ID: 917932671

View in Genome Browser
Species Human (GRCh38)
Location 1:179834137-179834159
Sequence CCTTGTTTCCAGAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917932668_917932671 -4 Left 917932668 1:179834118-179834140 CCAAAGATGAATAAAGATTCCTT No data
Right 917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG No data
917932666_917932671 26 Left 917932666 1:179834088-179834110 CCGCGAGGGTCCTCAGTGAATTG No data
Right 917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG No data
917932667_917932671 16 Left 917932667 1:179834098-179834120 CCTCAGTGAATTGAGTCGTTCCA No data
Right 917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917932671 Original CRISPR CCTTGTTTCCAGAAAATGGA AGG Intergenic
No off target data available for this crispr