ID: 917951354

View in Genome Browser
Species Human (GRCh38)
Location 1:180040211-180040233
Sequence ACCCTCTACCAGGCAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917951354_917951362 22 Left 917951354 1:180040211-180040233 CCAGATGTTGCCTGGTAGAGGGT 0: 1
1: 0
2: 1
3: 5
4: 97
Right 917951362 1:180040256-180040278 TGTTGATAGTCATTTTATTGAGG 0: 1
1: 0
2: 3
3: 36
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917951354 Original CRISPR ACCCTCTACCAGGCAACATC TGG (reversed) Intronic
900805161 1:4762879-4762901 ACCCTCTACCAAGAAACTTGGGG + Intronic
904301532 1:29557580-29557602 ACCTTCTACCAGGAAACCTCTGG - Intergenic
908216431 1:61958702-61958724 TCCCTCTACCAGGTAACCCCTGG - Intronic
910253292 1:85220744-85220766 CATCTCTACCAGCCAACATCTGG - Intergenic
913507914 1:119535172-119535194 TTCTTCTACCAGGAAACATCGGG - Intergenic
915366517 1:155319922-155319944 ACCCTCTCTCAGGCACCTTCAGG - Exonic
917951354 1:180040211-180040233 ACCCTCTACCAGGCAACATCTGG - Intronic
920569867 1:207008519-207008541 TCCCTCTCCCAGGCAACACAAGG + Intronic
923273991 1:232380833-232380855 AGCATCTCCCAGGCAACTTCTGG - Intergenic
1062956440 10:1543229-1543251 CTCCTCTACCAGGCCTCATCTGG + Intronic
1063886722 10:10587414-10587436 AACCTCTGCCAGACAACTTCAGG + Intergenic
1067662088 10:48243759-48243781 ACCCTCTCCAATTCAACATCCGG - Intronic
1069420096 10:68239344-68239366 GCCCTGTGCCAGGCAACATCAGG + Intergenic
1069834423 10:71299604-71299626 ACCCTCAGCCCGGCAACTTCTGG + Exonic
1074987103 10:118668430-118668452 GCCCTCAGCCAGGGAACATCAGG + Intergenic
1076078401 10:127555994-127556016 ACCCTCTACCGTCCAACACCAGG + Intergenic
1076264035 10:129094944-129094966 AGCCTCTTCCAGGAAGCATCAGG + Intergenic
1084287884 11:68143435-68143457 ACTCTCTAACAGCCAAGATCAGG + Intergenic
1088006279 11:104944915-104944937 ACCATGTACCAGACAACACCTGG + Intronic
1089023656 11:115244670-115244692 ACTCTTTACCAGCCAGCATCAGG + Intronic
1089472924 11:118735326-118735348 ACCTTATACCAGGGAAGATCTGG + Intergenic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1096842494 12:54388350-54388372 ACCCTCAACCAGGCCACATCTGG + Intronic
1103090660 12:118095812-118095834 ATCCTGTACAAGGCAAGATCAGG + Exonic
1103104996 12:118216291-118216313 ATCCTCTACCAGGAAATACCTGG - Intronic
1103279275 12:119741928-119741950 ACTTTCTACCAGGCAAAATTTGG - Intronic
1104079124 12:125414974-125414996 ACATTGTACCAGGCAGCATCTGG + Intronic
1104400521 12:128472373-128472395 ACCCTCTTCCATGCAAGATTGGG + Intronic
1104849293 12:131863573-131863595 TCCCTCGCCCAGGCAACCTCTGG - Intergenic
1106117364 13:26829350-26829372 ACTCTCTACCTGGCGAGATCAGG - Intergenic
1115343494 14:32317711-32317733 AGTCTCTCCCAGGCACCATCTGG + Intergenic
1115646604 14:35372453-35372475 ACCCTCCAGCAGGCAGCAACAGG - Intergenic
1116405945 14:44566805-44566827 ACCCTCCAACAGGCAAAATATGG + Intergenic
1121323957 14:93009033-93009055 TCCCTCCACCAGGGAACATCTGG + Intronic
1121850944 14:97220567-97220589 CCCCTCTGCCAGGCACCAACAGG - Intergenic
1129271985 15:74423814-74423836 ACCCTCTTCCTGGCCATATCAGG - Intronic
1131007185 15:88987603-88987625 TGCCTCTCCCAGGCAACCTCAGG + Intergenic
1132237111 15:100230378-100230400 ACTCTGTACCAGCCAGCATCTGG - Intronic
1133363962 16:5196381-5196403 ACCTCCTTCAAGGCAACATCCGG - Intergenic
1133970163 16:10561661-10561683 AACAACTACAAGGCAACATCAGG - Intronic
1136055557 16:27686196-27686218 ACTCTCCTCAAGGCAACATCTGG + Intronic
1139430890 16:66910529-66910551 ACCCTCCCCCTGGCAACACCTGG - Intronic
1141886559 16:86896261-86896283 GCCCTCTACCTGGCCTCATCTGG - Intergenic
1142182341 16:88677383-88677405 GCCCTCTACCCGGCACCAGCTGG + Intergenic
1143664123 17:8346542-8346564 ACCCTCCACCATGTAACAGCAGG + Intergenic
1145234756 17:21200653-21200675 ACACTGTACCAGGCAACACAAGG + Intronic
1149141557 17:53437941-53437963 TCCCTCTGCCAGCCAGCATCAGG + Intergenic
1154993141 18:21615097-21615119 AGCCTTTCCCAGGCAACCTCTGG + Intronic
1160918480 19:1508622-1508644 CCCCTCTACCAAGCTTCATCAGG + Intronic
1166583114 19:43920520-43920542 CCCCCCCACCCGGCAACATCTGG - Intronic
925883272 2:8370432-8370454 GCCCTCTCCCAGGGGACATCGGG - Intergenic
929582656 2:43092743-43092765 TCCCTCTACAAGGCAGCCTCAGG + Intergenic
936922135 2:117699687-117699709 ACCCTCTACCAAACAACAGAAGG - Intergenic
937453660 2:122023178-122023200 ACCCTCTACAATGCATCAGCTGG - Intergenic
938791001 2:134675925-134675947 TCCCTCCACCAGGAAGCATCTGG - Intronic
939789478 2:146553708-146553730 AACCTCTATCAGGGAACTTCAGG - Intergenic
940898023 2:159099702-159099724 ACCATCTTCCAGGTGACATCTGG + Intronic
943082599 2:183273722-183273744 ACACTCTAGCAGGAAACAACTGG - Intergenic
943853874 2:192763408-192763430 ACCCTCTACAAGGTAACTACTGG - Intergenic
1174279695 20:49430204-49430226 ACCCAATGGCAGGCAACATCAGG - Intronic
1178354046 21:31895769-31895791 ACCCTCTACCAGGGGTGATCAGG - Intronic
1179525358 21:41972610-41972632 TCCCTTTATCAGCCAACATCTGG - Intergenic
1182474002 22:30566012-30566034 AGCCTCTCCCAGGGAACAGCAGG + Intronic
1184371185 22:44083087-44083109 AGCCTCTACGTGGCCACATCAGG + Intronic
954444102 3:50537395-50537417 ACCCTGTGCCAGGCAGCACCTGG + Intergenic
956298629 3:67743490-67743512 ACCTTCTCACAGGCAACATATGG + Intergenic
957335933 3:78829564-78829586 CCCCTCCACCATGCAACATGAGG + Intronic
968283326 3:197493431-197493453 ACCCTCCACCAGGAAACATGAGG + Intergenic
969671580 4:8592950-8592972 ACCCTCCACCCTGCAACCTCTGG + Intronic
971310546 4:25522336-25522358 CCCATCCACCAGGCAACATGAGG - Intergenic
975115229 4:70672870-70672892 ACTCTCTCCAAGGCAACATGGGG + Intronic
975877736 4:78864186-78864208 ACCAGCAACAAGGCAACATCAGG + Intronic
980510452 4:133779757-133779779 ACCCCCTGCTAGGGAACATCTGG + Intergenic
981670108 4:147277025-147277047 AGCCTCCACCAGACAACACCAGG - Intergenic
982116830 4:152105075-152105097 ACCCTCCAAGAGGTAACATCAGG - Intergenic
984074363 4:175156673-175156695 ATTCTCTAGCAGGCAACAACTGG + Intergenic
985166170 4:187097073-187097095 AGCCTCTACCAGCCATGATCCGG + Intergenic
986305023 5:6508316-6508338 AACTTCTACCAGGGAACATGGGG - Intergenic
987387189 5:17341270-17341292 TCCTTCTCCCAGGCAACCTCTGG - Intergenic
988388541 5:30597982-30598004 ACCCCCTTCCAGGAAACAACTGG + Intergenic
996606199 5:125326412-125326434 ACCCTCTTCCAGGCAAGGTTAGG + Intergenic
1004856302 6:19754048-19754070 ACCTTCTGACAGGCACCATCTGG - Intergenic
1009045992 6:58237913-58237935 ACCCTTCCCCAGGCACCATCTGG + Intergenic
1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG + Intergenic
1009697791 6:67131977-67131999 AGGCTCTGCCAGGCAAAATCAGG - Intergenic
1012189572 6:96262695-96262717 AACTACTACCAGGAAACATCAGG + Intergenic
1013350135 6:109298212-109298234 ACCCTGTGCCAGGAAACATTGGG - Intergenic
1013663443 6:112322619-112322641 GCCCTCTATCAGCCAACAGCTGG + Intergenic
1014098967 6:117488695-117488717 ACCCTTTTACAGGCAACAGCAGG + Intronic
1017908149 6:158770884-158770906 TCCCTGCACCAGGCAACAGCTGG - Exonic
1019313526 7:374312-374334 TCCCTCTTCCAGGGAACAGCGGG + Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1024527117 7:50358150-50358172 ACCATTTACCAGGAAATATCTGG - Intronic
1024717213 7:52093045-52093067 ACCCTCTCCCAGACAGCACCTGG - Intergenic
1024791359 7:52968198-52968220 AGCCTTTACCAGGGAACTTCAGG + Intergenic
1030553605 7:110995719-110995741 ACCCTGGACCAGGGAAAATCAGG + Intronic
1033922161 7:146407585-146407607 AACCTCTTCCAGGAAACTTCTGG + Intronic
1041999017 8:64099954-64099976 ACCCTCTAAAAGGCACCCTCTGG + Intergenic
1043350698 8:79357445-79357467 ACCCTCTACCGAGCAAGAACTGG + Intergenic
1044360884 8:91282362-91282384 AACCCCTCCCAGGCAACAGCAGG + Intronic
1047347994 8:124047148-124047170 ACACTCTACTAGGAAAAATCAGG + Intronic
1050376961 9:4984390-4984412 ACCCTCTCCCGGGCTACACCAGG + Intergenic
1057931498 9:99197468-99197490 ACCCTCTAGCAGGTGACATTGGG - Intergenic
1195471351 X:105233984-105234006 ACCTTATACCACACAACATCAGG - Exonic