ID: 917943410

View in Genome Browser
Species Human (GRCh38)
Location 1:179945956-179945978
Sequence CTATCGAAGGTGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917943404_917943410 1 Left 917943404 1:179945932-179945954 CCACTCATGCCTATAATTCTAGC No data
Right 917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG No data
917943405_917943410 -8 Left 917943405 1:179945941-179945963 CCTATAATTCTAGCACTATCGAA No data
Right 917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917943410 Original CRISPR CTATCGAAGGTGGAGGTGGA AGG Intergenic
No off target data available for this crispr