ID: 917942917

View in Genome Browser
Species Human (GRCh38)
Location 1:179941144-179941166
Sequence ATGTATATACAAATAGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917942914_917942917 28 Left 917942914 1:179941093-179941115 CCTGGGTGACAGAGCGAGACTCC 0: 11541
1: 62730
2: 109154
3: 137807
4: 133923
Right 917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG No data
917942916_917942917 7 Left 917942916 1:179941114-179941136 CCGTCTCAAAAAAAAGGAATGAA No data
Right 917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917942917 Original CRISPR ATGTATATACAAATAGACTA TGG Intergenic
No off target data available for this crispr