ID: 917948702

View in Genome Browser
Species Human (GRCh38)
Location 1:180005474-180005496
Sequence CTCGATCTAGGTGGTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917948702_917948707 0 Left 917948702 1:180005474-180005496 CCATTACCACCACCTAGATCGAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 917948707 1:180005497-180005519 GCCACCATCAGTTTCCTATCTGG 0: 1
1: 0
2: 1
3: 5
4: 90
917948702_917948710 10 Left 917948702 1:180005474-180005496 CCATTACCACCACCTAGATCGAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 917948710 1:180005507-180005529 GTTTCCTATCTGGATTATTCTGG 0: 1
1: 0
2: 2
3: 13
4: 179
917948702_917948712 25 Left 917948702 1:180005474-180005496 CCATTACCACCACCTAGATCGAG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 917948712 1:180005522-180005544 TATTCTGGTAGTCTCCTCACTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917948702 Original CRISPR CTCGATCTAGGTGGTGGTAA TGG (reversed) Intronic
900734345 1:4286333-4286355 CTCCATCCATGTTGTGGTAAAGG + Intergenic
905119945 1:35673917-35673939 CTGGAAATAGATGGTGGTAATGG + Intergenic
905408766 1:37754130-37754152 CCTGATCCAGGTGGTGGTGAGGG - Intronic
906595722 1:47074973-47074995 CTTGATCTTGATGGTGGTGATGG + Intronic
906813979 1:48858739-48858761 CTGGAACTAGGTAGTGGTAATGG + Intronic
908012150 1:59789660-59789682 CTAGAATTAGGTAGTGGTAATGG - Intergenic
909896609 1:81078497-81078519 CTGGATATGGATGGTGGTAATGG + Intergenic
915481754 1:156191268-156191290 CTAGAACTAGGTAGTGGTGATGG - Intergenic
917859514 1:179132863-179132885 CTCCATCTCGGTGGTGGGAGAGG - Intronic
917948702 1:180005474-180005496 CTCGATCTAGGTGGTGGTAATGG - Intronic
918077006 1:181178093-181178115 CTGGAACTAGGTAGTGGTGATGG + Intergenic
922487948 1:225990445-225990467 CTCTATCTAGATTGTGGTGATGG + Intronic
924423421 1:243930456-243930478 CTAGATCTAGATGGTGTTCAAGG + Intergenic
924809017 1:247384713-247384735 CTCTATCTAAGTGGTGGGCAAGG - Intergenic
1064796662 10:19019742-19019764 CTCGTTCTAGATGGTGGGATGGG + Intergenic
1066227933 10:33402894-33402916 CTTCATCCCGGTGGTGGTAATGG + Intergenic
1071069946 10:81680340-81680362 CTCTGTCTAGGCGGTGGTCAAGG - Intergenic
1072175798 10:92920487-92920509 CTGGAATTAGGTAGTGGTAATGG - Intronic
1072282048 10:93874932-93874954 CTGGAACTAGATAGTGGTAATGG + Intergenic
1072500883 10:96016615-96016637 CTCAATAAAGGTGGTGGTGATGG + Intronic
1072712726 10:97727791-97727813 CTCGAATTAGATGGTGGTGATGG - Intergenic
1073828040 10:107348365-107348387 CTAGAGCTAGATGGTGGTTATGG + Intergenic
1074538815 10:114347901-114347923 CTGGAACTAGATAGTGGTAATGG - Intronic
1075029509 10:119012693-119012715 CTAAAACTAGGTGGTGGTGATGG - Intergenic
1076996361 11:299240-299262 CTCCATCAAGGTGGGGGGAAGGG - Intronic
1077272494 11:1687939-1687961 CTACATCCAGGTCGTGGTAAGGG + Intergenic
1079938927 11:26653427-26653449 CTTGAGCTAGGTGGTGGCAGTGG - Intronic
1080040614 11:27755860-27755882 CTGGAGATAGATGGTGGTAATGG - Intergenic
1083704886 11:64507247-64507269 CTGGAGCTGGGTGGTGGCAATGG - Intergenic
1084479506 11:69410549-69410571 CTCTGTCTAGGTGGTGGTCCAGG + Intergenic
1086312300 11:85548831-85548853 CTCGAGCTTGGTGGGGGGAAGGG - Intronic
1088668297 11:112116901-112116923 CTGGAGCTGGATGGTGGTAATGG - Intronic
1091574938 12:1724551-1724573 CTAGAGCTAGATGGTTGTAAGGG + Intronic
1095606681 12:44076050-44076072 GTTCATTTAGGTGGTGGTAACGG - Intronic
1097277252 12:57821959-57821981 CTGGATCTAGGGTGTGGCAATGG + Exonic
1098697070 12:73572694-73572716 CTCGAGCTTGGTGGTGGGAGAGG + Intergenic
1098833622 12:75393320-75393342 TTGGAGATAGGTGGTGGTAATGG - Intronic
1099522517 12:83681837-83681859 CTCGAGCTTGGTGGGGGGAAGGG + Intergenic
1101435669 12:104662012-104662034 CTCCATCTGGGTGGAGGTGAAGG + Intronic
1103416260 12:120743327-120743349 CTGGAACTAGATGGTGGCAATGG - Intergenic
1104649118 12:130518549-130518571 CTGGCTCTAGGTGGAGGTGATGG - Intronic
1106030830 13:26000953-26000975 CTGGAACTAGGTAGTGGTAATGG - Intronic
1112734613 13:102402126-102402148 CTCAATCTCGGAGGTGGTATTGG - Intergenic
1114006897 14:18323672-18323694 CTGGAAATAGATGGTGGTAAAGG + Intergenic
1115123764 14:29969473-29969495 CTGAATGTAGCTGGTGGTAAAGG + Intronic
1116052097 14:39816672-39816694 CTGTATCTTGGTGGTGGTAGTGG - Intergenic
1116526085 14:45907344-45907366 CTCTATCTTGATGGTGATAATGG - Intergenic
1117656125 14:57958562-57958584 CTAGAATTAGGTGGTGGTGATGG + Intronic
1119634923 14:76266139-76266161 CTAGAACTAGATGGTGGCAAGGG + Intergenic
1121056274 14:90856748-90856770 CTGGAATTAGGTAGTGGTAATGG - Exonic
1126226209 15:46273010-46273032 CTATATATAGGTGGTGGGAAGGG + Intergenic
1126554089 15:49966419-49966441 CTCGAACTTGGTGGTGGGAGGGG + Intronic
1127903358 15:63357750-63357772 CTGGATCTAAGTAGGGGTAATGG - Intronic
1128830185 15:70762224-70762246 CTCGATATAGGTGGAGAGAAAGG + Intronic
1132472971 16:117039-117061 CTGGATCTAGATAGTGGTGATGG + Intronic
1133728187 16:8556417-8556439 CTAGAACTAGATGGTGGCAATGG + Intergenic
1135265359 16:21020813-21020835 CTGGATATAGATGGTGGTGATGG - Intronic
1137440252 16:48492308-48492330 CTAGAACTAGGCGGTAGTAATGG + Intergenic
1138885601 16:61074244-61074266 CTAGAACTAGGTAGTGGTGATGG - Intergenic
1144565506 17:16355725-16355747 CTTGATCTGGGTGGTAGTTATGG + Intergenic
1145122226 17:20270175-20270197 CTGGAACTAGGTAGTGGTGATGG + Intronic
1145725402 17:27116597-27116619 CTAGAAATAGGTGGTGGTAAAGG - Intergenic
1146322070 17:31854884-31854906 CTGGAACTAGGTAGTGGTGATGG + Intronic
1148891035 17:50807240-50807262 CTGGAACTAGGTAGTGGTGATGG + Intergenic
1149402651 17:56313848-56313870 CTTGATTTAGGTGTTGGTTAGGG - Intronic
1150148991 17:62793789-62793811 GTCGATGGAGGTGGTGGTAATGG - Intronic
1150570576 17:66382845-66382867 CTCTTTCTTGTTGGTGGTAATGG - Intronic
1157301593 18:46483598-46483620 CTCCATCTCGGTGATGGTGATGG + Exonic
1163361297 19:16847833-16847855 CTGGAACTAGGTAGTGGTGAAGG - Intronic
926316421 2:11713692-11713714 CTGGAATTAGGTGGTGGTAATGG - Intronic
927292366 2:21417239-21417261 CTTGTTGTTGGTGGTGGTAAGGG + Intergenic
931050111 2:58403788-58403810 ATAGATCCATGTGGTGGTAATGG + Intergenic
933081143 2:77988293-77988315 CTGGATGTAGGTGGTGGGAGAGG + Intergenic
933792871 2:85897060-85897082 ATCAATCAAGGTGGTGGTCAGGG + Intergenic
939656771 2:144835981-144836003 CTCAATCAAGTTGGTGATAATGG - Intergenic
942732596 2:179076202-179076224 CTCGAGCTTGGTGGGGGGAAAGG + Intergenic
943473671 2:188328084-188328106 CTAGATCAAAGTGGTGGTGATGG - Intronic
1170015534 20:11777305-11777327 CTGGAATTAGGTAGTGGTAATGG + Intergenic
1173017870 20:39243361-39243383 CACTATCTTGGTTGTGGTAATGG + Intergenic
1178960873 21:37063798-37063820 CTTGATCTGGGTGGTGGTTATGG - Exonic
1180431404 22:15254482-15254504 CTGGAAATAGATGGTGGTAAAGG + Intergenic
1180884299 22:19229485-19229507 CTGGAACTATGTAGTGGTAATGG + Intronic
1182094226 22:27615197-27615219 CTCGATTTAGGTTGTGGTCCAGG + Intergenic
1184526790 22:45028752-45028774 CTGGCTCTAGGTGTTGGTTATGG + Intergenic
951819657 3:26794078-26794100 CTGGATCTAGGGGGAGGTGAAGG - Intergenic
952473941 3:33685906-33685928 CTGGAGCTAGATGGTGGTGATGG + Intronic
955414288 3:58678438-58678460 CTCGAGCTTGGTGGGGGGAAGGG - Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957925078 3:86798887-86798909 CTGGATGTAGGGGGTGCTAAAGG - Intergenic
959628572 3:108482056-108482078 CTCGGGCTAGGTGGTGGCAGTGG + Intronic
962815179 3:138991161-138991183 CTGGAATTAGATGGTGGTAATGG - Intergenic
963993137 3:151676607-151676629 CTCTGTCTAGGTGGTGGGCAAGG + Intergenic
968555917 4:1246395-1246417 CTCCATCCAGGTGGTGCTGACGG - Intronic
969204266 4:5630893-5630915 CTTGCTCTAGCTGATGGTAAGGG - Intronic
976006806 4:80439850-80439872 CTCGAGCTTGGTGGGGGGAAGGG + Intronic
978676565 4:111325883-111325905 CTGGAGCTAGTTGGTGGAAAAGG - Intergenic
979133212 4:117075247-117075269 CTGGGTGAAGGTGGTGGTAATGG - Intergenic
979568892 4:122192318-122192340 CTGGATATAGTTTGTGGTAAAGG + Exonic
983900348 4:173126958-173126980 CTAAATCAAGGTGGTGGCAAGGG + Intergenic
984926501 4:184811717-184811739 CTGGAACTAGATGGTGGTAATGG + Intronic
986447274 5:7832339-7832361 CAGGATCTGGGTGGTGGGAAGGG - Intronic
988533733 5:32048019-32048041 CTTGATCTAGGTTTTGGTTATGG + Intronic
990695112 5:58407797-58407819 CTAGACCAGGGTGGTGGTAATGG - Intergenic
991147450 5:63323525-63323547 TGCCATCCAGGTGGTGGTAAGGG - Intergenic
993960955 5:94296247-94296269 CTCGAGCTTGGTGGTGGGAGGGG - Intronic
996129947 5:119769827-119769849 CTCGAGCTTGGTGGTGGGAGGGG + Intergenic
996582636 5:125048519-125048541 CTCAGTAAAGGTGGTGGTAAAGG - Intergenic
997962535 5:138333354-138333376 CAGGATCTTGGTGGTGGTAGTGG + Intronic
1001849970 5:174955284-174955306 CTGGAACTGGGTGGTGGTTATGG - Intergenic
1003090868 6:3101871-3101893 CTAGATATAGATAGTGGTAATGG - Intronic
1003320782 6:5049254-5049276 CTCAATTTGGGTGGTGGTAGGGG - Intergenic
1003456029 6:6283005-6283027 CTCGATTAAGGTGGTGGCACAGG - Intronic
1005650300 6:27879433-27879455 CTGGATCTAGGGTGTGGCAATGG + Intergenic
1006084557 6:31586885-31586907 ATGGTTCTAGGTGCTGGTAAGGG - Intronic
1006340387 6:33443438-33443460 CTCCACCTCGGTGGTGGTGATGG - Exonic
1006681450 6:35799560-35799582 CTCTATCTAGGTAGTGGGCAAGG - Intergenic
1015883276 6:137891234-137891256 CTCGAGCTTGGTGGTGGGGAGGG - Intergenic
1018359783 6:163055769-163055791 CTGGAACTAGATGGTGGTCATGG - Intronic
1018532075 6:164776091-164776113 CTTGATCTAAGAGGTGGTACTGG + Intergenic
1019091100 6:169534713-169534735 CTCTATAAAGTTGGTGGTAATGG + Intronic
1020391405 7:7662151-7662173 CTCGAGCTTGGTGGGGGGAAGGG - Intronic
1021904868 7:25323114-25323136 CTGGATCTAGATAGTGGTAATGG + Intergenic
1021975054 7:26003831-26003853 CTGGAGCTAGATGGTGGTGATGG + Intergenic
1022916794 7:34963995-34964017 CTGGAAATAGGTGGTGGTGATGG + Intronic
1027410170 7:77907962-77907984 CTCTTTCTAGGTGGTGGCTAAGG + Intronic
1031397733 7:121293347-121293369 CTCGAGCTTGGTGGGGGTAGGGG - Intronic
1032261293 7:130339141-130339163 CTGGAGATGGGTGGTGGTAATGG - Intergenic
1032985132 7:137329318-137329340 CTAGAACTAGTTGGTGATAAGGG + Intronic
1033265163 7:139879201-139879223 CTCGATGATGGTGGTGGTGATGG - Intronic
1034097686 7:148425007-148425029 CTCAAGCTTGGTGGTGGGAAGGG + Intergenic
1035576332 8:709025-709047 CTGGAATTAGATGGTGGTAATGG + Intronic
1036596376 8:10216502-10216524 CTGGAGCTAGATGGTGGTGATGG - Intronic
1039718519 8:40136966-40136988 CTGGATAGAGGTGGGGGTAAGGG - Intergenic
1042836144 8:73080697-73080719 CTCAATCAAGCTGGTGATAAAGG - Intronic
1044529164 8:93288735-93288757 CTAGAACTAGATGGTGGTGATGG + Intergenic
1046067975 8:109218851-109218873 CTCGAGCTTGGTGGGGGGAAGGG - Intergenic
1046840559 8:118851576-118851598 CTAGAACTAGGTAGTGGTGATGG + Intergenic
1046947467 8:119987859-119987881 CTCGAGCTTGGTGGGGGGAAGGG - Intronic
1051405971 9:16737876-16737898 CTCCATCTAGTTGGTGGTCCTGG + Intronic
1051583052 9:18697617-18697639 CTATATTAAGGTGGTGGTAATGG + Intronic
1052583271 9:30389905-30389927 CTCGATCTGGGTGATGGCAGTGG - Intergenic
1056288761 9:85119464-85119486 CTAGAACTAGGTTGTGGTAATGG + Intergenic
1057974681 9:99592426-99592448 CTGGAACTAGATAGTGGTAATGG + Intergenic
1185815619 X:3152330-3152352 CTGGAACTAGGTAGAGGTAATGG + Intergenic
1185895075 X:3850920-3850942 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1185900193 X:3889345-3889367 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1185905309 X:3927776-3927798 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1187909491 X:24097826-24097848 CTGGAATTAGATGGTGGTAATGG - Intergenic
1188130011 X:26419606-26419628 CTCGAGCTTGGTGGGGGTAGGGG - Intergenic
1191941853 X:66489512-66489534 CTCGAGCTTGGTGGGGGGAAGGG + Intergenic
1195065758 X:101236864-101236886 CTTGGCCTAGGTGGTGGTGAGGG + Intronic
1195344950 X:103940500-103940522 CTCGATCTTGGTGGGGGGAGAGG - Intronic
1196411454 X:115424389-115424411 CTCGGTCTTGATGGTGGCAATGG + Intergenic
1196703582 X:118697458-118697480 CTCCATCCAGGTAGGGGTAATGG + Intergenic
1198186612 X:134259580-134259602 CTTGATCAAGGCGGTGGGAATGG - Intergenic
1199818727 X:151423640-151423662 CTCTGTATAGGTGGTGATAATGG + Intergenic
1200314256 X:155115289-155115311 TTCCATCTAGGTTGTGGTATGGG + Intronic