ID: 917943587

View in Genome Browser
Species Human (GRCh38)
Location 1:179947439-179947461
Sequence CCTACCCTGCCCAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917943579_917943587 22 Left 917943579 1:179947394-179947416 CCTGTCTGGAGTATATCCGTTTC No data
Right 917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG No data
917943578_917943587 27 Left 917943578 1:179947389-179947411 CCTTTCCTGTCTGGAGTATATCC No data
Right 917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG No data
917943581_917943587 6 Left 917943581 1:179947410-179947432 CCGTTTCCTCAGGTTTGCTAATT No data
Right 917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG No data
917943582_917943587 0 Left 917943582 1:179947416-179947438 CCTCAGGTTTGCTAATTATTATT No data
Right 917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917943587 Original CRISPR CCTACCCTGCCCAGGGTGGA AGG Intergenic
No off target data available for this crispr