ID: 917952387

View in Genome Browser
Species Human (GRCh38)
Location 1:180053062-180053084
Sequence AATCTGCGGTGACTCTCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917952387_917952390 -2 Left 917952387 1:180053062-180053084 CCTTCAGAGAGTCACCGCAGATT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 917952390 1:180053083-180053105 TTTAACATGGAAAAGAGAAGAGG 0: 1
1: 0
2: 5
3: 67
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917952387 Original CRISPR AATCTGCGGTGACTCTCTGA AGG (reversed) Exonic
904277880 1:29396033-29396055 GTACTGGGGTGACTCTCTGAGGG + Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
907353890 1:53856290-53856312 ATGCTGCTCTGACTCTCTGAAGG + Intronic
916707423 1:167365839-167365861 TATCTGTGGTGGCTATCTGATGG + Intronic
917952387 1:180053062-180053084 AATCTGCGGTGACTCTCTGAAGG - Exonic
918895010 1:190331125-190331147 AATGTGAGATGACTCTCTAATGG - Intronic
921176288 1:212597666-212597688 AACCTGAGGTCCCTCTCTGAGGG - Intronic
922194911 1:223351544-223351566 AACCTCCTGTGACTCTCAGATGG - Intronic
1076070321 10:127483498-127483520 TGTCTGCGATGACTATCTGAAGG - Intergenic
1083510943 11:63209077-63209099 AATGTGGGGTGGCCCTCTGAAGG + Intronic
1086230170 11:84559012-84559034 AATCTGTCATGACTCTCTGTTGG - Intronic
1086482033 11:87251714-87251736 AAGCTGCTGTGACTCACTGATGG + Intronic
1094809837 12:34126184-34126206 AATGTGGGGTGGCCCTCTGAAGG - Intergenic
1097035483 12:56120976-56120998 TATCTGCCGTGACTTTCTCAAGG + Exonic
1103998406 12:124844628-124844650 CATCCCCGGTGACTCTCTGCGGG - Intronic
1107139504 13:36982167-36982189 AAACAGCTTTGACTCTCTGAAGG + Intronic
1115584314 14:34794821-34794843 AATCTTTGGTGATGCTCTGATGG - Exonic
1117057619 14:51929111-51929133 AATTTGAAGTGACTCTCTAATGG + Intronic
1120317144 14:82909307-82909329 AATTTGTAGTGACACTCTGAGGG - Intergenic
1121767132 14:96497662-96497684 CATGTGCTGGGACTCTCTGAAGG + Intergenic
1129960568 15:79680912-79680934 ATGCTGCAGTGACTCACTGAGGG - Intergenic
1133547077 16:6817922-6817944 AATCTACTGTGTCTCTCTGTTGG + Intronic
1138556798 16:57775615-57775637 AAGCTGCGGTGAGTGTGTGAAGG - Intronic
1138773968 16:59697955-59697977 AGTCTTCGGTGAATATCTGAAGG + Intergenic
1140991477 16:80216885-80216907 AATCTATGGTAACTCTCTGCTGG - Intergenic
1144799839 17:17918582-17918604 AGTCTGAGGTGACTTTCTCAGGG - Intronic
1147482764 17:40782518-40782540 TTTCTGCGGTGATGCTCTGATGG + Exonic
1148404747 17:47401022-47401044 AATCTGTGTTCTCTCTCTGATGG - Intronic
1149556647 17:57578183-57578205 AATCTGAGTTGATTCTCTGCTGG + Intronic
1151767630 17:76140395-76140417 TGTCTGCGGGGACTCTCCGAGGG + Exonic
1157608369 18:48940316-48940338 AAGAAGCAGTGACTCTCTGAAGG - Intronic
1158627130 18:59081229-59081251 AATCTTAGTTGCCTCTCTGAAGG + Intergenic
1165710098 19:38004960-38004982 AACATGCGGTGACTCTCTCTGGG - Intronic
927119548 2:19943741-19943763 CATCTCCAGTGACCCTCTGAAGG - Intronic
927334918 2:21910842-21910864 AATCTGTGATGACTTTCTGTTGG - Intergenic
929871370 2:45761959-45761981 GATCTGCAGTAACTCCCTGATGG - Intronic
935796344 2:106644905-106644927 AATTTGCTGTGACCCTCTGTGGG + Intergenic
936486649 2:112931476-112931498 ACTCTGGGGTGGCTCTGTGATGG + Intergenic
943267217 2:185748202-185748224 AATGAGCAGTGAGTCTCTGATGG - Intronic
945726244 2:213474889-213474911 AATCTGGGGTGTGTCTGTGAGGG - Intronic
946522572 2:220482598-220482620 AATCTGCGATGAGTTTGTGAAGG - Intergenic
1173711439 20:45159502-45159524 AATCTGCTGTTAGTCTATGAGGG - Intergenic
1177850031 21:26334762-26334784 AATCTGCTGAGAGACTCTGATGG - Intergenic
1183355402 22:37356186-37356208 AATGTGGGGTGCTTCTCTGAAGG + Intergenic
954191873 3:48968702-48968724 TAACTGTGGTGACCCTCTGATGG - Intronic
954472184 3:50707585-50707607 AAACTGCGGTGAGTCTTTGGTGG + Intronic
954976577 3:54700945-54700967 AATATGCTGGGACTCTCAGAGGG - Intronic
960984332 3:123263983-123264005 AAGCTGCGGTGAGGCTGTGATGG - Intronic
969327476 4:6452236-6452258 AACCTGCGGTGTCACCCTGAAGG - Intronic
969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG + Intronic
974195532 4:58569896-58569918 AAAATGTGGGGACTCTCTGAAGG - Intergenic
975006916 4:69301578-69301600 AATGTGAGATGACTCTCTAATGG - Intronic
978965500 4:114735788-114735810 AATTGGCTGAGACTCTCTGAAGG + Intergenic
983942325 4:173548094-173548116 TTCCTGCAGTGACTCTCTGAGGG - Intergenic
986783357 5:11086818-11086840 AAACTGAGGTGATTCTGTGAAGG + Intronic
987048317 5:14127734-14127756 AATCTGGGGAGAATCTCTCATGG - Intergenic
998277280 5:140768808-140768830 AAGCTGGGGTGACACTCTGTGGG - Intergenic
999787273 5:154902777-154902799 AATATGCAGTCATTCTCTGATGG + Intronic
1000029554 5:157390159-157390181 AATCTGTCTTGACTCTCTAAAGG - Intronic
1000552533 5:162684790-162684812 AATATACTGTGACTCTCTGTTGG - Intergenic
1001436856 5:171705860-171705882 AATCTGAGGAGAATCTCTGCTGG - Intergenic
1003734045 6:8857684-8857706 AATCTGGGATGGCTTTCTGATGG + Intergenic
1007676223 6:43597511-43597533 AAGCTGCGGGAACACTCTGAAGG + Intronic
1011198462 6:84807392-84807414 AATTTGAGGGGACTCTTTGATGG + Intergenic
1011553109 6:88547940-88547962 CATCTGAGGTGGATCTCTGATGG - Intergenic
1019013663 6:168863598-168863620 AATTTGCATTGATTCTCTGAAGG + Intergenic
1020091358 7:5344063-5344085 ATTCTGCGTTGACTGTCTGAAGG - Intronic
1025969551 7:66309502-66309524 AACCTGCTGTGACCCTCAGAGGG - Intronic
1033154694 7:138946902-138946924 AAGCTGCAGTGAGTCTCAGAGGG - Intronic
1033492647 7:141859406-141859428 AATCTGCCTTGACTACCTGAAGG - Intergenic
1034593021 7:152159869-152159891 ATTCTGCATTGAATCTCTGACGG + Intronic
1035681545 8:1492459-1492481 ACTCTGCACTGACTCTCAGAGGG + Intergenic
1037462668 8:19128541-19128563 ACTCTGAGGTCACTCTCTCAAGG + Intergenic
1037918771 8:22789465-22789487 TATCAGCGGGGTCTCTCTGAGGG - Intronic
1041880520 8:62744767-62744789 CATTTGCAGTTACTCTCTGAAGG - Intronic
1048590408 8:135815836-135815858 ATTCTGCAGTGATCCTCTGAGGG + Intergenic
1052118222 9:24675350-24675372 AATCTCCGGTGTATCTGTGAGGG - Intergenic
1053717680 9:40913245-40913267 AATCTGCTATGATTGTCTGAAGG + Intergenic
1059102240 9:111483002-111483024 AATAGGCGGTGACCCTCAGATGG - Intronic
1185515863 X:698683-698705 AAGCAGCCGTCACTCTCTGAAGG + Intergenic
1187060907 X:15786410-15786432 AATCTGCTGTGCCCCTTTGAGGG - Exonic
1189471179 X:41315384-41315406 AATCTGAGGTGACCCTCTACTGG - Intergenic
1190774050 X:53538439-53538461 ACAGTGCGGTGAGTCTCTGAGGG + Exonic
1196868078 X:120087288-120087310 AATGTGGGGTGGCCCTCTGAAGG - Intergenic
1201277579 Y:12313314-12313336 AATGTGGGGTGGCCCTCTGAAGG + Intergenic