ID: 917954053

View in Genome Browser
Species Human (GRCh38)
Location 1:180074288-180074310
Sequence TATCTTAGGCCCAGAGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917954053_917954058 6 Left 917954053 1:180074288-180074310 CCTAACCCTCTGGGCCTAAGATA 0: 1
1: 0
2: 0
3: 30
4: 348
Right 917954058 1:180074317-180074339 GCTATTTAAGTTCAGAAATCAGG 0: 1
1: 0
2: 2
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917954053 Original CRISPR TATCTTAGGCCCAGAGGGTT AGG (reversed) Intronic
903443105 1:23402972-23402994 TCTCTTAGGCCCAGAGAGTGGGG - Intronic
903788003 1:25874413-25874435 TCTCTTAGGCCCAGAGAGGTTGG + Intergenic
906833466 1:49059146-49059168 TATCACAGGCCCAGAGGCCTAGG + Intronic
907584940 1:55608582-55608604 CATCACAGGCCCAGAGGCTTAGG - Intergenic
907642619 1:56206453-56206475 TAGCTCAGGCCCAGAGGCTTGGG - Intergenic
907862945 1:58371642-58371664 TATCACAGGCCCAGAGGCATAGG + Intronic
908896488 1:68906656-68906678 TATATCAGGCCCAGAGAGATGGG - Intergenic
909024540 1:70467727-70467749 AATATGAAGCCCAGAGGGTTTGG + Intergenic
909104480 1:71391798-71391820 TATCACAGGCCCAGAGGCTTAGG + Intergenic
909186332 1:72491212-72491234 AAACTTATGCCCAGAGGGGTGGG + Intergenic
909416834 1:75416142-75416164 TATCACAGGCCCAGAGGCCTAGG + Intronic
909715972 1:78706521-78706543 TAGCTCAGGCCCAGAGGGCCGGG - Intergenic
909891816 1:81016715-81016737 TATCTTAGGGATAGAGGTTTGGG - Intergenic
910327494 1:86027351-86027373 TATCACAGGCCCAGAGGCCTAGG + Intronic
911407814 1:97464461-97464483 TATCACAGGCTCAGAGGTTTAGG + Intronic
911907499 1:103588559-103588581 TATCACAGGCCCAGAGGCCTGGG - Intergenic
913364327 1:118018948-118018970 TTTCTTGGGCCCAGGAGGTTAGG + Intronic
915719609 1:157974833-157974855 TGTCTCAAGCCCAGAGGGTGAGG - Intergenic
917954053 1:180074288-180074310 TATCTTAGGCCCAGAGGGTTAGG - Intronic
919254668 1:195105538-195105560 CATCATAGGCCCAGAGGCCTAGG - Intergenic
920123265 1:203674439-203674461 TCCCTTAGGCCCAGAGCCTTGGG - Intronic
921005547 1:211089844-211089866 CATGTTAGTCCCAGAGGTTTGGG - Intronic
921452421 1:215324200-215324222 CATCACAGGCCCAGAGGCTTAGG - Intergenic
922706656 1:227793989-227794011 TCTCTTGGCCCCAGAGGGCTGGG - Intergenic
923377658 1:233380467-233380489 CATCTGAGGGACAGAGGGTTAGG + Intronic
924040473 1:239979635-239979657 CATCACAGGCCCAGAGGCTTGGG + Intergenic
924291649 1:242542720-242542742 TCTCTTAAGCCCAGATGTTTTGG + Intergenic
924394708 1:243606758-243606780 CATCATAGGCCCAGAGGCCTAGG + Intronic
1062881372 10:980717-980739 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1065251684 10:23821892-23821914 TGGCTTAGGCCCCAAGGGTTTGG - Intronic
1068221505 10:54051798-54051820 CATCATAGGCCCAGAGGACTAGG + Intronic
1068399347 10:56508678-56508700 TATCACAGGCCCAGAGACTTAGG + Intergenic
1068755615 10:60649095-60649117 TGTCTTGGGAACAGAGGGTTAGG - Intronic
1068820853 10:61376637-61376659 TACCTGGAGCCCAGAGGGTTTGG - Intergenic
1068973708 10:62985785-62985807 TATCTTAGGAGAAGAAGGTTCGG + Intergenic
1073147428 10:101289974-101289996 TATTTTAAGTCCAGAGAGTTAGG - Intergenic
1077841717 11:5982699-5982721 TATGTGGAGCCCAGAGGGTTTGG - Intergenic
1078450691 11:11438349-11438371 TCTCTTAGCCCCAGAGGCTATGG - Intronic
1079224374 11:18592597-18592619 TGTCTTAGCCCCAGAGTGTTGGG - Intergenic
1079445925 11:20556001-20556023 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1084252582 11:67911789-67911811 CATCAAAGGCCCAGAGGGCTAGG - Intergenic
1084777408 11:71386775-71386797 GATCTGAGGCCCCTAGGGTTGGG + Intergenic
1085890567 11:80573721-80573743 TATCATAGGCCCAGAGGCCCAGG - Intergenic
1085941872 11:81214338-81214360 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1086424491 11:86671005-86671027 TATCTTTGGTTCAGAGGATTGGG - Intronic
1087255079 11:95944687-95944709 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1087570469 11:99920923-99920945 TATATGAGGCCTTGAGGGTTGGG + Intronic
1088101935 11:106165538-106165560 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1089746135 11:120618568-120618590 CATCGTAGGCCCAGAGGCCTAGG + Intronic
1090316765 11:125797825-125797847 CATCACAGGCCCAGAGGCTTAGG - Intergenic
1091982770 12:4879709-4879731 CATCACAGGCCCAGAGGCTTAGG - Intergenic
1092652179 12:10646720-10646742 GATCACAGGCCCAGAGGTTTAGG + Intronic
1092665488 12:10791948-10791970 CATCTCAGGCCCAGAGGCCTAGG - Intergenic
1093570671 12:20662929-20662951 TATCATAGACCCAGAGGCCTAGG + Intronic
1093692616 12:22125170-22125192 CATCACAGGCCCAGAGGCTTAGG + Intronic
1095092734 12:38121943-38121965 TCTCTTGAGCCCAGAGAGTTAGG - Intergenic
1095222887 12:39638817-39638839 TTTCTTAGGCACATAGGGATGGG + Intronic
1095728018 12:45473851-45473873 CATCTTAGGCCCTGAGGCTTAGG + Intergenic
1095928860 12:47606103-47606125 CATCACAGGCCCAGAGGCTTAGG - Intergenic
1096155825 12:49341067-49341089 TATGTGAGGCCAAAAGGGTTGGG + Intergenic
1098630879 12:72720518-72720540 CATCACAGGCCCAGAGGTTTAGG + Intergenic
1099899995 12:88695749-88695771 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1099996652 12:89786329-89786351 CATCACAGGCCCAGAGGCTTAGG + Intergenic
1101186997 12:102290659-102290681 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1104153071 12:126103983-126104005 CATCTTGGGGCCAGTGGGTTGGG + Intergenic
1106942749 13:34795779-34795801 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1107708275 13:43128183-43128205 TATCTTGGGCCAAGAGGGAGCGG - Intergenic
1108872658 13:55005628-55005650 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1109070722 13:57763743-57763765 TGTCTGTGGCCCAGAGGGTTGGG - Intergenic
1109250404 13:60012754-60012776 TAGGTTAGGGCCAGAGGGTTTGG - Intronic
1109667627 13:65559399-65559421 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1110492339 13:76124403-76124425 TATCTCAGGCCCAGAGGCCTAGG + Intergenic
1111050860 13:82882305-82882327 TATCATAGTCCCAGAGGCCTAGG + Intergenic
1111103051 13:83611991-83612013 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1111239622 13:85457501-85457523 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1111339231 13:86862362-86862384 TACCATAGGCCCAGAGTCTTAGG + Intergenic
1111753102 13:92358842-92358864 CATCACAGGCCCAGAGGCTTAGG - Intronic
1112055232 13:95684673-95684695 TATCATAGGCCCAGAGACCTAGG + Intronic
1112769653 13:102781752-102781774 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1112909495 13:104463638-104463660 CATCATAGGCACAGAGGCTTAGG - Intergenic
1112918344 13:104578683-104578705 TATCTTAGGCGCAGTGGCTCGGG + Intergenic
1113501917 13:110782399-110782421 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1113529625 13:111012873-111012895 CTTCTTAGGCTCACAGGGTTGGG + Intergenic
1114573922 14:23695410-23695432 CATCATTGGCCCAGAGGCTTGGG - Intergenic
1115010264 14:28537431-28537453 TACATTGAGCCCAGAGGGTTTGG - Intergenic
1115051897 14:29072826-29072848 CATCACAGGCCCAGAGGCTTAGG - Intergenic
1116079757 14:40156837-40156859 CATCATAGGCCCAGAGGTTTAGG - Intergenic
1116122385 14:40737230-40737252 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1116272152 14:42786046-42786068 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1117668587 14:58082365-58082387 TATCTTTGGCCTTGAAGGTTAGG - Intronic
1118431939 14:65727602-65727624 CATCAGAGGCCCAGAGGTTTAGG - Intronic
1120136769 14:80878697-80878719 TAGCTCAGGCCCAGGGGGTTGGG - Intronic
1120434266 14:84460516-84460538 TATCTCAGGCAAATAGGGTTGGG - Intergenic
1120485921 14:85113020-85113042 CATCACAGGCCCAGAGGGCTAGG - Intergenic
1121483871 14:94298581-94298603 CATCATAGGCCCAGAGGTCTAGG - Intergenic
1124888634 15:33710914-33710936 CATCATAGGCCCAGAGGCTTAGG - Intronic
1126185122 15:45823985-45824007 TATCACAGGCCCAAAGGTTTAGG - Intergenic
1128034693 15:64514545-64514567 TTTCTTAGGCCCAGTGCCTTTGG + Intronic
1128576002 15:68775632-68775654 TACCTAAGACCCAGAGGGATGGG + Intergenic
1128718659 15:69929127-69929149 CATCATAGGTCCAGAGGTTTAGG - Intergenic
1129137259 15:73565620-73565642 TATCTTTTGGCCTGAGGGTTTGG - Intronic
1129473664 15:75768783-75768805 CATCTTGGCCCCAGTGGGTTGGG - Intergenic
1129573486 15:76715526-76715548 TATCTTGGGCCCTGTGGGGTAGG - Intronic
1129758300 15:78111883-78111905 CAACTTAAGCCCTGAGGGTTGGG + Intronic
1131273767 15:90963278-90963300 TATCATAGGAACAGAAGGTTAGG - Intergenic
1132210665 15:100019974-100019996 AATCTTAGGACAAGAGGCTTGGG - Intronic
1133300489 16:4779502-4779524 AAACTGAGGCCCAGAGGGTCCGG + Intronic
1134332019 16:13259836-13259858 TATCACAGGCCCAGAGGCCTGGG - Intergenic
1136290579 16:29269047-29269069 ATTCTTAGGCCCTGGGGGTTAGG + Intergenic
1138976549 16:62214590-62214612 TGTTTTTGGCCCAGAGGATTTGG - Intergenic
1139113451 16:63919955-63919977 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1141443240 16:84042634-84042656 TTTCTTGGGGCCAGAGGGGTGGG + Intronic
1142096459 16:88242567-88242589 ATTCTTAGGCCCTGGGGGTTAGG + Intergenic
1144774902 17:17780507-17780529 TGTCCTAGGCCCTGAGGGGTGGG - Intronic
1146537453 17:33665397-33665419 TATCGTTGGCACAGAGGGTAGGG + Intronic
1146691423 17:34878811-34878833 TATTTTAAGCCCTGAGGGATGGG + Intergenic
1149135515 17:53359324-53359346 CATCATAGAACCAGAGGGTTAGG + Intergenic
1149667914 17:58378872-58378894 TATCATAGGCCCTTAGTGTTTGG + Intronic
1149902325 17:60491955-60491977 TATCACAGGCCCAGAGGCCTAGG + Intronic
1150740072 17:67772286-67772308 AATCTTAGGCCCAGAGGAAATGG + Intergenic
1150830942 17:68518629-68518651 CATCATAGGCCCAGAGGCCTAGG - Intronic
1153111214 18:1590079-1590101 TATCTTTGGCCCCTAGGCTTAGG - Intergenic
1153650813 18:7238221-7238243 TCTCTGAGGCCCAGAGAGGTGGG - Intergenic
1156258438 18:35422239-35422261 CAGCTCAGGCCCAGAGGGCTGGG + Intergenic
1156974521 18:43202725-43202747 TATCTGAGGCCTATAGGCTTAGG + Intergenic
1158129693 18:54139365-54139387 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1159461233 18:68724237-68724259 TATCAGAGGCCCAGAGGCCTAGG - Intronic
1159643167 18:70887595-70887617 CATCATAGGCCCAGAGGTCTAGG + Intergenic
1159863808 18:73681499-73681521 TGTCTTAGGCCCAGAATGTTTGG - Intergenic
1162609922 19:11741312-11741334 TATCTTCGTGACAGAGGGTTGGG - Intergenic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
1166409999 19:42550379-42550401 CATCACAGGCCCAGAGGCTTAGG + Intronic
925332939 2:3072791-3072813 TCTCTTTGGCCCCCAGGGTTGGG - Intergenic
925498593 2:4479830-4479852 CATCATAGGCCCAGAGGCCTAGG - Intergenic
929381943 2:41364466-41364488 GATATGAAGCCCAGAGGGTTTGG + Intergenic
930438451 2:51376947-51376969 TATCACAGGCCCAGAGGCCTAGG + Intergenic
931734623 2:65182622-65182644 CATCACAGGCCCAGAGGTTTAGG + Intergenic
932518893 2:72386463-72386485 CATCACAGGCCCAGAGGTTTAGG + Intronic
932915661 2:75855643-75855665 TATCATATGCCCAGAGGCCTAGG + Intergenic
933070855 2:77856878-77856900 CATCACAGGCCCAGAGGGCTAGG + Intergenic
933268181 2:80204123-80204145 CATCACAGGCCCAGAGGTTTAGG - Intronic
935324554 2:101924692-101924714 CATCATAGGCCCAGAGGCCTAGG + Intergenic
935948911 2:108311631-108311653 CATCATAGGCCCAGAGGCCTAGG + Intergenic
936549753 2:113427122-113427144 CATCACAGGCCCAGAGGTTTAGG + Intergenic
936800341 2:116258136-116258158 GATCATAGGCCCAGAGGCCTAGG - Intergenic
939682718 2:145158475-145158497 TAACTTAGTCTCAGAGGGCTGGG - Intergenic
940621691 2:156121484-156121506 TATCACAGGCCCAGAGGCCTAGG + Intergenic
941578701 2:167268398-167268420 TATCACAGGCCCAGAGGCCTAGG + Intergenic
941590607 2:167416183-167416205 CATCACAGGCCCAGAGGCTTAGG + Intergenic
941682671 2:168415363-168415385 CATCACAGGCCCAGAGGTTTAGG - Intergenic
942298208 2:174537442-174537464 TAAGTTAGTCCCAGAGGGATTGG - Intergenic
942419932 2:175797229-175797251 CATCGCAGGCCCAGAGGTTTAGG + Intergenic
942924993 2:181420899-181420921 TTTCTGAGGAACAGAGGGTTGGG - Intergenic
943208540 2:184931604-184931626 TGTCACAGGCCCAGAGGATTGGG - Intronic
944160370 2:196653050-196653072 TATCACAGGCCCAGAGGCCTAGG - Intronic
945730219 2:213524039-213524061 CATCTCAGGCCCAGAGACTTAGG + Intronic
946575606 2:221071993-221072015 CATCATAGGCCCAGAGGCCTAGG - Intergenic
947139817 2:227010459-227010481 GATCCTGGGCCCAAAGGGTTTGG - Exonic
948895627 2:240925608-240925630 TCAGTTAGGCCCAGAGGGTTTGG + Intronic
1169676388 20:8159416-8159438 CATCATAGGCCCAGAGGCCTAGG - Intronic
1170499673 20:16961487-16961509 CATCACAGGCCCAGAGGCTTAGG - Intergenic
1170939432 20:20836160-20836182 TATCTTAGTGCCAGAGGGGAAGG + Intergenic
1173740792 20:45400504-45400526 CATCATAGGCCCAGAGGCCTAGG + Intronic
1174736070 20:52967223-52967245 GATCTTAGGCTCAGAAGCTTGGG - Intergenic
1175159904 20:57000491-57000513 GACCTGAAGCCCAGAGGGTTGGG + Intergenic
1176872490 21:14094991-14095013 TCTCTTGAGCCCAGAGAGTTAGG + Intergenic
1177258261 21:18693395-18693417 GATCACAGGCCCAGAGGCTTAGG - Intergenic
1177555433 21:22681972-22681994 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1177599186 21:23288920-23288942 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1178154248 21:29832716-29832738 TGTCACAGGCCCAGAGGGCTGGG - Intronic
1178389596 21:32187459-32187481 CATCTTGGGTCCAGAGGGATGGG + Intergenic
1178604548 21:34024542-34024564 TATCCTAGGCGCAGAGGATGCGG - Intergenic
1182080946 22:27528288-27528310 TGTCCTAGGCCCTGAGAGTTGGG + Intergenic
1183044454 22:35208469-35208491 TATCTCAGGCCCAGAATGCTAGG - Intergenic
1183682956 22:39344825-39344847 AATCTTAGGGGCAGAGGGTTAGG + Intergenic
1184199451 22:42956581-42956603 TATCCTAGGCCCTTAGAGTTTGG - Intronic
950244737 3:11405837-11405859 TGTCTTAAGCCCAGAAGTTTAGG - Intronic
951324531 3:21286328-21286350 CATCATAGGCCCAGAGGCCTAGG + Intergenic
953184929 3:40629156-40629178 TATCACAGGCCCAGAGGCCTAGG + Intergenic
953202136 3:40787232-40787254 CATCATAGGCCCAGAGGCTTAGG + Intergenic
953446587 3:42973949-42973971 CATCACAGGCCCAGAGGCTTAGG + Intronic
953530666 3:43737105-43737127 TATCCTATTCCCAGAGGGTGAGG + Intergenic
956272955 3:67467344-67467366 TTTCTTAAGCTCAAAGGGTTTGG + Intronic
956275218 3:67492218-67492240 TATCTTTGGCCAACAGAGTTGGG + Intronic
956681202 3:71783646-71783668 GATCTTGGGCTCAGAGGATTAGG + Intronic
957113132 3:75992240-75992262 CATCACAGGCCCAGAGGTTTAGG + Intronic
958175260 3:89989324-89989346 TATCACAGGCCCAGAGGCTTAGG + Intergenic
959769169 3:110072187-110072209 TATCACAGGCCCAGAGGCCTAGG + Intergenic
960015711 3:112885456-112885478 TGTGTGAAGCCCAGAGGGTTTGG - Intergenic
960130181 3:114047577-114047599 TCGCTTGAGCCCAGAGGGTTGGG + Intronic
961999243 3:131277790-131277812 AATCTGAGGCCCAAAGAGTTTGG - Intronic
962655811 3:137542906-137542928 TATGTGGAGCCCAGAGGGTTTGG - Intergenic
963404461 3:144844429-144844451 TATCACAGGCCCAGAGGCCTAGG - Intergenic
964279906 3:155052668-155052690 TATCACAGGCCCAGAGGCCTAGG - Intronic
964849854 3:161083678-161083700 TAGCCTAGGCCCACAGGGTCAGG + Intergenic
965348297 3:167579560-167579582 ATTCTTAGGGTCAGAGGGTTTGG - Intronic
965386849 3:168056051-168056073 TATCACAGGCCCAGAGGCCTAGG + Intronic
965662087 3:171052691-171052713 TATCACAGGCCCAGAGATTTAGG + Intergenic
965865919 3:173203668-173203690 CATCACAGGCCCAGAGGCTTAGG - Intergenic
966153557 3:176892180-176892202 CATCACAGGCCCAGAGGTTTAGG + Intergenic
966164812 3:177005900-177005922 CATCATAGGCCCTGAGGGCTAGG + Intergenic
966320897 3:178699787-178699809 GATGTGAAGCCCAGAGGGTTTGG - Intronic
967303166 3:188036781-188036803 TACCTAGGGCTCAGAGGGTTGGG + Intergenic
971248850 4:24954723-24954745 TATCACAGGCCCAGAGTGCTAGG - Intronic
971545502 4:27880269-27880291 TATCACAGGCCCAGAGGCCTAGG - Intergenic
972051716 4:34743271-34743293 CATCACAGGCCCAGAGGCTTAGG - Intergenic
972102934 4:35445487-35445509 TATCACAGGCCCAGAGGTCTAGG + Intergenic
973032343 4:45360455-45360477 TATCACAGGCCCAGAGGCCTAGG + Intergenic
973756962 4:54084436-54084458 TATATTAGGCCCATATTGTTTGG + Intronic
974101455 4:57422175-57422197 TGTCTCAGGCCCAGAGGCCTAGG + Intergenic
974492844 4:62588909-62588931 TATCACAGGCCCAGAGGCCTAGG - Intergenic
974555870 4:63446405-63446427 AATCAAAGGCCCAGAGGTTTAGG - Intergenic
975204098 4:71624296-71624318 CATCTCAGGCCCAGAGGCCTTGG - Intergenic
976141934 4:82002144-82002166 CATCATAGGCCCAGAGGTCTTGG + Intronic
976442227 4:85088947-85088969 TATCACAGGCCCAGAGGCCTAGG + Intergenic
976453492 4:85219216-85219238 CATCACAGGCCCAGAGGCTTAGG + Intergenic
976674789 4:87692238-87692260 CATCATAGGCCCAGAGGCCTAGG + Intergenic
977383522 4:96308313-96308335 CATCAAAGGCCCAGAGGTTTAGG + Intergenic
977395800 4:96469001-96469023 CATCATAGGCCCAGAGGTTTAGG - Intergenic
978932513 4:114332313-114332335 AATCTCAGGCTCAGAGGGCTGGG + Intergenic
979177100 4:117679062-117679084 CATCACAGGCCCAGAGGGCTAGG + Intergenic
980084507 4:128377475-128377497 CATCACAGGCCCAGAGGCTTAGG - Intergenic
980247519 4:130266976-130266998 CATCATAGGCCCAGAGGCCTAGG + Intergenic
980299105 4:130965096-130965118 CATCACAGGCCCAGAGGTTTAGG + Intergenic
980707654 4:136520298-136520320 CATCATAGGCCCAGAGGCCTAGG - Intergenic
980791890 4:137631628-137631650 TGTGTGAAGCCCAGAGGGTTTGG + Intergenic
981240081 4:142466741-142466763 CATCATAGGCCCAGAGGCCTAGG + Intronic
983020505 4:162670200-162670222 CATCATAGGCCCAGAGGCCTAGG - Intergenic
983089564 4:163487506-163487528 CATCACAGGCCCAGAGGGTGAGG - Intergenic
983437188 4:167730929-167730951 TATCACAGGCCCAGAGGCCTAGG + Intergenic
983713919 4:170754344-170754366 TATCACAGGCCCAGAGGCCTAGG + Intergenic
984623311 4:181977635-181977657 TATCTTAGACCCAGGGGTCTAGG - Intergenic
985852906 5:2401883-2401905 CATCATAGGCCCAGAGGCCTGGG + Intergenic
985919862 5:2961880-2961902 TATCTTAGGTCCAGATGCTTGGG + Intergenic
986014632 5:3747397-3747419 TATCATAGGTCCAGAGGCCTAGG + Intergenic
986081150 5:4395321-4395343 CATCATAGGCCCAGAGGCCTAGG - Intergenic
986533160 5:8760300-8760322 CATCACAGGCCCAGAGGCTTAGG + Intergenic
986754706 5:10824324-10824346 GATGTGGGGCCCAGAGGGTTTGG - Intergenic
986975358 5:13387776-13387798 CATCACAGGCCCAGAGGGATAGG + Intergenic
987459998 5:18197911-18197933 CATCACAGGCCCAGAGGCTTAGG + Intergenic
987689201 5:21245200-21245222 CATCTCAGGCCCAGAGGCCTAGG + Intergenic
987826341 5:23034907-23034929 CATCATAGGCCCAGAGGCCTAGG - Intergenic
989229121 5:39066382-39066404 CATCATAGGCCCAGAGGCCTAGG - Intronic
990264506 5:54061092-54061114 TATCACAGGCCCAGAGGTCTAGG + Intronic
992271042 5:75063136-75063158 TATGTTAGGGCCAGATAGTTAGG + Intergenic
993344737 5:86769013-86769035 CATCATAGGCCCAGAGGACTAGG - Intergenic
993517486 5:88856542-88856564 TATCACAGGCCCAGAGGCCTAGG + Intronic
993711610 5:91230608-91230630 TATCATAGGCCCGCAGGCTTCGG - Intergenic
995009347 5:107240298-107240320 CATCATAGGCCCAGAGGCCTAGG + Intergenic
995132712 5:108647466-108647488 TATCACAGGCCCAGAGGCCTAGG + Intergenic
995220333 5:109641138-109641160 CATCATAGGCCCAGAGGCCTAGG + Intergenic
995702783 5:114955025-114955047 TATCACAGGCCCAGAGGCTTAGG + Intergenic
996027049 5:118657815-118657837 TATCACAGGCCCAGAGGCCTAGG - Intergenic
996611188 5:125382419-125382441 TATCACAGGCCCAGAGTGCTAGG + Intergenic
996636095 5:125691880-125691902 CATCAAAGGCCCAGAGGTTTAGG + Intergenic
996911339 5:128660458-128660480 CATCATAGGCCCAGAGGGCTAGG + Intronic
998487644 5:142517153-142517175 TATCACAGGCCCAGAGGCCTAGG + Intergenic
999906114 5:156143022-156143044 CATCACAGGCCCAGAGGCTTAGG + Intronic
1000515419 5:162232605-162232627 CATCACAGGCCCAGAGGTTTAGG + Intergenic
1000526882 5:162369338-162369360 TATCAAAGGCCCAGAGGCCTTGG - Intergenic
1000977299 5:167779249-167779271 TATTTTAGGCCTAGTGTGTTGGG + Intronic
1002128521 5:177064876-177064898 CACCTAAGGCCCAGAGGGGTTGG - Exonic
1003979503 6:11376849-11376871 CATCAAAGGCCCAGAGGCTTAGG + Intronic
1004592067 6:17061413-17061435 AATCTTAGTCTCAGTGGGTTTGG - Intergenic
1007196556 6:40066540-40066562 CATCATAGGCCCAGAGGCCTGGG + Intergenic
1007623092 6:43226696-43226718 CATCCTAGGCCCAGAAGGTAGGG + Intronic
1007813407 6:44502765-44502787 TATTTTATGCCCAGAGCTTTGGG + Intergenic
1008681504 6:53877304-53877326 TATCACAGGCCCAGAGGCCTAGG - Intronic
1010473799 6:76262390-76262412 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1010655581 6:78507532-78507554 CATCACAGGCCCAGAGGATTAGG + Intergenic
1010879887 6:81154091-81154113 TATCACAGCCCCAGAGGTTTAGG - Intergenic
1010909588 6:81536798-81536820 TATCATAGGCCCAGAGGCATAGG - Intronic
1011355133 6:86466108-86466130 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1011784185 6:90826147-90826169 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1011845694 6:91560703-91560725 TATCACAGGCCCAGAGGCCTTGG - Intergenic
1012562080 6:100595031-100595053 TATCAGAGGCCATGAGGGTTGGG + Intronic
1012756620 6:103240230-103240252 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1012807679 6:103915711-103915733 CATCTAGGGCCCAGAGTGTTTGG + Intergenic
1014475996 6:121872587-121872609 TATCTCAGGCCCAGAGACCTAGG - Intergenic
1015094039 6:129393276-129393298 TATCTTAATCTCAGAAGGTTGGG + Intronic
1015709384 6:136122481-136122503 GATCTTAGGCATAGAAGGTTGGG - Intronic
1015899255 6:138047588-138047610 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1016729143 6:147408677-147408699 TATCATATGCCCAGAGGGCGTGG - Intergenic
1017130214 6:151102195-151102217 TTTCTAAGGCCCACAGGGCTAGG + Intergenic
1018489671 6:164279341-164279363 CATCATAGGCCTAGAGGCTTAGG + Intergenic
1021753986 7:23833569-23833591 TATTATAGGCCCAGAGGCCTAGG + Intergenic
1022703451 7:32782206-32782228 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1022784719 7:33627068-33627090 CATCATAGGCCCGGAGGGTTAGG + Intergenic
1023710491 7:42987341-42987363 TATCTTAGATGCAGAGAGTTGGG - Intergenic
1024064458 7:45720914-45720936 AATCTGAGGCCCAGAGAGGTTGG + Exonic
1027433632 7:78140798-78140820 TATGCTAGGCCCAGAGGGGAAGG + Intronic
1027624708 7:80531852-80531874 TATCATAGACCCAGAGGCCTAGG + Intronic
1027627565 7:80564335-80564357 CATGTTGTGCCCAGAGGGTTTGG - Intronic
1027681098 7:81222853-81222875 TATCATAGGCCCAGAGGCCTAGG + Intergenic
1027996729 7:85434417-85434439 CATCGCAGGCCCAGAGGTTTAGG + Intergenic
1028082973 7:86600403-86600425 GATGTTGAGCCCAGAGGGTTTGG + Intergenic
1028285877 7:88998288-88998310 TATCTTAAACTGAGAGGGTTTGG + Intronic
1028314455 7:89383476-89383498 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1028360061 7:89956258-89956280 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1028830331 7:95320794-95320816 TCTCTTAGGCCCAGAACATTTGG - Intronic
1029120093 7:98261953-98261975 CATCACAGGCCCAGAGGCTTAGG - Intronic
1030108533 7:106007212-106007234 CATCACAGGCCCAGAGGTTTAGG - Intronic
1030169654 7:106588608-106588630 TAGCAAAGGCCCAGAGGGTTTGG + Intergenic
1030440130 7:109579120-109579142 GGGCTTAGACCCAGAGGGTTGGG - Intergenic
1030653270 7:112138763-112138785 TATATTAGGTCCTGAGGGTGGGG + Intronic
1030904323 7:115163314-115163336 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1030930933 7:115522394-115522416 TATCACAGGCCCAGAGGCTTAGG - Intergenic
1031618290 7:123905926-123905948 TATCACAGGCCCAGAGGCCTAGG - Intergenic
1031793821 7:126145273-126145295 TATAATATTCCCAGAGGGTTTGG + Intergenic
1033483054 7:141760597-141760619 TATCACAGGCCCAGAGGTCTTGG - Intronic
1033716624 7:144009511-144009533 CATCACAGGCCCAGAGGCTTAGG + Intergenic
1035896198 8:3405526-3405548 CATCTGAGGCGCTGAGGGTTAGG - Intronic
1036109232 8:5879109-5879131 TAAATAAGGCCCATAGGGTTAGG + Intergenic
1037264978 8:17048698-17048720 TATCTTGAGCCCAGGAGGTTGGG - Intronic
1039000828 8:32978385-32978407 TAGCTTTATCCCAGAGGGTTTGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1040097948 8:43466383-43466405 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1042052953 8:64731702-64731724 CATCATAGGCCCAGAGGCCTAGG + Intronic
1043623729 8:82229562-82229584 CATCACAGGCCCAGAGGCTTAGG + Intergenic
1044028879 8:87210478-87210500 TATGATAGGCCCAGAGGCTAAGG + Intronic
1045785708 8:105918384-105918406 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1046314299 8:112479501-112479523 CATCACAGGCCCAGAGGCTTAGG + Intronic
1048419296 8:134261432-134261454 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1048705966 8:137154345-137154367 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1048758586 8:137766850-137766872 CATCATAGGCCCAGAGGACTAGG + Intergenic
1048769682 8:137882480-137882502 CATCACAGGCCCAGAGGCTTAGG + Intergenic
1049903193 9:189705-189727 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1050255571 9:3789184-3789206 CATCACAGGCCCAGAGGGCTAGG + Intergenic
1050274865 9:3986121-3986143 TATCTTAGAGCCACTGGGTTTGG + Intronic
1050514441 9:6428632-6428654 TCGCTTAAGCCCAGAAGGTTGGG - Intronic
1051097008 9:13477632-13477654 TATGTGGAGCCCAGAGGGTTTGG - Intergenic
1052526821 9:29629428-29629450 TATCATAGGCCCAGAGGCCTAGG + Intergenic
1052599098 9:30600667-30600689 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1052701294 9:31941213-31941235 CATCAGAGGCCCAGAGGCTTAGG + Intergenic
1053072170 9:35107953-35107975 GCTCTTAGGCCCAGAGGGACCGG - Exonic
1053455739 9:38231990-38232012 TCTCTTGGGCCCTTAGGGTTAGG + Intergenic
1053746204 9:41199987-41200009 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1054481064 9:65665230-65665252 CATCACAGGCCCAGAGGTTTAGG + Intergenic
1054682141 9:68231293-68231315 CATCACAGGCCCAGAGGTTTAGG + Intergenic
1054792015 9:69265300-69265322 TAACTTAGTCCTAAAGGGTTAGG - Intergenic
1055497184 9:76867263-76867285 TATCTTATGCGGAGAGGGTAGGG + Intronic
1055698607 9:78917052-78917074 CATCACAGGCCCAGAGGTTTAGG + Intergenic
1055713379 9:79089258-79089280 TATCACAGACCCAGAGGCTTAGG - Intergenic
1056695408 9:88846272-88846294 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1057876295 9:98756930-98756952 TAACTGAGGCCCAGAGAGCTCGG - Intronic
1057970007 9:99545591-99545613 TATCATAGGCCCAGAGGGCCAGG - Intergenic
1059318159 9:113444951-113444973 TTCCTTAGGCCCAGATGGTGGGG - Intronic
1060383225 9:123197229-123197251 TATCAGAGGCCGAGAGGGTGGGG + Intronic
1062178212 9:135176097-135176119 TGTCTCAGGCCCAGAGCTTTGGG - Intergenic
1202782334 9_KI270718v1_random:10760-10782 CATCACAGGCCCAGAGGTTTAGG - Intergenic
1187894464 X:23967210-23967232 CATCACAGGCCCAGAGGCTTAGG - Intergenic
1188016440 X:25112331-25112353 CATCATAGGCCCAGAGGCCTAGG - Intergenic
1188325570 X:28797180-28797202 CATCATAGGCCCAGAGGTTTAGG - Intronic
1188766052 X:34092556-34092578 TATCTCAGTCCCCCAGGGTTGGG - Intergenic
1188961929 X:36502631-36502653 CATCATAGGCCCACAGGCTTAGG - Intergenic
1188962410 X:36508258-36508280 CATCACAGGCCCAGAGGGCTAGG - Intergenic
1188997561 X:36904706-36904728 CATCACAGGCCCAGAGGTTTAGG + Intergenic
1189633302 X:42977447-42977469 TGTCTCAGGACCAGAGGTTTGGG - Intergenic
1190794058 X:53725033-53725055 CATCACAGGCCCAGAGGGCTAGG + Intergenic
1191089589 X:56606007-56606029 AGTCTGAAGCCCAGAGGGTTTGG - Intergenic
1193237857 X:79131048-79131070 CATCATAGACCCAGAGGCTTAGG + Intergenic
1193442880 X:81565020-81565042 CATCATAGGCCCTGAGGCTTAGG + Intergenic
1194019525 X:88669434-88669456 TATCATAGGCCGAGAGGTCTAGG - Intergenic
1194082594 X:89486902-89486924 TGTCACAGGCCCAGAGGCTTAGG - Intergenic
1194139485 X:90192278-90192300 TTTCTTGGGCCCAGAGGTTGAGG - Intergenic
1194497427 X:94635164-94635186 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1195196041 X:102498909-102498931 TATCACAGGCCCAGAGGCCTAGG + Intergenic
1196246252 X:113403793-113403815 CATCACAGGCCCAGAGGCTTAGG + Intergenic
1196574509 X:117302464-117302486 TGTGTGAAGCCCAGAGGGTTTGG - Intergenic
1197058885 X:122153649-122153671 CATCATAGGCCCAGAGGCCTAGG + Intergenic
1197392341 X:125883326-125883348 CATCACAGGCCCAGAGGGCTAGG + Intergenic
1197510252 X:127361942-127361964 CATCACAGGCCAAGAGGGTTAGG - Intergenic
1197561278 X:128024903-128024925 CATCATAGGTCCAGAGGTTTAGG - Intergenic
1197581856 X:128294056-128294078 TATCTCAGGCCCAGAGGCCTAGG + Intergenic
1199334370 X:146600917-146600939 TAGCTTAGGCCCAGCAGGCTAGG - Intergenic
1200381562 X:155842808-155842830 CATCACAGGCCCAGAGGTTTGGG + Intergenic
1200485228 Y:3761224-3761246 TTTCTTGGGCCCAGAGGTTGAGG - Intergenic
1201767762 Y:17588621-17588643 TGTCTTGAGCCCAGAGAGTTAGG + Intergenic
1201833791 Y:18317364-18317386 TGTCTTGAGCCCAGAGAGTTAGG - Intergenic