ID: 917931373

View in Genome Browser
Species Human (GRCh38)
Location 1:179824892-179824914
Sequence CAGAGTTAAGAGAAGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917931373_917931379 -2 Left 917931373 1:179824892-179824914 CCCCCGCCCTTCTCTTAACTCTG No data
Right 917931379 1:179824913-179824935 TGCCTCCCTCCCACCCTGCCTGG No data
917931373_917931392 23 Left 917931373 1:179824892-179824914 CCCCCGCCCTTCTCTTAACTCTG No data
Right 917931392 1:179824938-179824960 CCTCATGTCCCCATCAGAGGAGG No data
917931373_917931388 20 Left 917931373 1:179824892-179824914 CCCCCGCCCTTCTCTTAACTCTG No data
Right 917931388 1:179824935-179824957 GCCCCTCATGTCCCCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917931373 Original CRISPR CAGAGTTAAGAGAAGGGCGG GGG (reversed) Intergenic
No off target data available for this crispr