGAGGCCAGTGCAGGTGG - Intergenic
1037888489 8:22607867-22607889 CTTTGAGAGGACAGTGCAGATGG - Intronic
1039515273 8:38127501-38127523 CTTTGGGAGGTCAGTGCAGGTGG + Intronic
1041730833 8:61061142-61061164 CTTTGTGATCACTGTGAAGCTGG - Intronic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1042989234 8:74620401-74620423 CTCTGTGAGGGCAGTGCAGAAGG - Intronic
1044416162 8:91942936-91942958 CTTTGGGAGGCCAATGCAGTTGG - Intergenic
1044713462 8:95078398-95078420 CTTTGTGAGGCCAGGGCAGGAGG + Intronic
1044985360 8:97752145-97752167 CTTTGGGAGTACAGCGCAGAAGG - Intergenic
1045422135 8:102026759-102026781 CTTTGTTAGGGCAGTGCAGAAGG - Intronic
1049398417 8:142412630-142412652 CTTCGTGGGGGCAGTGCAGTGGG - Intergenic
1050298867 9:4236103-4236125 CTGTGTGAGAACAGTGAACTTGG - Intronic
1051502922 9:17797573-17797595 CTTTGAGAGGCCAGTGCAGGTGG + Intergenic
1053455627 9:38231268-38231290 CTTTGGGAGCTCAATGCAGATGG - Intergenic
1055146380 9:72939759-72939781 CTTTGTGAGACCAAGGCAGTTGG - Intronic
1055642637 9:78332236-78332258 CTTTGGGAGCACAAGGCAGGTGG - Intergenic
1055923188 9:81483320-81483342 CTTTGGGAGGCCAGTGCAGGAGG - Intergenic
1056318949 9:85418657-85418679 CTTTCTGCTTACAGTGCAGTGGG - Intergenic
1056961738 9:91130998-91131020 CTTTGTCAGTGCAGTGCAGCAGG - Intergenic
1057416564 9:94868983-94869005 CTTTGGGAGGCCAGTGCAGGTGG + Intronic
1058464107 9:105211095-105211117 CTTTGGGAGGCCAGTGCCGTTGG + Intergenic
1058505097 9:105658954-105658976 CTTTGGGAGCCCAATGCAGGTGG + Intergenic
1059524495 9:114977905-114977927 CTTTGTAAGCACGAGGCAGTAGG - Intergenic
1059620050 9:115994096-115994118 GTGTTTGAGCACAGTGCACTTGG - Intergenic
1059935198 9:119303422-119303444 CCTGGCGAGCACGGTGCAGTAGG + Intronic
1060520852 9:124293109-124293131 CTTGGTGACCACAATGCAGCTGG - Intronic
1060622538 9:125081130-125081152 CTTTGTGAGCAGAGTGAAAATGG + Intronic
1061384510 9:130280860-130280882 CTTTGGGAGCCCAATGCAGGCGG + Intergenic
1061567657 9:131454241-131454263 CTGTGTGAACACAGTGTGGTAGG - Intronic
1062397398 9:136357991-136358013 CTGGGTGGACACAGTGCAGTTGG - Intronic
1186939349 X:14488209-14488231 TATTGTGAGCACAGTGCCTTTGG + Intergenic
1187171675 X:16858118-16858140 TTTTGTAAGCCCAGAGCAGTGGG + Intronic
1189367401 X:40399424-40399446 CATTGTGAGGTCTGTGCAGTGGG + Intergenic
1189804473 X:44721500-44721522 CTTTGGGAGCCCAAGGCAGTTGG + Intergenic
1190166510 X:48077296-48077318 CTTTGGGAGCCCAGGGCAGGAGG + Intergenic
1190271156 X:48864876-48864898 CTTTGGGAGGCCAGTGCAGGCGG - Intergenic
1190722136 X:53158284-53158306 CTTTGAAAGGACAGGGCAGTGGG - Intergenic
1191680058 X:63831494-63831516 CTTTGTTAGGGCAGTGCAGAAGG + Intergenic
1191843816 X:65531702-65531724 CTTTGGGAGCCCAGGGCAGGTGG + Intronic
1192222059 X:69203975-69203997 CATTTTGAACACAGTCCAGTTGG - Intergenic
1192349548 X:70345885-70345907 CAATGTAAGCAAAGTGCAGTGGG + Intronic
1193662488 X:84274232-84274254 CTCTGCTAGCACAGTGCAGAAGG - Intergenic
1193904121 X:87222428-87222450 TTTTGTGAGCACAGAGATGTGGG - Intergenic
1195028993 X:100908358-100908380 CTTTGGGAGGCCAGTGCAGGTGG - Intergenic
1196327778 X:114428537-114428559 CTTTGTGAGGACAAGGCAGGAGG + Intergenic
1199560838 X:149160993-149161015 TTTTGTGAGCACACAGTAGTGGG + Intergenic
1199780659 X:151056004-151056026 CTTTGGGAGGACAGAGCAGGAGG - Intergenic
1200059683 X:153478732-153478754 ATCTGTGGGCACAGTGCAGGCGG - Intronic
1200209869 X:154342425-154342447 CTTTCGCAGCACAGTGGAGTGGG - Intergenic
1200220983 X:154389667-154389689 CTTTCGCAGCACAGTGGAGTGGG + Intergenic
1201604952 Y:15773981-15774003 CTCTGTGAGCACAGTGTTGGGGG + Intergenic
1201610375 Y:15836226-15836248 CTTTGTGCCCATAGAGCAGTGGG - Intergenic